|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 December 2004
doi: 10.1242/dev.01587
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Department of Biology, Emory University, Atlanta, GA 30322, USA
2 Biology Department, Texas A&M University, College Station, TX 77843-3258,
USA
Author for correspondence (e-mail:
briley{at}mail.bio.tamu.edu)
Accepted 17 November 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Preplacodal domain, Otic placode, Genetic network, Paired, Fibroblast growth factor, forkhead, distal-less, msxC
| Introduction |
|---|
|
|
|---|
Extensive alternative splicing has been reported for many vertebrate Pax
genes, including mammalian Pax2, Pax3, Pax5, Pax6, Pax7 and
Pax8, and zebrafish pax2a, pax3, pax7, and pax9
(Barber et al., 1999
;
Barr et al., 1999
;
Epstein et al., 1994
;
Kozmik et al., 1997
;
Kozmik et al., 1993
;
Nornes et al., 1996
;
Puschel et al., 1992
;
Seo et al., 1998
;
Tavassoli et al., 1997
;
Vogan et al., 1996
;
Zwollo et al., 1997
).
Similarly, Pax2/5/8 transcripts of the invertebrate chordate
amphioxus (Branchiostoma floridae) are alternatively spliced
(Krelova et al., 2002
). In
most cases, alternative splicing has been shown to produce protein isoforms
with drastically different DNA binding specificities and transactivation
potentials (Barber et al.,
1999
; Barr et al.,
1999
; Epstein et al.,
1994
; Kozmik et al.,
1997
; Kozmik et al.,
1993
; Nornes et al.,
1996
; Puschel et al.,
1992
; Seo et al.,
1998
; Tavassoli et al.,
1997
; Vogan et al.,
1996
; Zwollo et al.,
1997
). Thus, alternative splicing is a highly conserved means of
increasing the functional repertoire of Pax genes.
The nine vertebrate Pax genes are grouped into four categories, with
Pax2/5/8 constituting one of these classes
(Pfeffer et al., 1998
). This
is an ancient group, with orthologs present in echinoderms, nematodes, and
flies (Czerny et al., 1997
).
The sequences of the functional regions are nearly invariant among the
vertebrate Pax2/5/8 genes
(Pfeffer et al., 1998
).
Pax2/5/8 genes are expressed in a spatially and temporally
overlapping manner at the midbrain-hindbrain junction and in the CNS; this
expression pattern has been conserved from zebrafish to mouse
(Pfeffer et al., 1998
).
Pax2 and Pax8 homologs are also expressed in the otic
placode and pronephros in these species
(Pfeffer et al., 1998
;
Plachov et al., 1990
). Recent
evidence has shown that Pax2 and Pax8 perform redundant
functions during mammalian kidney development and are required for the
earliest steps of this process (Bouchard et
al., 2002
; Mansouri et al.,
1998
). However, otic development in Pax2/Pax8-deficient
mouse embryos has not yet been described. In both zebrafish and mouse,
Pax8 is strongly expressed in the primordium of the otic placode
during late gastrulation, making it the earliest known marker of otic
induction (Pfeffer et al.,
1998
). Pax8 expression is maintained throughout placode
development and is lost soon after formation of the otic vesicle
(Pfeffer et al., 1998
).
Pax2 homologs are expressed in the otic anlagen during early
somitogenesis stages and are maintained in portions of the otic vesicle
(Pfeffer et al., 1998
). The
Pax8 knockout mouse does not show an otic phenotype
(Bouchard et al., 2002
;
Mansouri et al., 1998
), and
the Pax2 knockout mouse shows variable defects in derivatives of the
medial otic vesicle where Pax2 is expressed after the vesicle forms
(Bouchard et al., 2000
;
Burton et al., 2004
;
Favor et al., 1996
;
Torres et al., 1996
). The
absence of an earlier or more severe phenotype may reflect redundancy between
these genes. There are two Pax2 homologs in zebrafish, pax2a
and pax2b, and functional disruption of both genes reduces hair cell
production but does not impair formation of the placode or vesicle
(Whitfield et al., 2002
). The
extent to which pax8 compensates for loss of pax2a and
pax2b is not known.
