|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online September 9, 2005
doi: 10.1242/10.1242/dev.02021
Yale University School of Medicine, 333 Cedar Street, Box 208005, New Haven, CT 06520-8005, USA
* Author for correspondence (e-mail: allen.bale{at}yale.edu)
Accepted 2 August 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Sufu, Suppressor of fused, Hedgehog, Mouse development, Left-right asymmetry
| Introduction |
|---|
|
|
|---|
Hedgehog (Hh) is a secreted molecule that influences the differentiation of
a variety of tissues during development. Hh, its receptor `patched' (Ptc) and
many downstream members of the Hh signal transduction pathway were originally
discovered by developmental biologists studying embryogenesis in
Drosophila (Nusslein-Volhard and
Wieschaus, 1980
). This pathway lays down the basic framework of
the embryo, determining anteroposterior relationships (`segment polarity') in
developing structures. Secreted Hh diffuses freely to determine cell fates in
a concentration-dependent manner. Ptc is a repressor of Hh signaling and
constitutively inhibits smoothened (Alcedo
et al., 1996
; Stone et al.,
1996
; van den Heuvel and
Ingham, 1996
; Xie et al.,
1998
). Upon Hh binding, smoothened (Smo) is released from
repression and signals downstream to a complex consisting of fused (Fu),
suppressor of fused [Su(fu)], costal 2 (Cos2) and cubitus interruptus (Ci). Ci
is the transcriptional effector of the pathway
(Alexandre et al., 1996
;
Eaton and Kornberg, 1990
;
Forbes et al., 1993
;
Grau and Simpson, 1987
;
Preat, 1992
;
Preat et al., 1990
;
Robbins et al., 1997
;
Simpson and Grau, 1987
;
Sisson et al., 1997
). When the
pathway is switched on, Ci dissociates from the complex and translocates to
the nucleus, resulting in the expression of target genes, including
ptc. In the absence of signal, Ci is proteolyzed to a 75 kDa
repressor form that inhibits hh expression
(Aza-Blanc et al., 1997
;
Methot and Basler, 1999
).
Elements of the Hh pathway are found in most multicellular organisms. In
humans, mutations that lead to activation of the pathway are often associated
with cancer. For example, PTCH, the hedgehog receptor, is mutated in
Gorlin syndrome, an autosomal dominant disorder characterized by multiple
basal cell carcinomas (BCC) and medulloblastoma
(Hahn et al., 1996
;
Johnson et al., 1996
). Gorlin
syndrome patients exhibit generalized overgrowth, developmental defects of the
central nervous system, polydactyly, and a variety of other birth defects. The
phenotype in mice heterozygous for a null allele of patched (Ptch1)
closely mimics the human disease. These mice are 10% larger than their
wild-type littermates and have birth defects similar to those seen in humans
(Aszterbaum et al., 1999
;
Goodrich et al., 1997
;
Hahn et al., 1998
). They
develop medulloblastoma, rhabdomyosarcoma, and BCC-like tumors. The
Ptch1 homozygous mutant is embryonic lethal at day 9.0-10.5, and has
an open neural tube and heart abnormalities.
Suppressor of fused, like patched, is a negative modulator of Hh signaling.
It was first identified as a dominant second-site suppressor of the fused
phenotype in Drosophila (Preat,
1992
). Drosophila Su(fu) reduces the nuclear accumulation
of the activator form of full-length Ci, presumably through cytoplasmic
retention of Ci (Methot and Basler,
2000
; Wang et al., 2000). Similarly, human suppressor of fused
(SUFU) sequesters the GLI proteins, homologs of Drosophila
Ci, in the cytoplasm to inhibit Hh signaling
(Kogerman et al., 1999
;
Stone et al., 1999
). By
analogy to Ptch1, Sufu may function as a tumor suppressor and play a
role in the development of the central nervous system (CNS), limbs and heart.
To study the role of Sufu in development and carcinogenesis, we constructed a
mouse Sufu mutant by targeted disruption of the Sufu gene.
We anticipated that Sufu heterozygotes, like Ptch1
heterozygotes, would be prone to BCC and medulloblastoma, exhibit increased
size and a set of birth defects similar to those in Gorlin syndrome.
Sufu homozygotes were predicted to be embryonic lethal, with neural
tube defects and possible heart abnormalities.
| Materials and methods |
|---|
|
|
|---|
Mouse genotyping
Genotyping was performed by: (1) PCR of a 700 bp fragment of the
neo gene using a 5' primer (ATGACTGGGCACAACAGAC) and a 3'
primer (CGATACCGTAAAGCACGAG); (2) Southern blot analysis using a
BamHI digest and the Sufu intron 8 probe described above to
distinguish homozygotes from heterozygotes at 8.5 dpc or later; or (3) PCR of
a 3.8 kb fragment from the 3' end of intron 3 (ACTGCAAGTCTTTGGCCTTC) to
the 5' end of exon 7 (ACTGACGCCGCTCAGGTTAG) to distinguish homozygotes
from heterozygotes at stages earlier than 8.5 dpc, when the quantity of yolk
sac DNA was insufficient for Southern analysis.
Mouse embryo studies
Embryos were obtained from timed intercrossing of heterozygous mice. Noon
of the day of detection of the vaginal plug was considered as 0.5 dpc. Embryos
were dissected in phosphate buffered saline (PBS).
