|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 24 August 2005
doi: 10.1242/dev.01958
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

MRC Centre for Developmental Neurobiology and Randall Division for Cell and Molecular Biophysics, New Hunt's House, King's College London, London SE1 1UL, UK
Author for correspondence (e-mail:
simon.hughes{at}kcl.ac.uk)
Accepted 27 June 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Fibroblast growth factor 8, Muscle, Zebrafish, Fast, Myod, Somite
| Introduction |
|---|
|
|
|---|
Expression of members of the Myod family of myogenic regulatory
transcription factors (MRFs) is known to commit cells to myogenesis and
control their terminal differentiation
(Buckingham, 2001
). The MRF
myf5 is expressed in posterior presomitic mesoderm in presumptive
fast muscle precursors. myf5 expression declines in anterior
presomitic mesoderm, but is transiently re-expressed in the posterior border
of each somite as it forms (Chen et al.,
2001
; Coutelle et al.,
2001
). Expression of the MRF myod coincides with that of
myf5 in the posterior lateral somite from the six somite stage (6s)
(Coutelle et al., 2001
;
Weinberg et al., 1996
).
myod expression is maintained in the posterior region of the first
six and all subsequently formed somites until the cells begin to differentiate
into fast muscle around the 15-somite stage, when it is downregulated
(Weinberg et al., 1996
). A
third MRF, myogenin, which is often associated with terminal differentiation,
is expressed in posterior somite border cells after myod but prior to
their terminal differentiation (Weinberg
et al., 1996
). The signals regulating MRF expression in fast
muscle precursors are unknown.
During a search for signals that might regulate fast myogenesis, we noticed
that zebrafish fibroblast growth factor 8 (fgf8) gene is
expressed in a stripe in the anterior of zebrafish somites with a similar
timecourse to myod expression in the posterior
(Furthauer et al., 1997
;
Reifers et al., 1998
). The
expression of fgf8 and MRFs are also temporally alike in amniote
somites (Crossley and Martin,
1995
; Maruoka et al.,
1998
; Stolte et al.,
2002
). Thus, Fgf8 is expressed in space and time such that it
could regulate myogenesis.
The seminal work of Hauschka showed that distinct myogenic cell populations
are differentially sensitive to Fgfs, but the relevance of these findings to
myogenesis in vivo have been unclear. Some cultured myoblasts require Fgf for
differentiation, whereas in others differentiation is repressed by Fgf
(Seed and Hauschka, 1988
).
Fgfs signal through tyrosine kinase Fgf receptors, several of which are
expressed in zebrafish somites, although their role there is unknown
(Klint and Claesson-Welsh,
1999
; Thisse et al.,
1995
; Tonou-Fujimori et al.,
2002
). In fish, a mutation in fgf8 has been reported to
diminish myod expression (Reifers
et al., 1998
). In Drosophila, the heartless Fgf8
receptor is required for formation of a subset of somatic muscles
(Michelson et al., 1998
).
Manipulation of Fgf levels or signalling pathways in amniotes alters early
muscle patterning. In the chick limb, both Fgfr1 and Fgfr4 signalling appear
to promote differentiation (Flanagan-Steet
et al., 2000
; Marics et al.,
2002
). By contrast, blockade of somitic Fgfr1 results in premature
muscle differentiation and prevents muscle precursors from migrating
(Itoh et al., 1996
). In the
chick somite, Fgfr1 is widely expressed, whereas Fgfr4 is particularly
abundant in precursors of body wall, limb and oculomotor muscles
(Marcelle et al., 1994
). Thus,
the effect of Fgf signalling may depend on the receptor and the recipient cell
type. Overexpression of fgf4 or fgf8 in the limb decreases
the expression of myod, fgfr4 and the number of muscle cells and
induces tendon-specific markers
(Edom-Vovard et al., 2001
;
Edom-Vovard et al., 2002
). In
the somite, however, the formation of muscle and tendon can be promoted by the
addition of Fgf (Brent and Tabin,
2004
; Itoh et al.,
1996
; Marics et al.,
2002
). In conclusion, several Fgfs, including Fgf8, are implicated
in regulating myogenesis in vivo.