Several upstream regulators of otic induction have been identified. The
forkhead class transcription factor gene foxi1 is expressed in the
ventral ectoderm beginning at 50% epiboly. By mid-gastrulation foxi1
expression is upregulated in the future otic placode prior to induction of
pax8. Loss of foxi1 prevents expression of pax8 in
the otic domain and severely compromises otic induction. Furthermore,
misexpression of foxi1 is sufficient to induce ectopic pax8
(Nissen et al., 2003
;
Solomon et al., 2003
). At
least two other genes, fgf3 and fgf8, are also necessary for
pax8 expression. These genes encode Fgf ligands that are expressed in
the developing hindbrain between the prospective otic placodes. Loss of both
fgf genes blocks otic induction, whereas misexpression of either gene
is sufficient to induce ectopic otic tissue
(Leger and Brand, 2002
;
Maroon et al., 2002
;
Phillips et al., 2001
;
Phillips et al., 2004
). Thus,
Fgf signaling and foxi1 function converge to induce pax8,
suggesting that pax8 could be an important mediator of otic
induction. In addition, zebrafish dlx3b and dlx4b,
transcription factors with homeo-domains similar to Drosophila
distal-less (Ekker et al.,
1992a
; Ellies et al.,
1997
), are required for otic placode formation. Combined loss of
function of dlx3b/4b leads to a reduction or absence of otic placodes
and pax2a expression in otic cells, but pax8 expression
initiates normally (Liu et al.,
2003
; Solomon and Fritz,
2002
).
In this paper, we describe a role for pax8 during otic development. We have cloned full-length transcripts of zebrafish pax8 and show that there are three main splice variants that encode proteins with different N-terminal sequences. Depletion of Pax8 function leads to compromised otic vesicle and inner ear morphology, and our data suggest that different isoforms have both overlapping and unique functions. We show a strong genetic interaction between pax8 and pax2a, and to a lesser extent pax2b, implicating these genes in the maintenance of otic cell fate. Depletion of pax8 enhances otic placode and vesicle defects in embryos with reduced Fgf signaling or in embryos that have been depleted for dlx3b function. In contrast, depletion of pax8 does not enhance defects in embryos depleted for foxi1. These and other data support the hypothesis that pax8 helps mediate otic induction downstream of foxi1 and fgf3 and 8 but in parallel with dlx3b. At later stages, pax8 acts redundantly with Pax2 genes to maintain otic fate.
| Materials and methods |
|---|
|
|
|---|
pax8 5' and 3' RACE cloning and sequencing
RNA was isolated from 3-5 somite and 24-hour embryos using TRIPURE reagent
(Roche). For the 5' RACE reaction, 3-5 somite stage RNA was processed
using the First Choice RLM-RACE kit from Ambion. cDNA was synthesized using a
pax8-specific primer (CAGCGCCGCGGAGGGAAAGT) and C. therm polymerase
(Roche) at 68°C for reverse transcription. Subsequently, PCR was performed
using a second, nested pax8-specific primer
(GCGGCGGTCGATTGGCAAAACTGTA) and the 5' RACE adaptor outer primer
(Ambion). A fraction of this reaction was used as template in a second PCR
amplification with a third, nested pax8-specific primer
(AACGGGCGCAGATGACGGAGACGAA) and the 5' RACE adaptor inner primer. All
PCRs were performed using the Clontech Advantage-GC2 protocol with a final
concentration of 1 M GC-melt. The resulting amplification products were cloned
into pCRII Topo vector (Invitrogen) and sequenced. The 24-hour RNA was reverse
transcribed using the CDS primer from the SMART II kit (Clontech) and C. Therm
polymerase. 3' RACE was performed using a pax8-specific primer
(CATCAATGGGCTGCTGGGAATCA) and the CDS primer (Clontech) in an initial PCR. A
fraction of this reaction was used for a second PCR amplification with a
nested pax8-specific primer (TCCGAGGGCTGAGGTATTTGTC) and the PCR
primer supplied in the Clontech SMART II kit. A third round of PCR was
performed using a fraction of the second PCR reaction as template and the
pax8-specific primer (GCCAGTTCAGCAGCCCGTCCCTCAT) and the PCR primer
(Clontech). The resulting products were cloned into the pCRII Topo vector and
sequenced.
For the splice variant analysis, pax8-specific primers located in the 5' UTR [exon 1a (Fig. 1A); GACAGACAACGGCGAACACCAACAC] and the 3'UTR [exon 13 (Fig. 1A); ACCCGGCCTCAGCTCAACATCAATAG] were used to amplify pax8 transcripts from 24-hour cDNA (described above), using the Advantage-GC2 PCR protocol with a 1 M concentration of GC-melt. The resulting products were cloned into the pCRII Topo vector and sequenced.
|
To knockdown pax8, translation-blocking morpholinos and splice-blocking morpholinos were generated as follows: translation blocker for splice variant 1 (variant 1 MO): 5' GTTCACAAACATGCCTCCTAGTTGA 3'; translation blocker for splice variants 2 and 3 (variant 2/3 MO): 5' GACCTCGCCCAGTGCTGTTGGACAT 3'; splice blocker exon6/7 (splice donor site): 5' CTGCACTCACTGTCATCGTGTCCTC 3'; splice blocker exon6/7 (splice acceptor site): 5' CAGCTCTCCTGGTCACCTGCACAAC 3'; splice blocker exon3 (paired domain): 5' GTAGCGGTGACACACCCCCTCGGCC 3'; splice blocker exon7/8 (homeo domain): 5' TGCGGTGTTCTGCACCTGCTCTGCT 3'. Unless stated otherwise, pax8 morphants were injected with 2.5 ng each of variant 1 MO and variant 2/3 MO to maximally disrupt pax8 function.