Northern blot hybridization
Total RNA was isolated from whole 9.5 dpc wild-type and mutant embryos
using RNeasy Mini Kit (Qiagen). Approximately 15 µg of each RNA sample was
electrophoresed through a 1.2% formaldehyde gel and transferred to a nylon
membrane (Genescreen, Dupont). Hybridization in PerfectHyb Plus Hybridization
Buffer (Sigma) was carried out at 65°C with either a 1.3 kb Sufu
cDNA fragment with exons 1-12 up to the stop codon or an exon 12 fragment
containing 924 bp that followed the stop codon as a probe. Equal loading of
RNA in each lane was determined by the appearance of ribosomal bands on
ethidium bromide-stained RNA gels, and by reprobing the same northern blots
with a mouse Gapdh cDNA (bases 379 to 910) after stripping off the
Sufu probes with 1% SDS.
Western blot analysis
Lysates from whole 9.5 dpc wild-type and mutant embryos were prepared in
RIPA lysis buffer. 50 µg of protein was run on a 10% SDS-PAGE gel and
transferred to a nitrocellulose membrane (Bio-Rad). Sufu protein expression
was detected with a goat polyclonal Sufu antibody (Santa Cruz Biotechnology)
that recognizes the carboxy terminus. Secondary antibody was
horseradish-peroxidase-conjugated anti-goat (Santa Cruz Biotechnology). Equal
protein loading was detected using a monoclonal ß-actin antibody
(Sigma).
Histology
Wild-type and mutant embryos were fixed overnight in 10% buffered formalin
and then paraffin wax embedded. Transverse sections (4 µm) were stained
with Hematoxylin and Eosin using standard histology techniques.
RNA in situ hybridization
Whole-mount RNA in situ hybridization was performed as described previously
(Wilkinson and Nieto, 1993
). A
sonic hedgehog (Shh) digoxigenin-labeled riboprobe
(Boehringer-Mannheim) was generated by in vitro transcription from a 700 bp
PCR fragment containing a portion of exon 3, and a Pax7 probe was
made similarly from an 800 bp PCR fragment containing a portion of exon 9 and
the 3' UTR. The Pitx2 probe was a 725 bp fragment from the
3' end of the cDNA extending into the 3'UTR; Dnahc11
(previously lrd) was a 700 bp probe from the 3'UTR;
Ptch1 was a 540 bp fragment of exon 23; and Nodal was a 1.8
kb cDNA fragment encompassing most of the nodal gene
(Zhou et al., 1993
).
Hybridized probes were detected with alkaline phosphatase (AP)-coupled
anti-digoxigenin antibodies developed with BM Purple-AP substrate (Roche). For
Shh and Pax7, 10 µm frozen transverse sections were
prepared.
Immunohistochemistry
For whole-mount detection of acetylated tubulin, 7.75 dpc embryos were
fixed overnight in 4% paraformaldehyde in PBS, then dehydrated on ice in a
series of graded methanol and PBS solutions and stored in 100% methanol at
-20°C. The embryos were rehydrated in a series of graded solutions of
methanol and PBS with 0.2% Triton X100 (Kodak) (PBT), then treated for 1 hour
with 3% bovine serum albumin (BSA) in PBT. They were incubated overnight at
4°C with a 1:200 dilution of mouse monoclonal anti-acetylated tubulin
clone 6-IIB-1 (Sigma) in PBT-3% BSA, followed by three 45-minute PBT-3% BSA
washes at room temperature, then incubated for 3 hours at room temperature
with a 1:150 dilution of Alexa 488-conjugated anti-mouse antibody in PBT-3%
BSA followed by three 45-minute washes in PBT at room temperature. They were
mounted and cover-slipped on glass slides in ProLong Antifade medium
(Molecular Probes) with the posterior of the embryo facing up, then viewed and
photographed by confocal microscopy.
For sections through the neural tube, embryos were fixed overnight in 4%
paraformaldehyde at 4°C, washed with PBS for one hour, and equilibrated in
30% sucrose overnight at 4°C. Transverse frozen sections (10 µm) were
incubated in the indicated primary antibody for two hours and then incubated
with corresponding secondary antibodies. Slides were mounted with ProLong
Antifade mounting medium (Molecular Probes). Sections were examined with a
Zeiss LSM 510 confocal microscope. Antibodies were mouse anti-Shh-N
(Ericson et al., 1996
), mouse
anti-FoxA2 (Ericson et al.,
1996
), mouse anti-Nkx2.2
(Ericson et al., 1997a
) and
mouse anti-Pax6 (Ericson et al.,
1997b
). The anti-PTCH antibody was arabbit polyclonal antibody
against the peptide, RLPTPSPEPPPSVVRFAMP
(Karpen et al., 2001
). Primary
antibodies were detected with a corresponding Alexa-fluor 488 fluorescent
secondary antibody (Molecular Probes).
|
| Results |
|---|
|
|
|---|
Intercrossing of heterozygous mice produced no live-born homozygous offspring. Analysis of timed stages revealed that Sufu homozygous mutants did not survive past 10.5 dpc. In order to determine the effects of gene targeting on mRNA and protein expression, we characterized the Sufu mutant transcript and protein in 9.5 dpc homozygous embryos. Correct targeting of the Sufu gene would eliminate the intron 6/exon 7 junction and obliterate normal mRNA splicing in this region. A cDNA probe with the entire coding sequence of Sufu identified a 5.5 kb mRNA in wild-type mice, consistent with previous reports (Fig. 1C, upper panel). The Sufu homozygotes had aberrant 8.5 kb and 1.5 kb transcripts, and a transcript similar in size to the wild type. To help determine whether the 5.5 kb band in the mutant was truly identical to the wild-type band, the blot was reprobed with a fragment containing only the extreme 3' end of the coding sequence. There was no band equal in size to wild type with this probe (Fig. 1C, middle panel). These results are consistent with the targeted gene producing three aberrant splice products. To confirm the loss of full-length Sufu protein, we performed western blot analysis with an antibody to the carboxy terminus of Sufu. The expected 54 kDa Sufu protein was observed in wild-type and heterozygous 9.5 dpc embryos (Fig. 1D). There was no detectable Sufu protein expression in homozygous embryos. ß-Actin expression was equivalent in all three genotypes.
|
In addition to its role in the Hh pathway, Sufu has been shown to bind and
inhibit the activity of ß-catenin in tissue culture studies
(Meng et al., 2001
). This
function is similar to that of adenomatous polyposis coli (APC), and
APC heterozygous mutants in both mouse and human are prone to
gastrointestinal polyps. Sufu mutants had no gastrointestinal polyps,
indicating that this function is not significant in vivo or that loss of
Sufu alone does not produce a strong enough effect to result in a
visible phenotypic abnormality.