Fgf8 is expressed in the tail bud of vertebrate embryos, as well
as in the somites. This tail bud expression is implicated in the formation of
somite boundaries (Dale and Pourquie,
2000
; Dubrulle et al.,
2001
; Sawada et al.,
2001
). However, ablation of fgf8 in the mouse leads to
embryonic lethality by day E9.5, owing to malformations of the heart
(Frank et al., 2002
;
Moon and Capecchi, 2000
;
Sun et al., 1999
). Compound
heterozygotes and conditional mutants have implicated fgf8 in various
aspects of development but have yet to test its role in myogenesis
(Abu-Issa et al., 2002
;
Frank et al., 2002
;
Meyers et al., 1998
;
Meyers and Martin, 1999
;
Moon and Capecchi, 2000
;
Trumpp et al., 1999
). Overall,
the pleiotropic patterning defects observed in Fgf manipulations and the
difficulty of distinguishing myogenic cell subpopulations in amniotes have
severely hampered analysis of the role of Fgfs in amniote myogenesis in
vivo.
In the zebrafish, Fgf signalling promotes posterior mesoderm development
and can influence somite border positioning
(Cao et al., 2004
;
Draper et al., 2003
;
Griffin et al., 1995
;
Sawada et al., 2001
). The
loss-of-function fgf8 mutant acerebellar (ace)
exhibits only mild somite defects (Draper
et al., 2003
; Reifers et al.,
1998
). Despite morphological changes, somites form and some
embryonic myogenesis is present. Overall, however, the function of somitic
fgf8 expression and its role in myogenesis is unclear.
Here, we identify a new cell population in the lateral somite, the lateral fast myoblasts (LFM) that is dependent on Fgf signalling. Fgf8 is required for the initiation and maintenance of myod and myogenin, but not myf5, expression in LFMs. Lack of Fgf signalling leads to failure of both dermomyotomal marker downregulation and lateral fast fibre (LFF) differentiation. So Fgf8 drives progression of the myogenic program but not the initiation of myogenesis in these cells. Strikingly, residual medial fast fibres are unaffected by the loss of Fgf signalling, even in the absence of Hh signalling, indicating that MFFs and LFFs may constitute distinct cell populations. Our findings reveal a specific pro-myogenic role for Fgf8 in the lateral somite.
| Materials and methods |
|---|
|
|
|---|
In situ mRNA hybridisation and immunohistochemistry
In situ mRNA hybridisation was as described previously
(Coutelle et al., 2001
).
Embryos were fixed in 4% paraformaldehyde (PFA) for at least 30 minutes at
28°C and fluorescein- or digoxigenin-tagged probes made with Roche
labelling mix to full-length myf5-coding sequence (pJG1-Myf5),
mylz2 (Xu et al.,
1999
), pax3 (Seo et
al., 1998
), myod or myogenin
(Weinberg et al., 1996
)).
Embryos were fixed for antibody staining with 4% PFA for 30 minutes at
28°C or Carnoy's (Barresi et al.,
2000
), mounted in 1.5% agarose blocks in 5% sucrose, which were
subsequently soaked overnight in 30% sucrose. Cryosections were cut at 10-15
µm, dried, washed with PBTw (PBS 0.1% Tween20), blocked with 5% goat/horse
serum in PBTw (according to host of secondary antibody) for 1 hour at room
temperature, incubated with primary antibodies A4.1025
(Blagden et al., 1997
), S58
(Devoto et al., 1996
) or EB165
(Blagden et al., 1997
) diluted
in block overnight at 4°C, and detected as described
(Blagden et al., 1997
).
Wholemounts were treated similarly, but using HRP-conjugated class-specific
antibodies (Vector) and DAB detection or triple stained for 4D9 (DSHB),
A4.1025 and DAPI using Alexa-conjugated subclass-specific secondary antibodies
(Molecular Probes) and Citifluor mount.
Embryo manipulations
Embryos were injected at the one- to two-cell stage with fgf8
morpholino (gagtctcatgtttatagcctcagta, 7-10 ng from 2.5 mg/ml stock) and
rhodamine as described (Westerfield,
1995
). Cyclopamine (200 µM, or ethanol control) was added from
50% epiboly. Embryos were dechorionated at the six-somite stage
(Westerfield, 1995
), placed in
1% agarose-coated dishes with SU5402 (Calbiochem, 60 µM) or DMSO control.
Fgf8 bead implantation above nascent somites was performed at the 10-somite
stage and analysed at the 15-somite stage as described
(Reifers et al., 2000b
).
| Results |
|---|
|
|
|---|
|
The early defect in fast muscle terminal differentiation persists. We examined accumulation of fast MyHC, which normally marks all fast fibres, at 33 hpf. Embryos with blocked Fgf signalling have a reduced population of fibres with lower levels of fast MyHC in the medial somite, and significantly less fast MyHC in the lateral somite (Fig. 2B; 25/25 and 62/63 SU5402- and Fgf8 MO-treated 24 hpf embryos, respectively). Thus, fast fibre differentiation is inhibited, rather than delayed.