To knockdown fgf3, two translation-blocking sequences were co-injected: fgf3-MO #1, 5' CATTGTGGCATCGCGGGATGTCGGC 3'; fgf3-MO #2, 5' GGTCCCATCAAAGAAGTATCATTTG 3'. Other morpholino sequences used were as follows: dlx3b-MO translation blocker, 5' ATATGTCGGTCCACTCATCCTTTAAT 3'; foxi1-MO translation blocker, 5' TAATCCGCTCTCCCTCCAGAAA 3'; pax2b-MO translation blocker: 5' GGTCTGCCTTACAGTGAATATCCAT 3'.
Immunofluorescent staining
Embryos were raised in 0.3% PTU solution to inhibit the formation of
melanocytes. Embryos were fixed and stained as previously described
(Riley et al., 1999
) using
polyclonal anti-mouse Pax2 antibody (Berkeley Antibody company, 1:100
dilution) and monoclonal anti-acetylated tubulin antibody (Sigma T-6793,
1:100). Alexa 546 goat anti-rabbit IgG (Molecular Probes A-11010, 1:50) and
Alexa 488 goat anti-mouse IgG (Molecular Probes A-11001, 1:50) were used as
secondary antibodies.
In situ hybridization
In situ hybridization was carried out as described in Phillips et al.
(Phillips et al., 2001
), and
two-color staining was performed as described by Jowett
(Jowett, 1996
) with minor
modifications. Antisense riboprobes were transcribed from plasmids containing
the following: dlx3b (Ekker et
al., 1992a
); krox20
(Oxtoby and Jowett, 1993
);
msxC (Ekker et al.,
1992b
); pax2a (Krauss
et al., 1991
); pax5 and pax8
(Pfeffer et al., 1998
).
| Results |
|---|
|
|
|---|
Variants 1.2 (3.7%) and 2.2 (3.7%) lack exon 11, which encodes a portion of the transactivation domain. Similarly, variants 1.3 (5.5%) and 2.3 (3.7%) lack exons 9 and 10, which also encode part of the transactivation domain. Variants 1.4 (3.7%) and 1.5 (1.8%) use an alternate splice donor site, leading to an insert between exons 9 and 10; this insert is in frame and would add 11 amino acids to the transactivation domain (not shown in Fig. 1A sequence). In addition to the insert, variant 1.5 also lacks exon 11. Variant 2.6 lacks part of the transactivation domain due to the absence of exon 9.
The sequence analysis shows that pax8 transcripts are subject to extensive alternative splicing. To address the potential functional significance of different Pax8 isoforms, artificial mRNA for variants 1.1 or 2.1 (full length) and 1.3 or 2.3 (nonfunctional transactivation domain) were injected into one-cell embryos. Ectopic overexpression of either full length variant leads to severe gastrulation defects, precluding a meaningful interpretation of pax8 function in otic placode formation. Conversely, injection of the isoforms lacking the transactivation domain did not lead to any detectable phenotypes in otic placode or vesicle morphology (data not shown).
Functional analysis of pax8
We designed morpholino oligonucleotides (MO) to knock down pax8
function. Four MOs were designed to block pre-mRNA splicing at distinct splice
junction sites (Draper et al.,
2001
), and two additional MOs were designed to target the sequence
around each of the predicted start codons
(Nasevicius and Ekker, 2000
).
Together, these two MOs are predicted to block translation of all isoforms
(Fig. 1A). Co-injection of the
translation-blocking MOs resulted in the most consistent and reproducible
phenotypes, and this approach was used in all subsequent studies. Co-injection
of the two translation blockers plus two of the four splice-blocking MOs did
not produce any additional phenotypic defects, although nonspecific necrosis
was seen at higher MO concentrations (not shown), further suggesting that the
translation-blocking MOs effectively block pax8 function.
At 24 hpf, reduction of pax8 translation in embryos injected with
both translation-blocking pax8 MOs (pax8 morphants) causes a
slightly shortened trunk/tail axis and a reduced midbrain-hindbrain border
with mild necrosis in adjacent brain tissue
(Fig. 2A,D). Furthermore, the
otic vesicle is reduced in its linear dimensions by roughly half
(Fig. 2B,E). These phenotypic
changes are observed in over 90% of pax8 morphants. Embryos injected
with only variant 1 MO (Fig.