Homozygous Sufu mutants at 8.5 dpc grossly resembled their wild-type littermates. By 9.0-9.5 dpc, abnormalities first appeared with growth retardation, failure to undergo embryonic turning, abnormal somites and an open neural tube (Fig. 2B,C). Four out of 13 Sufu mutants at 9.5-10.5 dpc had L-looped (leftward) hearts (Fig. 2H), and one had indeterminate cardiac looping (Table 1). All wild-type littermates had normal D-looped hearts. The expression of Pitx2, normally found in the left lateral plate mesoderm at 8.5 dpc, paralleled the observed morphologic defects, with approximately one third of mutant embryos demonstrating absent or bilateral expression (Fig. 3C,D and
|
|
Although some of the features of Sufu mutants resembled those seen
in other mutants of the Hh pathway, none of the observed dysmorphology was a
specific measure of Hh signaling. To further evaluate Hh pathway activity, we
used neural tube patterning as an assay for Hh effect in development. Shh
determines cell fates in a concentration-dependent manner in the neural tube.
Shh is initially produced in the notochord and then in the floor plate to
modulate the differentiation of ventral cell types, such as motoneurons
(Ericson et al., 1996
). In
Drosophila, hh expression is repressed when the pathway is inactive.
By analogy to Drosophila, loss of Sufu in the mouse should
allow for de-repression of Shh expression. Whole-mount RNA in situ in
9.5 dpc embryos showed a dramatic upregulation of Shh expression
throughout the brain and neural tube of Sufu homozygous mutants
(Fig. 5B). Transverse sections
showed that Shh expression expanded dorsally to encompass the ventral
half of the neural tube (Fig.
5D). Likewise, the distribution of Shh protein, as determined by
immunohistochemistry, was much broader than in wild-type embryos and
encompassed most of the neural tube (data not shown). Although immaturity of
Sufu mutants would be a possible explanation for persistent high
levels of Shh in the brain, the increased distribution of expression in more
caudal regions of the neural tube is not consistent with this explanation and
indicates de-repression of the gene.
|
|
Shh regulates the conversion of neural plate cells into ventralized neural
progenitors. Markers of ventral cell types include Foxa2 and the Nkx2.2
homeodomain transcription factor (Hynes et
al., 1995
; Roelink et al.,
1995
). Normally, Foxa2 and Nkx2.2 are expressed in the floor
plate, with Foxa2 expression being restricted to the ventral midline
(Ang et al., 1993
;
Ruiz i Altaba et al., 1993
;
Sasaki and Hogan, 1993
)
(Fig. 6E,G). We observed a
dorsal expansion of Foxa2- and Nkx2.2-expressing cells in the Sufu
mutant (Fig. 6F,H).
Pax6, a murine homeobox gene, is expressed in the lateral domain of
the ventricular zone (Fig. 6I).
Low concentrations of Shh can activate Pax6 expression, but high
concentrations repress expression (Ericson
et al., 1997a
). Consistent with the dorsal expansion of
Shh expression, Pax6-expressing cells were absent from the lateral
domain in Sufu mutants (Fig.
6J). In more caudal sections, Pax6-positive cells were detected in
the extreme dorsal cells of the neural tube (data not shown). Pax7, a marker
of dorsal cell types, was virtually absent from the neural tube of
Sufu mutants (Fig.
7B,D).
|
Evaluation of Sufu heterozygotes for tumor predisposition
Ptch1 heterozygote knockout mice have a high incidence of tumors,
including medulloblastoma, rhabdomyosarcoma and BCC
(Aszterbaum et al., 1999
;
Goodrich et al., 1997
;
Hahn et al., 1998
). To
determine whether Sufu heterozygotes are susceptible to these tumors,
we exposed these mice to a single dose of 4 Gy of ionizing radiation. Several
studies have shown that ionizing radiation can increase the frequency of
tumors and decrease tumor latency in animals carrying mutations in known tumor
suppressor genes. In particular, this dose of radiation causes skin tumors in
virtually 100% of Ptch1 mice
(Aszterbaum et al., 1999
).
C57BL/6;129SV F1 progeny were generated by breeding chimeras to C57BL/6
females. Twenty Sufu heterozygotes and 21 isogenic wild-types were
monitored weekly for tumors. One heterozygous mouse died of unknown causes.
Otherwise, all animals survived and were necropsied twelve months after
radiation exposure. None of the Sufu heterozygotes exhibited
medulloblastoma, rhabdomyosarcoma or BCC
(Table 3). Ovarian granulosa
cell adenomas and hepatomas were observed in both wild-type and Sufu
heterozygote mice. Bronchiolalveolar adenoma was observed in one Sufu
heterozygote mouse; this tumor was not seen in wild-type littermates. However,
the incidence of this tumor type is too low to draw any definitive
conclusions. To determine whether genetic background could influence the tumor
spectrum, we repeated this experiment with Sufu heterozygotes on a
129/Sv background. These mice have been monitored for eleven months and show
no signs of tumor growth. Lack of medulloblastoma and BCC in Sufu
heterozygotes suggests that loss of Sufu is not sufficient to induce
these tumors on either of the two genetic backgrounds within the observed time
frame.
|
| Discussion |
|---|
|
|
|---|
In general, our findings indicate that the phenotypic effect of Sufu disruption is milder than that of Ptch1 disruption. We found that Sufu heterozygosity confers no obvious developmental phenotype and that Sufu heterozygotes, unlike Ptch1 heterozygotes, have no increase in birth defects or tumor predisposition. Nevertheless, the homozygous mutants share many features. This study reveals several aspects of the role of Sufu in vertebrate development and the control of cell proliferation.