Fgf8 does not appear to be required for slow myogenesis. At 15 s, slow MyHC is detected in two medial stripes adjacent to the notochord of SU5402- or Fgf8 MO-treated or ace mutant embryos, just as in controls (Fig. 2C and data not shown). By 33 hpf in unmanipulated embryos, most slow fibres have migrated to lie close to the superficial somite surface (Fig. 2D). After blockade of Fgf8, slow muscle fibres are present in the correct orientation, although sometimes appear immature. MP-like fibres are present adjacent to the notochord at the dorsoventral midline. In addition, slow fibres superficial to the residual fast muscle suggest that migration commences normally (Fig. 2D). However, superficial slow fibres, particularly those near the dorsoventral midline, fail to reach their normal position close to the ectoderm and significantly more unlabelled tissue separates the slow muscle fibres from the ectoderm (Fig. 2D). Thus, inhibition of Fgf8 function prevents formation of a lateral population of fast fibres required for normal myogenesis.
|
The medial myod expression remaining after blockade of Fgf8
signalling is not confined to slow muscle cells. A group of cells in the
medioposterior region of each somite retains myod expression
(Fig. 3A, black arrows). The
extent of lateral myod expression across the posterior somite was
measured by counting cells in somites 4-6 and 13-15 of flatmounted 15 s
embryos. Although somite width is not significantly altered in either Fgf8 MO-
or SU5402-treated embryos, at around 11 cells in each case,
70% the cells
of the posterior somite border lose myod mRNA in response to either
treatment (Table 1). In the
case of ace, somite shape is altered such that the posterior somite
border contains fewer cells. Nevertheless, the number of residual
myod-expressing cells is similar to that in morphant and
SU5402-treated embryos (Table
1). Therefore, Fgf8 morphant, SU5402-treated and ace
mutant embryos are similar with respect to loss of myod expression,
indicating that Fgf8 is required for myod initiation in the zebrafish
lateral somite.
|
Although myod has been implicated as a key regulator of myogenesis
in the lateral amniote somite, myf5 is also expressed in lateral
myogenic cells of both amniotes and fish
(Coutelle et al., 2001
;
Hadchouel et al., 2003
). In
fish, myf5 is the first MRF gene expressed in fast muscle precursors,
being expressed in the tailbud, declining in anterior presomitic mesoderm and
then re-accumulating transiently coincident with myod expression in
posterior somite border cells as each somite forms
(Coutelle et al., 2001
).
Ablation of Fgf8 function or signalling does not prevent myf5
expression in the lateral somite; indeed, expression often appears to persist
at higher than control levels in anterior somites
(Fig. 3A; 215/215, 56/56 and
9/35; Fgf8 MO, SU5402 and ace heterozygous cross embryos,
respectively). Thus, the Fgf system is required to permit myogenesis to
proceed from the initiation of myf5 to the upregulation of
myod and myogenin.
|
Fgf8 induces myod within the somite
The fact that addition of SU5402 after somite segmentation has commenced
leads to downregulation of myod expression in all somites strongly
suggests that Fgf signalling within the somite drives myod
(Fig. 3A). To prove that Fgf8
can induce myod expression locally within the somite, we applied a
bead with Fgf8 protein above the somites on one side of the animal.
Fgf8-soaked beads induce a dramatic unilateral or bilateral upregulation of
myod, whereas control beads either do not affect myod mRNA
expression, or diminish expression if implantation physically disrupts the
somite (Fig. 3B). Even when
initiation of myod expression in the lateral somite is ablated by
Fgf8 MO, an Fgf8 bead implanted above the somites can rescue myod
expression (Fig. 3C). Fgf8
beads also drive increase in myod transcripts in the anterior somite
(Fig. 3B). Thus, local
signalling by Fgf8 within the somite drives myod expression.
|
When lateral fast myogenesis is inhibited with SU5402 or by Fgf8 MO
injection, lateral somite cells retain pax3 expression
(Fig. 4F; data not shown).
Transverse sections reveal that the normal restriction of most readily
detectable pax3 expression to the dorsal and ventral extremes of the
lateral somite fails to occur in embryos lacking Fgf signalling, leaving
pax3 mRNA in a broad lateral layer
(Fig. 4F). SU5402 also
upregulates pax3 in the dorsal neural tube. A second marker of
nascent somitic cells is meox mRNA
(Neyt et al., 2000
). After
somite formation, meox is downregulated and becomes restricted to
lateral somite cells in a manner similar to pax3
(Fig. 4G). Upon Fgf8 MO
injection, meox is upregulated in the lateral somite region where
fast muscle fails to form (Fig.