2C) or variant 2/3 MO (Fig.
2F) display an otic vesicle phenotype of intermediate severity,
with the variant 2/3 morphant embryos showing a slightly more affected otic
vesicle. Because pax8 is one of the earliest known markers of preotic
development (Pfeffer et al.,
1998
), we analyzed the initial stages of otic induction in
pax8 morphants. Knockdown of pax8 does not eliminate
pax8 mRNA expression in otic precursor cells, but reduces the size of
the preotic domain of pax8 expression at all stages examined
(Fig. 2G,J). The level of
pax8 expression in these cells is also reduced, suggesting a certain
degree of autoregulation. Two other preotic markers, pax2a and
dlx3b, also display reduced preotic domains, but levels of expression
are relatively normal (Fig.
2H,K,I,L). Hindbrain (HB) patterning is normal in pax8
morphants as judged by expression patterns of krox20, fgf3, fgf8,
wnt8 and wnt8b (Fig.
2H,K; see also Fig.
5), suggesting that impairment of preotic development is not due
to loss of HB signals. We infer that a reduced level of pax8 impairs
the response of preplacodal cells to otic-inducing signals (see Discussion).
Alternatively, otic induction may proceed normally in pax8 morphants,
but placodal cells proliferate less in the absence of Pax8. However,
previously published work on the role of Fgf3 and Fgf10 during otic
development in the mouse suggests that this latter explanation is not the case
(Alvarez et al., 2003
;
Wright and Mansour, 2003
).
|
|
|
|
A similar phenotype to the pax2a-pax2b-pax8-deficient phenotype is seen in noi (pax2a)-pax8-deficient embryos (not shown). Because pax2b is still expressed, we infer that pax2b alone is not sufficient to maintain otic development. Nevertheless, the frequency of total ear loss in noi (pax2a)- pax8-deficient embryos (22%, n=23) is lower than in pax2a-pax2b-pax8-deficient embryos (47%, n=36), suggesting that pax2b can contribute to otic maintenance. To test this further, we injected wild-type embryos with pax2b-MO and pax8-MO. Otic development is similar to that seen in pax8-deficient embryos through 18 hpf (Fig. 5M,N, and data not shown). However, pax2b-pax8-deficient embryos produce a much smaller otic vesicle than pax8-deficient embryos and usually lacks otoliths (Fig. 5O,P), suggesting significant loss of otic tissue after the vesicle begins to form. Thus, both pax2a and pax2b play a role in otic maintenance, but the requirement for pax2a appears more critical.
Because of the strong interaction between pax8 and pax2a, we used the noi (pax2a) mutation to provide a sensitized background in which to test the relative roles of different pax8 splice variants. pax8 variant 1 MO blocks translation of variant 1 isoforms, which lack the N-terminal Paired domain, whereas pax8 variant 2/3 MO blocks translation of isoforms predicted to include the entire Paired domain. Injection of pax8 variant 1 MO into noi (pax2a) mutants usually results in production of a moderately reduced otic vesicle containing hair cells but no otoliths (83%, n=84, Fig. 6A,B). In contrast, injection of pax8 variant 2/3 MO into noi (pax2a) mutants ablates the ear entirely (21/76) or results in production of a relatively small otic vesicle (55/76). In the latter case, however, otoliths are usually produced (Fig. 6C,D). The two translation blockers also differentially affect brain development in the region of the midbrain-hindbrain border (MHB). The MHB does not form in noi (pax2a) mutants. Mutants injected with pax8 variant 2/3 MO invariably show a persistent and intense band of cell death localized to the ventral midline of the MHB region (Fig. 6C,H). This pattern of cell death is never observed in uninjected noi (pax2a) mutants nor in mutants injected with pax8 variant 1 MO (Fig. 6A,F). Instead, 20-30% of noi (pax2a) mutants injected with pax8 variant 1 MO show a moderate increase in cell death in the dorsolateral MHB region (Fig. 6G). The significance of these differences is unclear at present, but the data strongly suggest that Pax8 isoforms containing a complete vs. partial Paired domain have at least some distinct developmental functions.
|
|
|
| Discussion |
|---|
|
|
|---|
At least six splice variants found in the mouse and human show changes in
C-terminal sequences (Kozmik et al.,
1993
), and even more C-terminal variants are found in zebrafish.