Conservation of function between Drosophila and mouse Sufu in Hh signaling
In Drosophila, the level of activity of the Hh pathway influences
the maintenance of hh expression. When the pathway is inactive, the
transcriptional repressor form of Ci represses hh. The presence of Hh
ligand or the removal of an antagonist of Hh signaling allows for
de-repression of hh expression. Theoretically, disrupting the
Su(fu) gene would allow for ligand-independent Hh pathway activation
in Su(fu) null cells. In agreement with this mechanism, Shh
transcription is upregulated throughout the neural tube of Sufu mouse
mutants. This expansion of the zone of Shh expression in
Sufu mutants could result solely from a lack of repression by Sufu,
or from ligand-dependent Hh pathway activation due to dorsal diffusion of
excess Shh protein. Future studies might include an analysis of Hh pathway
target gene expression in Sufu-/-;wild-type chimeric
embryos to determine how clones homozygous mutant for Sufu behave in
a neural tube with a normal Shh gradient.
|
|
In vertebrates, Shh signals regulate embryogenesis by directing the transcription of target genes, including Ptch1. The negative-feedback loop is necessary to regulate the distribution of Shh protein and the level of Hh pathway activation. Ptch1 null embryos show upregulation of the Hh pathway and a relatively uncontrolled activity of Hh target gene transcription due to the lack of functional Ptch1 protein. We observed ectopic dorsal expansion of Ptch1 protein throughout the ventricular zone of Sufu mutants. In contrast to Ptch1 mutants, Sufu mutants have functional Ptch1 protein. The negative-feedback loop is intact, but loss of Sufu had the same effect as loss of Ptch1 in creating ventralization of cell types in the neural tube.
The Gli genes, vertebrate homologs of ci, are required for
transduction of Hh signal. Among the three vertebrate Gli proteins, Gli3
appears to have largely a repressor function, and there is evidence that it
undergoes proteolytic processing in vivo, analogous to that of
Drosophila Ci (Ohlmeyer and
Kalderon, 1998
; Wang et al., 2000). Gli1 has an activator
function, and Gli2 can exert both positive and negative functions in
transcriptional regulation (Koebernick and
Pieler, 2002
), although a repressor role for Gli2 in vivo is not
established (Bai and Joyner,
2001
). Consistent with Gli3 being a negative regulator of Hh
signaling, Gli3 mutant mice share some similarities with
Ptch1 mutant mice, having brain defects
(Franz, 1994
) and polydactyly
(Hui and Joyner, 1993
).
Furthermore, Ptch1 mutants, Gli3 mutants
(Goodrich et al., 1997
;
Ruiz i Altaba, 1998
) and
Sufu mutants all express ectopic Shh in the dorsal neural tube,
suggesting that these loss-of-function mutants have an elevated Hh pathway
activity.
Interestingly, in Drosophila, the loss-of-function mutant of
Su(fu) is viable and displays an essentially normal phenotype
(Preat, 1992
), with very minor
abnormalities in wing vein morphology
(Ohlmeyer and Kalderon, 1998
).
Su(fu) overexpression mutants have no recognizable phenotype
(Pham et al., 1995
). These
observations demonstrate that, under standard laboratory growth conditions,
Su(fu) is not essential for normal development in
Drosophila. There is no evidence that Drosophila Su(fu)
alone has a powerful effect on cellular proliferation or differentiation. The
requirement for Sufu in mouse, but not Drosophila, development
suggests a divergence among organisms. The complexity of multicellular
vertebrates and the need for a tighter control of signal transduction pathways
may contribute to these disparities. Vertebrate morphological development may
specifically require the use of Sufu for different functions that are
essential to viability. In support of this model, there is growing evidence
that genes conserved from Drosophila to vertebrates may acquire new
interacting partners through evolution. Genetic screens in vertebrates have
identified Hh pathway signaling components that do not seem to be necessary to
Hh signaling in Drosophila
(Bulgakov et al., 2004
;
Huangfu et al., 2003
;
Wolff et al., 2004
), and, in
addition, Sufu may function in other signaling pathways.
Defects in left-right asymmetry and cardiac morphogenesis in mutants of the hedgehog pathway
Hh signaling is involved in the developmental program that ensures that
left-right asymmetry is nonrandom (Levin
et al., 1995
; Schneider and
Brueckner, 2000
). The embryonic node is a site of Shh
expression and is essential in left-right determination
(Pagan-Westphal and Tabin,
1998
). In the chick, Shh is asymmetrically expressed, but
Shh expression is not asymmetric in the mouse.
The phenotypes of mice with targeted disruption of Hh pathway genes
indicate that Hh signaling may play a role at more than one stage of
left-right determination. Shh-/- mice have a 10% incidence
of reversed cardiac looping and an additional 30% incidence of abnormal
positioning of the cardiac loop. Pitx2 and other markers of
left-sided signaling are expressed bilaterally in a portion of Shh
mutants. There is evidence that hedgehog is required to prevent left
determinants from being expressed on the right at a stage after initial
asymmetric signaling is set up (Meyers and
Martin, 1999
).
|
Studies of chick development predict that loss-of-function mutations in
both positive and negative members of the Hh signaling pathway might result in
laterality defects (Levin et al.,
1995
), but a laterality defect in a mouse mutant with excess Hh
signaling has not been reported previously. Although Ptch1 mutants
have cardiac anomalies (Goodrich et al.,
1997
), they reportedly establish a normal left-right axis
(Zhang et al., 2001
).