4G). A third gene, wnt11r, is expressed transiently in a
superficial region of the dorsal somitic extreme and neural tube of control
embryos, similar to pax3 (Fig.
4H). wnt11r is also more highly expressed in both dorsal
somitic tissue and neural tube of SU5402-treated embryos
(Fig. 4I). Thus, Fgf8
signalling is required for downregulation of pax3, meox and probably
wnt11r, and upregulation of myod and myogenin in
the somite.
Fgf signalling is required for myod maintenance
The persistent expression of fgf8 and erm in maturing
somites suggested that Fgf signalling continues until the period of fast
muscle differentiation (Fig.
1). To determine whether Fgf signalling continues to be required
for maintenance of somitic myod expression, SU5402 was applied to
older embryos (schematised in Fig.
5A). From 6-10 s, myod is expressed strongly in a
posterior stripe in all somites (Fig.
1A, Fig. 5B). When
SU5402 treatment is initiated between 6 s and 10 s, lateral expression of
myod begins to decline within 30 minutes and is lost throughout the
axis 1 hour later, both in new somites formed during the treatment period and
in old somites that were expressing myod laterally prior to treatment
(Fig. 5C-G). However, medial
myod expression in adaxially derived cells is retained. SU5402
treatment from 10 s to 15 s prevents myod expression in nascent
somites and also in older somites, although the reduction is less marked in
the most anterior somites (Fig.
5H,I). Conversely, washout of SU5402 at 15 s is followed by a
rapid recovery of lateral myod expression
(Fig. 5J). The Fgf signalling
pathway is required, therefore, for maintenance of myod expression in
the lateral somite.
|
Residual medial fast muscle is not Hh dependant
Although reduction of Fgf signalling ablates lateral fast muscle
differentiation, medial fast myogenesis still occurs. Hh proteins derived from
ventral midline tissues are required for adaxial slow myogenesis
(Barresi et al., 2000
;
Blagden et al., 1997
;
Du et al., 1997
) and for
engrailed expression in the specialized medial fast fibres (MFF)
(Wolff et al., 2003
). We
investigated the relationship between the Fgf8-independent fast fibres and
MFFs (Fig. 6). Treatment of
wild-type embryos with Hh signalling inhibitor cyclopamine leads to loss of
myod expression in adaxial slow muscle cells but has no noticeable
effect on myod expression in the fast muscle precursors
(Fig. 6A,C; 86/92 treated
embryos). Exposure to both cyclopamine and SU5402 leads to embryos with a
residual medial posterior group of myod-expressing cells in each
somite but lacking both adaxial and lateral expression
(Fig. 6D, 90/98 treated
embryos). Thus, the effects of the two drugs appear additive. Subsequently, a
small quantity of residual fast muscle forms, but not slow muscle (data not
shown). Similar results are obtained after SU5402 treatment of
you-too (yot) mutant embryos, which lack slow myogenesis
owing to a mutation in the Gli2 component of the Hh signalling pathway
(Fig. 6E,F). Taken together,
these data show that Hh signalling is not responsible for the resistance of
residual fast fibres to reduction in Fgf signalling.
|
The Hh- and Fgf8-independence of medial fast muscle raised the possibility
that a distinct population of MFF precursors form in the medial somite
dependent on another midline signal. We tested this hypothesis by examining
the role of Fgf signalling in floatinghead (flh) mutants,
which lack ventral midline tissues and have bilateral somites fused at the
midline beneath the neural tube (Halpern
et al., 1995
). flh mutants lack adaxial myod
expression at 15 s but retain a single stripe of myod expression in
the posterior of each forming somite
(Coutelle et al., 2001
).
Treatment with SU5402 essentially ablates the posterior somitic myod
stripes (28/108 treated embryos from heterozygous flh/+ crosses;
Fig. 6H). However, SU5402 does
not suppress anterior myod expression underlying and flanking the
neural tube, which may be within the delayed differentiating slow muscle
observed in flh mutants (Blagden
et al., 1997
). In conclusion, the flh gene is required
for formation of most, if not all, medial Fgf8- and Hh-independent
myod-expressing cells but not for lateral Fgf8-dependent
myod-expressing cells.
| Discussion |
|---|
|
|
|---|
Fgf8 drives lateral fast myogenesis
Defects in Fgf8 morphants and ace mutants demonstrate that lateral
cells in the posterior zebrafish somite require Fgf8 signalling to initiate
the expression of myod and, subsequently, to undergo terminal
differentiation into fast muscle fibres. Several lines of evidence indicate
that Fgf8 signalling is required during and after somite border formation,
rather than earlier in development. First, fgf8 is expressed in
anterior regions of both immature and mature somites. Second, expression of
the immediate Fgf target gene, erm, and its inhibition by exposure to
the Fgf receptor antagonist SU5402 after somite border formation, indicate
that Fgf-like signalling persists in the posterior region of maturing somites.