Other Pax8 functional domains, including the transactivation domain and the
inhibitory domain, are disrupted in these isoforms. The functional
significance of C-terminal variation is presently unknown; however, altering
the structure of the functional domains may create proteins with altered DNA
sequence specificity or varying transactivation potentials, as has been
previously reported for other members of the zebrafish and mammalian Pax gene
families (Barber et al., 1999
;
Barr et al., 1999
;
Epstein et al., 1994
;
Kozmik et al., 1997
;
Kozmik et al., 1993
;
Nornes et al., 1996
;
Puschel et al., 1992
;
Seo et al., 1998
;
Tavassoli et al., 1997
;
Vogan et al., 1996
;
Zwollo et al., 1997
). It
should be noted that these alternatively spliced isoforms appear to be rare in
zebrafish.
Redundancy among Pax2 and pax8 genes
Knockdown of pax8 causes significant reduction in the amount of
otic tissue produced during induction, and the deficit persists through
subsequent stages of otic development. The small vesicle that is eventually
produced expresses regional markers normally but shows deficiencies in sensory
epithelia. In severe cases, various maculae or cristae are missing or fused,
possibly as a nonspecific consequence of the presence of too little otic
tissue. The closely related genes pax2a and pax2b are
expressed at slightly later stages of preotic development and appear to
partially overlap in function with pax8. Disruption of both
pax2a and pax2b function causes only subtle defects in otic
development, suggesting that pax8 can substantially compensate for
their loss. When the function of all three Pax genes is disrupted, otic tissue
shows progressive diminution during placodal development and is lost entirely
by 24 hpf. Staining with acridine orange does not reveal an obvious increase
in otic cell death, suggesting that otic these cells eventually
dedifferentiate in the absence of otic maintenance mediated by pax2a,
pax2b, and pax8. This notion is further supported by the
observation that the otic domain of dlx3b expression appears to be
progressively lost beginning around 24 hpf. These data strongly support the
hypothesis that pax8 and pax2 functions are partially
redundant. A similar relationship among murine Pax2/5/8 family
members seems likely as well. Pax8 and Pax2 are expressed in
the developing murine ear at the same relative stages as in zebrafish
(Pfeffer et al., 1998
). No ear
defects have been reported in Pax8 knockout mice
(Bouchard et al., 2002
;
Mansouri et al., 1998
), and
defects in Pax2 knockout mice are limited to disturbances in medial
otic vesicle development (Bouchard et al.,
2000
; Burton et al.,
2004
; Favor et al.,
1996
; Torres et al.,
1996
). Otic development has not yet been described in
Pax8-Pax2 double knockout mice, but it seems likely that much more
severe otic defects will result in such embryos. Indeed, such has been
observed with respect to kidney development
(Bouchard et al., 2002
). The
developing kidney undergoes apoptotic cell death at an early stage in
Pax8-Pax2 double mutants, a phenotype not observed in either of the
single mutants (Bouchard et al.,
2002
).
pax8 as part of a genetic network.
Induction of pax8 expression requires at least two distinct
pathways, one mediated by foxi1 and the other by Fgf signaling
(Leger and Brand, 2002
;
Maroon et al., 2002
;
Nissen et al., 2003
;
Phillips et al., 2001
;
Solomon et al., 2003
;
Solomon et al., 2004
). These
inductive pathways are partially independent, but some aspects of
foxi1 expression appear to be regulated by Fgf signaling.
foxi1 is initially expressed in ventral ectoderm but then shows
upregulation in periotic ectoderm roughly 30-60 minutes before induction of
pax8. The spatial pattern of foxi1 expression is unaltered
in embryos depleted for Fgf3 and Fgf8
(Solomon et al., 2004
), but
misexpression of Fgf3 or Fgf8 is sufficient to induce
foxi1 expression in ectopic locations
(Phillips et al., 2004
). It is
possible that foxi1 is sensitive to residual Fgf signaling in
Fgf morphants or, alternatively, Fgf3 and Fgf8 may act in concert
with other factors to regulate foxi1. In any case, expression of
pax8 occurs in the region where foxi1 and Fgf signaling
overlap, and serves as an important nexus linking these pathways.
Our data also indicate that pax8 positively regulates its own expression since the level of pax8 expression is reduced in pax8 morphants. We speculate that pax8 helps mediate otic induction and that this feedback loop magnifies the efficacy of Fgf signaling, extending the range of Fgf action to cells farther from the source. Thus, loss of pax8 would be expected to limit otic induction to cells in close proximity to the signaling source, a prediction borne out by our studies. Subsequent expression of pax2a and pax2b, which require Fgf signaling but not pax8, presumably stabilizes otic fate within the diminished population of preotic cells. Such a model could explain why eliminating Pax8 in the mouse has such mild consequences; in the mouse, Fgf3 is expressed directly within preotic cells, making the need for signal amplification less critical during initial stages of otic induction. Later expression of Pax2 might then be sufficient to stabilize otic development initiated by prior Fgf signaling.