Sufu-/- embryos presumably have excess, rather than a lack
of, Hh signaling during the process of left-right determination. However, like
Smo and Disp1 mutants, they fail to undergo normal embryonic
turning, and approximately one third have abnormal Pitx2 expression
and inverse cardiac looping. Sufu mutants also exhibit hyperplasia of
the myocardium, an effect that might be predicted based on evidence from
Smo mutants that Hh signaling controls early Nkx2.5
expression in cardiac mesoderm (Zhang et
al., 2001
).
Nodal is expressed dynamically in discrete regions of the
developing mouse embryo. It is required for the induction of mesendodermal
cell types, and mouse Nodal mutants do not form a primitive streak
(Conlon et al., 1994
;
Zhou et al., 1993
). In
addition, Nodal has been implicated in the formation and function of
the mouse node. Asymmetric Nodal expression in the developing node
and in the left lateral plate mesoderm determines normal left-right asymmetry.
The defect that leads to left-right axis abnormalities in Sufu
mutants appears to be marked expansion of Nodal expression with
concomitant abnormal node morphology. Excess expression of Nodal in
and around the developing node could plausibly lead to variable node
dysmorphology, with more normal nodes leading to normal cardiac phenotypes and
more disorganized nodes leading to randomized cardiac phenotypes via the
disruption of normal left-right signaling. Milder defects might not affect the
leftward nodal flow that initiates normal asymmetric left-right signaling,
whereas more severe node malformations would lead to laterality defects. The
variability of node dysmorphology could thus partially explain why fewer than
half of the embryos examined exhibited abnormal cardiac looping. The node
cilia appeared microscopically normal, although studies of ciliary motility in
Sufu mutants have not yet been done.
The molecular basis for the expansion of Nodal expression in 7.5
dpc embryos is not yet determined, and further studies will be necessary to
clarify both the pathogenesis of the defect and its downstream effects.
Nodal dysregulation at this embryonic age suggests an early function
of Sufu, possibly through modulation of early Hh signaling. In support of this
model, defects in the mouse homologs of the intraflagellar transport (IFT)
components IFT172 and IFT88 result in altered Hh signaling, and abnormal nodes
and left-right development (Huangfu et
al., 2003
). Another speculative explanation for the paradoxical
lack of left-right abnormalities in Ptch1 mutants when compared with
Sufu mutants is that Sufu might act through effectors other than the
classical targets of the Hh pathway, i.e. through Notch or Wnt signaling, two
pathways with known roles in Nodal expression. For example, there is
evidence that Sufu is a negative regulator of ß-catenin, a key member of
the canonical Wnt signaling pathway (Meng
et al., 2001
). Mice mutant for Apc, another negative
regulator of ß-catenin, or Tcf3, a constitutive repressor
antagonized by ß-catenin, exhibit a variety of node abnormalities
(Merrill et al., 2004
) not
dissimilar to those seen in the Sufu mutant. As in Apc and
Tcf3 mice, the node defects in the Sufu-/- mouse
could theoretically be due to upregulation of ß-catenin signaling leading
to an expansion of Nodal expression. Future studies will help to
clarify the etiology of the expansion of Nodal expression, the node
defect, and their downstream phenotypic sequelae.
Shh signaling and cancer predisposition
Ptch1 heterozygous mice phenotypically resemble humans with Gorlin
syndrome, having developmental defects and cancer predisposition. Although
loss of Sufu might be expected to generate a similar phenotype, adult
Sufu heterozygous mice were grossly normal. They were equal in size
to their wild-type littermates and had no developmental defects. Sufu
heterozygotes did not develop tumors associated with Hh pathway
activation.
In contrast to the mouse model, Sufu loss-of-function mutations in
human heterozygotes can predispose to medulloblastomas
(Taylor et al., 2002
). Tumors
in these individuals arise with loss of the normal allele. There are no
prospective studies of human Sufu heterozygotes, and it is possible
that these tumors are seen in only a minority of genetically affected
individuals. A low-penetrance phenotype in humans would be consistent with the
failure to identify medulloblastomas in the limited number of mice that have
been studied thus far. Sufu mutation may not be a dominant mechanism
in the development of these tumors, and other mutations might be required for
tumorigenesis. Like mice heterozygous for Sufu mutations, there were
no apparent developmental abnormalities in human Sufu heterozygotes.
These data strongly support the notion that, in contrast to Ptch1,
loss of one copy of Sufu is not sufficient to cause a phenotype
related to Hh pathway activation. It would seem that Sufu functions as a
modulator of Hh signaling but does not have the same impact as Ptch1, which is
a critical member of the pathway. Although Sufu does not seem to have as
powerful an effect as Ptch1 does, decreased activity of this gene product is
likely to influence the cancer susceptibility in Ptch1 heterozygotes.
Sufu+/-;Ptch1+/- mice might have a shorter
tumor latency period, larger tumors or biologically more aggressive tumors,
such as metastatic BCC. Predisposition to additional tumor types might be
unmasked in this genetic background.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alcedo, J., Ayzenzon, M., Von Ohlen, T., Noll, M. and Hooper, J. E. (1996). The Drosophila smoothened gene encodes a seven-pass membrane protein, a putative receptor for the hedgehog signal. Cell 86,221 -232.[CrossRef][Medline]
Alexandre, C., Jacinto, A. and Ingham, P. W.
(1996). Transcriptional activation of hedgehog target genes in
Drosophila is mediated directly by the cubitus interruptus protein, a member
of the GLI family of zinc finger DNA-binding proteins. Genes
Dev. 10,2003
-2013.