Third, ectopic Fgf8 exposure after somite border formation upregulates
myod expression. Fourth, SU5402 rapidly blocks lateral myod
expression in somites. Fifth, the effect of SU5402 is reversible, leading to
myod re-expression in the posterior somite. Sixth, loss of
myod induction is accompanied by persistence of markers of the
immature posterior somite border, such as myf5, pax3 and
meox, which themselves are essential markers of subsets of myogenic
precursors in mouse (Kassar-Duchossoy et
al., 2004
; Mankoo et al.,
1999
; Tajbakhsh et al.,
1997
). Thus, Fgf8 functions as a muscle differentiation factor in
this in vivo context in zebrafish.
|
Myogenin is the MRF directly responsible for most murine muscle
differentiation (Venuti et al.,
1995
). In zebrafish lateral somite, myogenin expression
follows that of myod after a delay
(Weinberg et al., 1996
). As
Fgf8 blockade prevents lateral myogenin expression, an explanation
could be that in zebrafish, as in mice, Myod drives myogenin
expression in the lateral somite (Bergstrom
et al., 2002
; Rudnicki et al.,
1993
). Moreover, lack of myogenin may contribute to the failure of
terminal differentiation we observe.
Decline in myod expression in ace mutants has previously
been suggested to result from effects on earlier mesodermal patterning during
gastrulation or tail bud outgrowth (Draper
et al., 2003
; Reifers et al.,
1998
). However, myf5, pax3 and meox expression
are initiated in a near normal pattern at presumptive somite boundaries in
ace, Fgf8 MO- and SU5402-treated embryos, suggesting that anterior
presomitic mesoderm is capable of undergoing normal myogenic patterning. Other
signals in addition to Fgf8 must pattern myf5 expression in this
region.
Our data confirm that Fgf-like signalling has a significant role in tail
bud outgrowth. Early blockade of Fgf signalling with dominant-negative
constructs or SU5402 truncates embryos and disrupts gastrulation
(Draper et al., 2003
;
Griffin et al., 1995
). We also
demonstrate that expression of the earliest known myogenic marker,
myf5, is disrupted in the tailbud region and posterior presomitic
mesoderm by SU5402 inhibition of Fgf-like signalling. However, in zebrafish,
other Fgf genes contribute to tailbud Fgf signalling so that ablation of
fgf8 function does not prevent reasonable somite development
(Draper et al., 2003
;
Reifers et al., 1998
).
Although fgf8 is expressed in amniote somites
(Edom-Vovard and Duprez, 2004
;
Maruoka et al., 1998
;
Stolte et al., 2002
;
Vogel et al., 1996
), the role
of Fgf8 in somite myogenesis is unknown owing to the pleiotropic roles of Fgf8
(Brent et al., 2003
;
Frank et al., 2002
;
Moon and Capecchi, 2000
;
Sun et al., 1999
). However,
numerous experiments show that Fgfs can promote formation of differentiated
muscle both in vivo and in vitro
(Flanagan-Steet et al., 2000
;
Marics et al., 2002
;
Seed and Hauschka, 1988
). The
`community effect' that regulates myogenesis in Xenopus is mediated
by early-acting Fgf signalling (Fisher et
al., 2002
; Standley et al.,
2001
). Although eFGF (an fgf4/6 homologue) is a candidate
mediator of the community effect in vivo, fgf8 is also expressed in
nascent Xenopus somites just when fast muscle is differentiating and
in a pattern remarkably similar to that in zebrafish
(Grimaldi et al., 2004
;
Moreno and Kintner, 2004
).
Moreover, interruption of Fgf signalling can inhibit somitic myogenesis
(Marics et al., 2002
). Our
findings do not rule out involvement of other Fgfs, particularly the close
homologues Fgf17 and Fgf17b (Cao et al.,
2004
; Reifers et al.,
2000a
), in somitic myogenesis in zebrafish. Interestingly, in
Drosophila, Fgf8-like factors have recently been identified as
signals required for generation of a subset of somatic muscles
(Gryzik and Muller, 2004
;
Michelson et al., 1998
). We
speculate that triggering myogenic progression within the mesoderm may be an
evolutionarily conserved function of Fgf8 signalling.
Fgf signalling maintains myod
Fast fibre differentiation in rostral somites is significantly delayed
(about 3 hours at 28°C) relative to initiation of myod expression
(Blagden et al., 1997
). Fgf
signalling maintains myod expression during this delay. SU5402
treatment decreases lateral myod expression in somites that express
myod prior to treatment. This maintenance function may persist until
fast fibre terminal differentiation. Maintenance may not be required in caudal
somites as fast fibres differentiate soon after myod initiation.