A number of other transcription factors have been implicated in early otic
development, the best characterized of which are dlx3b and dlx4b.
dlx3b/4b are initially expressed in ventral ectoderm but become
restricted by 9 hpf to a contiguous line of cells surrounding the neural plate
(Akimenko et al., 1994
). By 11
hpf, dlx3b/4b show strong upregulation in preotic cells. The early
phases of dlx3b/4b expression are independent of Fgf signaling, but
later upregulation in the otic anlagen fails to occur in embryos depleted for
Fgf3 and Fgf8 (Liu et al.,
2003
; Solomon, 2004); (this report). As such, dlx3b and
dlx4b could serve as another mediator of Fgf signaling (Solomon,
2004). Knockdown of either dlx gene causes mild to moderate
deficiencies in otic development, with much more severe deficiencies seen in
embryos knocked down for both (Liu et al.,
2003
; Solomon and Fritz,
2002
). Embryos homozygous for a deletion that removes dlx3b,
dlx4b and sox9a (a third preotic marker under control of Fgf
signaling) fail to produce an ear, although roughly one-third of mutant
embryos produce a few disorganized otic cells that belatedly express
pax2a. This severe disruption occurs despite the fact that
pax8 is initially expressed normally
(Solomon and Fritz, 2002
).
Thus, pax8 is clearly not sufficient to sustain early otic
development. Other transcription factors also play crucial roles during otic
induction.
In this paper, we have shown that knockdown of both pax2a and
pax8 causes much more severe loss of ear tissue than knocking down
either alone. We have previously shown that foxi1, which is required
for pax8 expression in the otic domain, and dlx3b act in
parallel pathways in early otic placode formation and show a strong
synergistic genetic interaction (Solomon, 2004). The pax8-dlx3b
morphant analysis confirms these previous results and furthermore suggests
that a significant aspect but not all of foxi1 function is mediated
by pax8. Thus, there appear to be multiple regulatory genes that
respond to Fgf signaling and help mediate its effects. Each is likely to
control both redundant and specific functions; hence there is neither a single
`master regulator', analogous to the role played by pax6/eyeless
during eye development, nor an `all-or-none' combinatorial code required for
otic induction. This model partly accounts for the remarkable resilience and
regulative capacity of the developing inner ear
(Baker and Bronner-Fraser,
2001
; Noramly and Grainger,
2002
; Riley and Phillips,
2003
; Torres and Giraldez,
1998
). A similar series of experiments involving pax2-pax8,
dlx3b, foxi1, fgf3-fgf8 and sox9 genes has been performed by
Hans and colleagues (Hans et al.,
2004
). They propose a model that fully agrees with the findings
and conclusions presented here (Hans et
al., 2004
), as well as the model proposed by Solomon et al.
(Solomon et al., 2004
).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Akimenko, M. A., Ekker, M., Wegner, J., Lin, W. and Westerfield,
M. (1994). Combinatorial expression of three zebrafish genes
related to distal-less: part of a homeobox gene code for the head.
J. Neurosci. 14,3475
-3486.[Abstract]
Alvarez, Y., Alonso, M. T., Vendrell, V., Zelarayan, L. C.,
Chamero, P., Theil, T., Bosl, M. R., Kato, S., Maconochie, M.,
Riethmacher, D. et al. (2003). Requirements for FGF3 and
FGF10 during inner ear formation. Development
130,6329
-6338.
Baker, C. V. and Bronner-Fraser, M. (2001).
Vertebrate cranial placodes I. Embryonic induction. Dev.
Biol. 232,1
-61.[CrossRef][Medline]
Barber, T. D., Barber, M. C., Cloutier, T. E. and Friedman, T.
B. (1999). PAX3 gene structure, alternative splicing and
evolution. Gene 237,311
-319.[CrossRef][Medline]
Barr, F. G., Fitzgerald, J. C., Ginsberg, J. P., Vanella, M. L.,
Davis, R. J. and Bennicelli, J. L. (1999). Predominant
expression of alternative PAX3 and PAX7 forms in myogenic and neural tumor
cell lines. Cancer Res.
59,5443
-5448.
Bouchard, M., Pfeffer, P. and Busslinger, M.
(2000). Functional equivalence of the transcription factors Pax2
and Pax5 in mouse development. Development
127,3703
-3713.[Abstract]
Bouchard, M., Souabni, A., Mandler, M., Neubuser, A. and
Busslinger, M. (2002). Nephric lineage specification by Pax2
and Pax8. Genes Dev. 16,2958
-2970.