Ang, S. L., Wierda, A., Wong, D., Stevens, K. A., Cascio, S., Rossant, J. and Zaret, K. S. (1993). The formation and maintenance of the definitive endoderm lineage in the mouse: involvement of HNF3/forkhead proteins. Development 119,1301 -1315.[Abstract]
Aszterbaum, M., Epstein, J., Oro, A., Douglas, V., LeBoit, P. E., Scott, M. P. and Epstein, E. H., Jr (1999). Ultraviolet and ionizing radiation enhance the growth of BCCs and trichoblastomas in patched heterozygous knockout mice. Nat. Med. 5,1285 -1291.[CrossRef][Medline]
Aza-Blanc, P., Ramirez-Weber, F. A., Laget, M. P., Schwartz, C. and Kornberg, T. B. (1997). Proteolysis that is inhibited by hedgehog targets Cubitus interruptus protein to the nucleus and converts it to a repressor. Cell 89,1043 -1053.[CrossRef][Medline]
Bai, C. and Joyner, A. (2001). Gli1 can rescue the in vivo function of Gli2. Development 128,5161 -5172.
Brennan, J., Norris, D. P. and Robertson, E. J.
(2002). Nodal activity in the node governs left-right asymmetry.
Genes Dev. 16,2339
-2344.
Bulgakov, O. V., Eggenschwiler, J. T., Hong, D. H., Anderson, K.
V. and Li, T. (2004). FKBP8 is a negative regulator of mouse
sonic hedgehog signaling in neural tissues.
Development 131,2149
-2159.
Conlon, F. L., Lyons, K. M., Takaesu, N., Barth, K. S., Kispert, A., Herrmann, B. and Robertson, E. J. (1994). A primary requirement for nodal in the formation and maintenance of the primitive streak in the mouse. Development 120,1919 -1928.[Abstract]
Eaton, S. and Kornberg, T. B. (1990).
Repression of ci-D in posterior compartments of Drosophila by engrailed.
Genes Dev. 4,1068
-1077.
Ericson, J., Morton, S., Kawakami, A., Roelink, H. and Jessell, T. M. (1996). Two critical periods of Sonic Hedgehog signaling required for the specification of motor neuron identity. Cell 87,661 -673.[CrossRef][Medline]
Ericson, J., Briscoe, J., Rashbass, P., van Heyningen, V. and
Jessell, T. M. (1997a). Graded sonic hedgehog signaling and
the specification of cell fate in the ventral neural tube. Cold
Spring Harb. Symp. Quant. Biol. 62,451
-466.
Ericson, J., Rashbass, P., Schedl, A., Brenner-Morton, S., Kawakami, A., van Heyningen, V., Jessell, T. M. and Briscoe, J. (1997b). Pax6 controls progenitor cell identity and neuronal fate in response to graded Shh signaling. Cell 90,169 -180.[CrossRef][Medline]
Forbes, A. J., Nakano, Y., Taylor, A. M. and Ingham, P. W. (1993). Genetic analysis of hedgehog signalling in the Drosophila embryo. Development115 -124.
Franz, T. (1994). Extra-toes (Xt) homozygous mutant mice demonstrate a role for the Gli-3 gene in the development of the forebrain. Acta Anat. (Basel) 150, 38-44.[Medline]
Goodrich, L. V., Milenkovic, L., Higgins, K. M. and Scott, M.
P. (1997). Altered neural cell fates and medulloblastoma in
mouse patched mutants. Science
277,1109
-1113.
Grau, Y. and Simpson, P. (1987). The segment polarity gene costal-2 in Drosophila. I. The organization of both primary and secondary embryonic fields may be affected. Dev. Biol. 122,186 -200.[CrossRef][Medline]
Hahn, H., Wicking, C., Zaphiropoulous, P. G., Gailani, M. R., Shanley, S., Chidambaram, A., Vorechovsky, I., Holmberg, E., Unden, A. B., Gillies, S. et al. (1996). Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 85,841 -851.[CrossRef][Medline]
Hahn, H., Wojnowski, L., Zimmer, A. M., Hall, J., Miller, G. and Zimmer, A. (1998). Rhabdomyosarcomas and radiation hypersensitivity in a mouse model of Gorlin syndrome. Nat. Med. 4,619 -622.[CrossRef][Medline]
Huangfu, D., Liu, A., Rakeman, A. S., Murcia, N. S., Niswander, L. and Anderson, K. V. (2003). Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature 426,83 -87.[CrossRef][Medline]
Hui, C. C. and Joyner, A. L. (1993). A mouse model of Greig cephalopolysyndactyly syndrome: the extra-toesJ mutation contains an intragenic deletion of the Gli3 gene. Nat. Genet. 3,241 -246.[CrossRef][Medline]
Hynes, M., Porter, J. A., Chiang, C., Chang, D., Tessier-Lavigne, M., Beachy, P. A. and Rosenthal, A. (1995). Induction of midbrain dopaminergic neurons by Sonic hedgehog. Neuron 15,35 -44.[CrossRef][Medline]
Johnson, R. L., Rothman, A. L., Xie, J., Goodrich, L. V., Bare, J. W., Bonifas, J. M., Quinn, A. G., Myers, R. M., Cox, D. R., Epstein, E. H., Jr et al. (1996). Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 272,1668 -1671.[Abstract]
Karpen, H. E., Bukowski, J. T., Hughes, T., Gratton, J. P.,
Sessa, W. C. and Gailani, M. R. (2001). The sonic hedgehog
receptor patched associates with caveolin-1 in cholesterol-rich microdomains
of the plasma membrane. J. Biol. Chem.
276,19503
-19511.