The normal decline of myod expression in rostral somites of
wild-type embryos with age parallels terminal differentiation of the lateral
fast cells. However, residual myod expression remains in older
anterior somites and this is relatively insensitive to SU5402 treatment. We
suggest this Fgf-independent myod expression is in other cell
populations, such as the migrating SSFs (see discussion of flh
below). A requirement for Fgf8 only up until terminal differentiation is
consistent with the loss of most somitic expression of fgf8 at later
stages (Roehl and Nüsslein-Volhard,
2001
).
It is notable that loss of Fgf8 function does not reduce fast muscle as much as might be predicted from the severe early reduction of myod expression in the lateral somite. Consistently, myogenin reduction is less marked than that of myod. Some recovery of fast differentiation could be driven by later-acting Fgfs. Alternatively, differentiation of somitic cells that do not express myod early may partially rescue fast myogenesis. The extent to which residual medial fast fibres are structurally and functionally normal remains to be determined.
A Fgf8- and Hh-independent population of medial fast fibres
Our results show that medial somite cells, including both slow and medial
fast muscle precursors, are not dependent on Fgf signalling and can express
myod and undergo terminal differentiation in the presence of SU5402,
Fgf8 MO and in ace mutants. This may explain why previous studies
have concluded that there is only a mild posterior mesoderm or anteroposterior
patterning defect in ace and Fgf8 MO-injected embryos
(Draper et al., 2003
;
Reifers et al., 1998
).
A unique population of medial fibres distinct from MPs express low levels
of Engrailed (Devoto et al.,
1996
; Hatta et al.,
1991
). These multinucleate fast fibres express Engrailed in
response to late Hh signalling and have been named MFF
(Roy et al., 2001
;
Wolff et al., 2003
). The
Fgf8-independent residual fast fibres include cells capable of forming MFFs,
based on their location, fast character and continued Engrailed expression in
fgf8 mutants or after SU5402 treatment. Strikingly, however, our
cells do not require Hh signalling for myod expression or terminal
differentiation. Engrailed expression is not extensive enough to account for
all residual fast fibres. Thus, late Hh may act upon these cells to promote
Engrailed expression (Wolff et al.,
2003
). Fast fibre terminal differentiation may be required prior
to Hh signalling.
The medial location of our residual fast fibres indicates that midline
patterning may be important for their formation. Although Hh signalling is
required for medial slow muscle formation
(Barresi et al., 2000
;
Blagden et al., 1997
;
Du et al., 1997
;
Schauerte et al., 1998
), our
results demonstrate that neither Hh signalling nor slow muscle is required for
residual fast fibre initiation, as medial myod expression is observed
in yot mutants and in embryos treated with the Hh signalling
antagonist cyclopamine. Moreover, blockade of Hh signalling after initiation
of myod expression demonstrates that Hh signalling is not required
for the maintenance of myod expression in these cells. Nevertheless,
the flh mutation leads to ablation of essentially all myod
expression in the posterior somite. The homeobox transcription factor Flh is
required for notochord formation but is expressed more broadly in midline
tissue at early stages (Talbot et al.,
1995
). So either a non-Hh notochord-derived signal or a
cell-autonomous action of Flh in somite precursors may control medial fast
fibre initiation. Residual snail1 expression is present in medial
cells of ace mutant embryos, highlighting a possible role for Snail1
in the initiation of myod expression
(Reifers et al., 1998
). The
cellular and molecular origin of our residual fast fibres requires further
study.
Slow fibres form and migrate without Fgf8
Slow MP and SSF fibres form in the absence of Fgf8. Whether other Fgf
signalling might be required for slow fibre formation is uncertain because
early SU5402 treatment disrupts gastrulation. SSF normally migrate laterally
to lie superficial to fast muscle, but under a dermomyotome-like external cell
layer (see below). Although SSFs come to lie lateral to the residual fast
fibres in embryos with defective Fgf8 signalling, they fail to cross the
enlarged domain of undifferentiated lateral somitic tissue. This correlation
raises the possibility that the lateral displacement of slow muscle is
dependant on differentiation of fast muscle.
Expansion of dermomyotome-like tissue in the absence of Fgf8 signalling
We examined expression of several zebrafish homologues of molecules that
mark amniote dermomyotome. pax3 and meox genes mark
many/most cells in nascent somites, but subsequently become more restricted.