Brand, M., Heisenberg, C. P., Jiang, Y. J., Beuchle, D., Lun,
K., Furutani-Seiki, M., Granato, M., Haffter, P., Hammerschmidt, M., Kane, D.
A. et al. (1996). Mutations in zebrafish genes affecting the
formation of the boundary between midbrain and hindbrain.
Development 123,179
-190.[Abstract]
Burton, Q., Cole, L. K., Mulheisen, M., Chang, W. and Wu, D.
K. (2004). The role of Pax2 in mouse inner ear development.
Dev. Biol. 272,161
-175.[CrossRef][Medline]
Chi, N. and Epstein, J. A. (2002). Getting your
Pax straight: Pax proteins in development and disease. Trends
Genet. 18,41
-47.[CrossRef][Medline]
Czerny, T., Bouchard, M., Kozmik, Z. and Busslinger, M.
(1997). The characterization of novel Pax genes of the sea urchin
and Drosophila reveal an ancient evolutionary origin of the Pax2/5/8
subfamily. Mech. Dev.
67,179
-192.[CrossRef][Medline]
Dahl, E., Koseki, H. and Balling, R. (1997).
Pax genes and organogenesis. Bioessays
19,755
-765.[CrossRef][Medline]
Dorfler, P. and Busslinger, M. (1996).
C-terminal activating and inhibitory domains determine the transactivation
potential of BSAP (Pax-5), Pax-2 and Pax-8. EMBO J.
15,1971
-1982.[Medline]
Draper, B. W., Morcos, P. A. and Kimmel, C. B.
(2001). Inhibition of zebrafish fgf8 pre-mRNA splicing with
morpholino oligos: a quantifiable method for gene knockdown.
Genesis 30,154
-156.[CrossRef][Medline]
Ekker, M., Akimenko, M. A., Bremiller, R. and Westerfield,
M. (1992a). Regional expression of three homeobox transcripts
in the inner ear of zebrafish embryos. Neuron
9, 27-35.[CrossRef][Medline]
Ekker, S. C., von Kessler, D. P. and Beachy, P. A.
(1992b). Differential DNA sequence recognition is a determinant
of specificity in homeotic gene action. EMBO J.
11,4059
-4072.[Medline]
Ellies, D. L., Stock, D. W., Hatch, G., Giroux, G., Weiss, K. M.
and Ekker, M. (1997). Relationship between the genomic
organization and the overlapping embryonic expression patterns of the
zebrafish dlx genes. Genomics
45,580
-590.[CrossRef][Medline]
Epstein, J. A., Glaser, T., Cai, J., Jepeal, L., Walton, D. S.
and Maas, R. L. (1994). Two independent and
interactive DNA-binding subdomains of the Pax6 paired domain are regulated by
alternative splicing. Genes Dev.
8,2022
-2034.
Favor, J., Sandulache, R., Neuhauser-Klaus, A., Pretsch, W.,
Chatterjee, B., Senft, E., Wurst, W., Blanquet, V., Grimes, P., Sporle,
R. et al. (1996). The mouse Pax2(1Neu) mutation is identical
to a human PAX2 mutation in a family with renal-coloboma syndrome and results
in developmental defects of the brain, ear, eye, and kidney. Proc.
Natl. Acad. Sci. USA 93,13870
-13875.
Hans, S., Liu, D. and Westerfield, M. (2004).
Pax8 and Pax2a function synergistically in otic specification, downstream of
the Foxi1 and Dlx3b transcription factors. Development
131,5091
-5102.
Jowett, T. (1996). Double fluorescent in situ
hybridization to zebrafish embryos. Trends. Genet.
12,387
-389.[CrossRef][Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and
Schilling, T. F. (1995). Stages of embryonic
development of the zebrafish. Dev. Dyn.
203,253
-310.[Medline]
Kozmik, Z., Kurzbauer, R., Dorfler, P. and Busslinger, M.
(1993). Alternative splicing of Pax-8 gene transcripts is
developmentally regulated and generates isoforms with different
transactivation properties. Mol. Cell. Biol.
13,6024
-6035.
Kozmik, Z., Czerny, T. and Busslinger, M.
(1997). Alternatively spliced insertions in the paired domain
restrict the DNA sequence specificity of Pax6 and Pax8. EMBO
J. 16,6793
-6803.[CrossRef][Medline]
Krauss, S., Johansen, T., Korzh, V., Moens, U., Ericson, J. U.
and Fjose, A. (1991). Zebrafish pax[zf-a]: a paired
box-containing gene expressed in the neural tube. EMBO
J. 10,3609
-3619.[Medline]
Krelova, J., Holland, L. Z., Schubert, M., Burgtorf, C., Benes,
V. and Kozmik, Z. (2002). Functional equivalency of
amphioxus and vertebrate Pax258 transcription factors suggests that the
activation of mid-hindbrain specific genes in vertebrates occurs via the
recruitment of Pax regulatory elements. Gene
282,143
-150.[CrossRef][Medline]
Leger, S. and Brand, M. (2002). Fgf8 and Fgf3
are required for zebrafish ear placode induction, maintenance and inner ear
patterning. Mech. Dev.