Koebernick, K. and Pieler, T. (2002). Gli-type zinc finger proteins as bipotential transducers of Hedgehog signaling. Differentiation 70,69 -76.[CrossRef][Medline]
Kogerman, P., Grimm, T., Kogerman, L., Krause, D., Unden, A. B., Sandstedt, B., Toftgard, R. and Zaphiropoulos, P. G. (1999). Mammalian suppressor-of-fused modulates nuclear-cytoplasmic shuttling of Gli-1. Nat. Cell Biol. 1, 312-319.[CrossRef][Medline]
Levin, M., Johnson, R. L., Stern, C. D., Kuehn, M. and Tabin, C. (1995). A molecular pathway determining left-right asymmetry in chick embryogenesis. Cell 82,803 -814.[CrossRef][Medline]
Ma, Y., Erkner, A., Gong, R., Yao, S., Taipale, J., Basler, K. and Beachy, P. A. (2002). Hedgehog-mediated patterning of the mammalian embryo requires transporter-like function of dispatched. Cell 111,63 -75.[CrossRef][Medline]
Meng, X., Poon, R., Zhang, X., Cheah, A., Ding, Q., Hui, C. C.
and Alman, B. (2001). Suppressor of fused negatively
regulates beta-catenin signaling. J. Biol. Chem.
276,40113
-40119.
Merrill, B. J., Pasolli, H. A., Polak, L., Rendl, M.,
Garcia-Garcia, M. J., Anderson, K. V. and Fuchs, E. (2004).
Tcf3: a transcriptional regulator of axis induction in the early embryo.
Development 131,263
-274.
Methot, N. and Basler, K. (1999). Hedgehog controls limb development by regulating the activities of distinct transcriptional activator and repressor forms of Cubitus interruptus. Cell 96,819 -831.[CrossRef][Medline]
Methot, N. and Basler, K. (2000). Suppressor of fused opposes hedgehog signal transduction by impeding nuclear accumulation of the activator form of Cubitus interruptus. Development 127,4001 -4010.[Abstract]
Meyers, E. N. and Martin, G. R. (1999).
Differences in left-right axis pathways in mouse and chick: functions of FGF8
and SHH. Science 285,403
-406.
Nusslein-Volhard, C. and Wieschaus, E. (1980). Mutations affecting segment number and polarity in Drosophila. Nature 287,795 -801.[CrossRef][Medline]
Ohlmeyer, J. T. and Kalderon, D. (1998). Hedgehog stimulates maturation of Cubitus interruptus into a labile transcriptional activator. Nature 396,749 -753.[CrossRef][Medline]
Pagan-Westphal, S. and Tabin, C. (1998). The transfer of left-right positional information during chick embryogenesis. Cell 93,25 -35.[CrossRef][Medline]
Pearse, R. V., 2nd, Collier, L. S., Scott, M. P. and Tabin, C. J. (1999). Vertebrate homologs of Drosophila suppressor of fused interact with the gli family of transcriptional regulators. Dev. Biol. 212,323 -336.[CrossRef][Medline]
Pham, A., Therond, P., Alves, G., Tournier, F. B., Busson, D., Lamour-Isnard, C., Bouchon, B. L., Preat, T. and Tricoire, H. (1995). The Suppressor of fused gene encodes a novel PEST protein involved in Drosophila segment polarity establishment. Genetics 140,587 -598.[Abstract]
Preat, T. (1992). Characterization of Suppressor of fused, a complete suppressor of the fused segment polarity gene of Drosophila melanogaster. Genetics 132,725 -736.[Abstract]
Preat, T., Therond, P., Lamour-Isnard, C., Limbourg-Bouchon, B., Tricoire, H., Erk, I., Mariol, M. C. and Busson, D. (1990). A putative serine/threonine protein kinase encoded by the segment-polarity fused gene of Drosophila. Nature 347, 87-89.[CrossRef][Medline]
Robbins, D. J., Nybakken, K. E., Kobayashi, R., Sisson, J. C., Bishop, J. M. and Therond, P. P. (1997). Hedgehog elicits signal transduction by means of a large complex containing the kinesin-related protein costal2. Cell 90,225 -234.[CrossRef][Medline]
Roelink, H., Porter, J. A., Chiang, C., Tanabe, Y., Chang, D. T., Beachy, P. A. and Jessell, T. M. (1995). Floor plate and motor neuron induction by different concentrations of the amino-terminal cleavage product of sonic hedgehog autoproteolysis. Cell 81,445 -455.[CrossRef][Medline]
Ruiz i Altaba, A. (1998). Combinatorial Gli gene function in floor plate and neuronal inductions by Sonic hedgehog. Development 125,2203 -2212.[Abstract]
Ruiz i Altaba, A., Prezioso, V. R., Darnell, J. E. and Jessell, T. M. (1993). Sequential expression of HNF-3 beta and HNF-3 alpha by embryonic organizing centers: the dorsal lip/node, notochord and floor plate. Mech. Dev. 44, 91-108.[CrossRef][Medline]
Sarmah, B., Latimer, A. J., Appel, B. and Wente, S. R. (2005). Inositol polyphosphates regulate zebrafish left-right asymmetry. Dev. Cell 9,133 -145.[CrossRef][Medline]
Sasaki, H. and Hogan, B. L. (1993). Differential expression of multiple fork head related genes during gastrulation and axial pattern formation in the mouse embryo. Development 118,47 -59.[Abstract]
Schneider, H. and Brueckner, M. (2000). Of mice and men: dissecting the genetic pathway that controls left-right asymmetry in mice and humans. Am. J. Med. Genet. 97,258 -270.[CrossRef][Medline]
Simon-Chazottes, D., Paces-Fessy, M., Lamour-Isnard, C., Guenet, J. L. and Blanchet-Tournier, M. F. (2000). Genomic organization, chromosomal assignment, and expression analysis of the mouse suppressor of fused gene (Sufu) coding a Gli protein partner. Mamm. Genome 11,614 -621.[CrossRef][Medline]