Pax3 is observed in thin cells on the somite surface, probably the
`external cells' (Waterman,
1969
). We have also observed Pax7 protein in this superficial cell
layer in a variety of fish species (Devoto
et al., 2005
). meox is expressed in a subset of cells at
the somite surface. A zebrafish gene denominated wnt11r has greater
sequence homology to murine Wnt11 than the gene originally named
wnt11 in zebrafish (J. Minchin, unpublished, see
www.ensembl.org).
Like mouse Wnt11 (Christiansen et
al., 1995
), zebrafish wnt11r is expressed in the
dorsomedial corner of the nascent zebrafish somite. Thus, cells near the
superficial surface of the zebrafish somite share a number of molecular
characteristics with amniote dermomyotome.
In the absence of Fgf8 signalling, the dermomyotome-like markers are upregulated in the lateral somite, suggesting that cells failing to undergo myogenesis maintain a character similar to that of immature somites. Thus, lack of Fgf signalling does not lead to death of lateral somite cells, but causes them to remain in a less differentiated state, perhaps awaiting further signals. High, possibly unphysiological, levels of Fgf8 from implanted beads appear to drive ectoptic myod expression in anterior somite cells. Nevertheless, the block on differentiation caused by Fgf signalling blockade can be relieved by removal of the blockade or application of exogenous Fgf8 with the recovery of a near-normal myod expression pattern. It seems the myogenic program can be arrested and resumed in lateral cells with no obvious delay or defect from control embryos. Thus, the blocked cells appear to retain a `memory' for their fate that allows Fgf signalling to promote rapid myod mRNA accumulation. These findings suggest that rising Fgf8 within the somite controls the timing of myod expression in the lateral cells, but may not be responsible for the spatial restriction of expression to the posterior somite border.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Abu-Issa, R., Smyth, G., Smoak, I., Yamamura, K. and Meyers, E.
N. (2002). Fgf8 is required for pharyngeal arch and
cardiovascular development in the mouse. Development
129,4613
-4625.
Barresi, M. J., Stickney, H. L. and Devoto, S. H. (2000). The zebrafish slow-muscle-omitted gene product is required for Hedgehog signal transduction and the development of slow muscle identity. Development 127,2189 -2199.[Abstract]
Bergstrom, D. A., Penn, B. H., Strand, A., Perry, R. L., Rudnicki, M. A. and Tapscott, S. J. (2002). Promoter-specific regulation of MyoD binding and signal transduction cooperate to pattern gene expression. Mol. Cell 9,587 -600.[CrossRef][Medline]
Blagden, C. S., Currie, P. D., Ingham, P. W. and Hughes, S.
M. (1997). Notochord induction of zebrafish slow muscle
mediated by Sonic Hedgehog. Genes Dev.
11,2163
-2175.
Bober, E., Franz, T., Arnold, H. H., Gruss, P. and Tremblay, P. (1994). Pax-3 is required for the development of limb muscles: A possible role for the migration of dermomyotomal muscle progenitor cells. Development 120,603 -612.[Abstract]
Brent, A. E. and Tabin, C. J. (2004). FGF acts
directly on the somitic tendon progenitors through the Ets transcription
factors Pea3 and Erm to regulate scleraxis expression.
Development 131,3885
-3896.
Brent, A. E., Schweitzer, R. and Tabin, C. J. (2003). A somitic compartment of tendon progenitors. Cell 113,235 -248.[CrossRef][Medline]
Buckingham, M. (2001). Skeletal muscle formation in vertebrates. Curr. Opin. Genet. Dev. 11,440 -448.[CrossRef][Medline]
Cao, Y., Zhao, J., Sun, Z., Zhao, Z., Postlethwait, J. and Meng, A. (2004). fgf17b, a novel member of Fgf family, helps patterning zebrafish embryos. Dev. Biol. 271,130 -143.[CrossRef][Medline]
Chen, Y. H., Lee, W. C., Liu, C. F. and Tsai, H. J. (2001). Molecular structure, dynamic expression, and promoter analysis of zebrafish (Danio rerio) myf-5 gene. Genesis 29,22 -35.[CrossRef][Medline]
Christiansen, J. H., Dennis, C. L., Wicking, C. A., Monkley, S. J., Wilkinson, D. G. and Wainwright, B. J. (1995). Murine Wnt-11 and Wnt-12 have temporally and spatially restricted expression patterns during embryonic development. Mech. Dev. 51,341 -350.[CrossRef][Medline]
Coutelle, O., Blagden, C. S., Hampson, R., Halai, C., Rigby, P. W. and Hughes, S. M. (2001). Hedgehog signalling is required for maintenance of myf5 and myoD expression and timely terminal differentiation in zebrafish adaxial myogenesis. Dev. Biol. 236,136 -150.[CrossRef][Medline]
Crossley, P. H. and Martin, G. R. (1995). The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121,439 -451.[Abstract]
Dale, K. J. and Pourquie, O. (2000). A clock-work somite. BioEssays 22, 72-83.[CrossRef][Medline]
Devoto, S. H., Melançon, E., Eisen, J. S. and Westerfield, M. (1996). Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Development 122,3371 -3380.[Abstract]
Devoto, S. H., Stoiber, W., Hammond, C. L., Steinbacher, P., Haslett, J. R., Barresi, M. J. F., Patterson, S. E., Adiarte, E. and Hughes, S. M. (2005). Generality of vertebrate developmental patterns: evidence for a dermomyotome in fish. Evol. Dev. (in press).
Draper, B. W., Stock, D. W. and Kimmel, C. B.
(2003). Zebrafish fgf24 functions with fgf8 to promote posterior
mesodermal development. Development
130,4639
-4654.
Du, S. J., Devoto, S. H., Westerfield, M. and Moon, R. T.
(1997). Positive and negative regulation of muscle cell identity
by members of the hedgehog and TGF-ß gene families.
J. Cell Biol. 139,145
-156.
Dubrulle, J., McGrew, M. J. and Pourquie, O. (2001). FGF signaling controls somite boundary position and regulates segmentation clock control of spatiotemporal Hox gene activation. Cell 106,219 -232.[CrossRef][Medline]
Edom-Vovard, F. and Duprez, D. (2004). Signals regulating tendon formation during chick embryonic development. Dev. Dyn. 229,449 -457.[CrossRef][Medline]
Edom-Vovard, F., Bonnin, M. A. and Duprez, D. (2001). Misexpression of Fgf-4 in the chick limb inhibits myogenesis by down-regulating Frek expression. Dev. Biol. 233,56 -71.[CrossRef][Medline]
Edom-Vovard, F., Schuler, B., Bonnin, M. A., Teillet, M.-A. and Duprez, D. (2002). Fgf4 positively regulates scleraxis and tenascin expression in chick limb tendons. Dev. Biol. 247,351 -366.[CrossRef][Medline]
Ekker, M., Wegner, J., Akimenko, M. A. and Westerfield, M. (1992). Coordinate embryonic expression of three zebrafish engrailed genes. Development 116,1001 -1010.[Abstract]
Fisher, M. E., Isaacs, H. V. and Pownall, M. E. (2002). eFGF is required for activation of XmyoD expression in the myogenic cell lineage of Xenopus laevis. Development 129,1307 -1315.
Flanagan-Steet, H., Hannon, K., McAvoy, M. J., Hullinger, R. and Olwin, B. B. (2000). Loss of FGF receptor 1 signaling reduces skeletal muscle mass and disrupts myofiber organization in the developing limb. Dev. Biol. 218,21 -37.[CrossRef][Medline]
Frank, D. U., Fotheringham, L. K., Brewer, J. A., Muglia, L. J.,
Tristani-Firouzi, M., Capecchi, M. R. and Moon, A. M. (2002).
An Fgf8 mouse mutant phenocopies human 22q11 deletion syndrome.
Development 129,4591
-4603.
Furthauer, M., Thisse, C. and Thisse, B. (1997). A role for FGF-8 in the dorsoventral patterning of the zebrafish gastrula. Development 124,4253 -4264.[Abstract]
Griffin, K., Patient, R. and Holder, N. (1995). Analysis of FGF function in normal and no tail zebrafish embryos reveals separate mechanisms for formation of the trunk and tail. Development 121,2983 -2994.[Abstract]
Grimaldi, A., Tettamanti, G., Martin, B. L., Gaffield, W.,
Pownall, M. E. and Hughes, S. M. (2004). Hedgehog regulation
of superficial slow muscle fibres in Xenopus and the evolution of tetrapod
trunk myogenesis. Development
131,3249
-3262.
Gryzik, T. and Muller, H. A. (2004). FGF8-like1 and FGF8-like2 encode putative ligands of the FGF receptor Htl and are required for mesoderm migration in the Drosophila gastrula. Curr. Biol. 14,659 -667.[CrossRef][Medline]
Hadchouel, J., Carvajal, J. J., Daubas, P., Bajard, L., Chang, T., Rocancourt, D., Cox, D., Summerbell, D., Tajbakhsh, S., Rigby, P. W. et al. (2003). Analysis of a key regulatory region upstream of the Myf5 gene reveals multiple phases of myogenesis, orchestrated at each site by a combination of elements dispersed throughout the locus. Development 130,3415 -3426.