Simpson, P. and Grau, Y. (1987). The segment polarity gene costal-2 in Drosophila. II. The origin of imaginal pattern duplications. Dev. Biol. 122,201 -209.[CrossRef][Medline]
Sisson, J. C., Ho, K. S., Suyama, K. and Scott, M. P. (1997). Costal2, a novel kinesin-related protein in the Hedgehog signaling pathway. Cell 90,235 -245.[CrossRef][Medline]
Stone, D. M., Hynes, M., Armanini, M., Swanson, T. A., Gu, Q., Johnson, R. L., Scott, M. P., Pennica, D., Goddard, A., Phillips, H. et al. (1996). The tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature 384,129 -134.[CrossRef][Medline]
Stone, D. M., Murone, M., Luoh, S., Ye, W., Armanini, M. P., Gurney, A., Phillips, H., Brush, J., Goddard, A., de Sauvage, F. J. et al. (1999). Characterization of the human suppressor of fused, a negative regulator of the zinc-finger transcription factor Gli. J. Cell Sci. 112,4437 -4448.[Abstract]
Tanaka, Y., Okada, Y. and Hirokawa, N. (2005). FGF-induced vesicular release of Sonic hedgehog and retinoic acid in leftward nodal flow is critical for left-right determination. Nature 435,172 -177.[CrossRef][Medline]
Taylor, M. D., Liu, L., Raffel, C., Hui, C. C., Mainprize, T. G., Zhang, X., Agatep, R., Chiappa, S., Gao, L., Lowrance, A. et al. (2002). Mutations in SUFU predispose to medulloblastoma. Nat. Genet. 31,306 -310.[CrossRef][Medline]
van den Heuvel, M. and Ingham, P. W. (1996). smoothened encodes a receptor-like serpentine protein required for hedgehog signalling. Nature 382,547 -551.[CrossRef][Medline]
Wang, B., Fallon, J. F. and Beachy, P. A. (2000a). Hedgehog-regulated processing of Gli3 produces an anterior/posterior repressor gradient in the developing vertebrate limb. Cell 100,423 -434.[CrossRef][Medline]
Wang, G., Amanai, K., Wang, B. and Jiang, J.
(2000b). Interactions with Costal2 and Suppressor of fused
regulate nuclear translocation and activity of Cubitus interruptus.
Genes Dev. 14,2893
-2905.
Wilkinson, D. G. and Nieto, M. A. (1993). Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods Enzymol. 225,361 -373.[Medline]
Wolff, C., Roy, S., Lewis, K. E., Schauerte, H., Joerg-Rauch,
G., Kirn, A., Weiler, C., Geisler, R., Haffter, P. and Ingham, P. W.
(2004). iguana encodes a novel zinc-finger protein with
coiled-coil domains essential for Hedgehog signal transduction in the
zebrafish embryo. Genes Dev.
18,1565
-1576.
Xie, J., Murone, M., Luoh, S. M., Ryan, A., Gu, Q., Zhang, C., Bonifas, J. M., Lam, C. W., Hynes, M., Goddard, A. et al. (1998). Activating Smoothened mutations in sporadic basal-cell carcinoma. Nature 391,90 -92.[CrossRef][Medline]
Zhang, X. M., Ramalho-Santos, M. and McMahon, A. P. (2001). Smoothened mutants reveal redundant roles for Shh and Ihh signaling including regulation of L/R asymmetry by the mouse node. Cell 105,781 -792.[CrossRef][Medline]
Zhou, X., Sasaki, H., Lowe, L., Hogan, B. L. and Kuehn, M. R. (1993). Nodal is a novel TGF-beta-like gene expressed in the mouse node during gastrulation. Nature 361,543 -547.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H. O.-L. Cheung, X. Zhang, A. Ribeiro, R. Mo, S. Makino, V. Puviindran, K. K. L. Law, J. Briscoe, and C.-c. Hui The Kinesin Protein Kif7 Is a Critical Regulator of Gli Transcription Factors in Mammalian Hedgehog Signaling Sci. Signal., June 23, 2009; 2(76): ra29 - ra29. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. Patterson, C. Damrau, A. Paudyal, B. Reeve, D. T. Grimes, M. E. Stewart, D. J. Williams, P. Siggers, A. Greenfield, and J. N. Murdoch Mouse hitchhiker mutants have spina bifida, dorso-ventral patterning defects and polydactyly: identification of Tulp3 as a novel negative regulator of the Sonic hedgehog pathway Hum. Mol. Genet., May 15, 2009; 18(10): 1719 - 1739. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, Z. Zhou, C. T. Walsh, and A. P. McMahon Selective translocation of intracellular Smoothened to the primary cilium in response to Hedgehog pathway modulation PNAS, February 24, 2009; 106(8): 2623 - 2628. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. van den Brink Hedgehog Signaling in Development and Homeostasis of the Gastrointestinal Tract Physiol Rev, October 1, 2007; 87(4): 1343 - 1375. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Bijlsma, M. P. Peppelenbosch, and C. A. Spek Hedgehog Morphogen in Cardiovascular Disease Circulation, October 31, 2006; 114(18): 1985 - 1991. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lee, H. L. Miller, H. R. Russell, K. Boyd, T. Curran, and P. J. McKinnon Patched2 modulates tumorigenesis in patched1 heterozygous mice. Cancer Res., July 15, 2006; 66(14): 6964 - 6971. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Huangfu and K. V. Anderson Signaling from Smo to Ci/Gli: conservation and divergence of Hedgehog pathways from Drosophila to vertebrates Development, January 1, 2006; 133(1): 3 - 14. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||