119,91
-108.[CrossRef][Medline]
Liu, D., Chu, H., Maves, L., Yan, Y. L., Morcos, P. A.,
Postlethwait, J. H. and Westerfield, M. (2003). Fgf3 and Fgf8
dependent and independent transcription factors are required for otic placode
specification. Development
130,2213
-2224.
Lun, K. and Brand, M. (1998). A series of no
isthmus alleles of the zebrafish pax2.1 gene reveals multiple signaling events
in development of the midbrain-hindbrain boundary.
Development 125,3049
-3062.[Abstract]
Mansouri, A., Hallonet, M. and Gruss, P.
(1996). Pax genes and their roles in cell differentiation and
development. Curr. Opin. Cell Biol.
8, 851-857.[CrossRef][Medline]
Mansouri, A., Chowdhury, K. and Gruss, P.
(1998). Follicular cells of the thyroid gland require Pax8 gene
function. Nat. Genet.
19, 87-90.[CrossRef][Medline]
Maroon, H., Walshe, J., Mahmood, R., Kiefer, P., Dickson, C. and
Mason, I. (2002). Fgf3 and Fgf8 are required together
for formation of the otic placode and vesicle.
Development 129,2099
-2108.
Nasevicius, A. and Ekker, S. C. (2000).
Effective targeted gene `knockdown' in zebrafish. Nat.
Genet. 26,216
-220.[CrossRef][Medline]
Nissen, R. M., Yan, J., Amsterdam, A., Hopkins, N. and Burgess,
S. M. (2003). Zebrafish foxi one modulates cellular responses
to Fgf signaling required for the integrity of ear and jaw patterning.
Development 130,2543
-2554.
Noramly, S. and Grainger, R. M. (2002).
Determination of the embryonic inner ear. J.
Neurobiol. 53,100
-128.[CrossRef][Medline]
Nornes, S., Mikkola, I., Krauss, S., Delghandi, M., Perander, M.
and Johansen, T. (1996). Zebrafish Pax9 encodes two
proteins with distinct C-terminal transactivating domains of different potency
negatively regulated by adjacent N-terminal sequences. J. Biol.
Chem. 271,26914
-26923.
Oxtoby, E. and Jowett, T. (1993). Cloning of
the zebrafish krox-20 gene (krx-20) and its expression during hindbrain
development. Nucleic Acids Res.
21,1087
-1095.
Pfeffer, P. L., Gerster, T., Lun, K., Brand, M. and Busslinger,
M. (1998). Characterization of three novel members of the
zebrafish Pax2/5/8 family: dependency of Pax5 and Pax8 expression on the
Pax2.1 (noi) function. Development
125,3063
-3074.[Abstract]
Phillips, B. T., Bolding, K. and Riley, B. B.
(2001). Zebrafish fgf3 and fgf8 encode redundant functions
required for otic placode induction. Dev. Biol.
235,351
-365.[CrossRef][Medline]
Phillips, B. T., Storch, E. M., Lekven, A. C. and Riley, B.
B. (2004). A direct role for Fgf but not Wnt in otic placode
induction. Development
131,923
-931.
Plachov, D., Chowdhury, K., Walther, C., Simon, D., Guenet, J.
L. and Gruss, P. (1990). Pax8, a murine paired box
gene expressed in the developing excretory system and thyroid gland.
Development 110,643
-651.
Puschel, A. W., Gruss, P. and Westerfield, M.
(1992). Sequence and expression pattern of pax-6 are highly
conserved between zebrafish and mice. Development
114,643
-651.[Abstract]
Riley, B. B. and Phillips, B. T. (2003).
Ringing in the new ear: resolution of cell interactions in otic development.
Dev. Biol. 261,289
-312.[CrossRef][Medline]
Riley, B. B., Chiang, M., Farmer, L. and Heck, R.
(1999). The deltaA gene of zebrafish mediates lateral inhibition
of hair cells in the inner ear and is regulated by pax2.1.
Development 126,5669
-5678.[Abstract]
Seo, H. C., Saetre, B. O., Havik, B., Ellingsen, S. and Fjose,
A. (1998). The zebrafish Pax3 and Pax7 homologues are highly
conserved, encode multiple isoforms and show dynamic segment-like expression
in the developing brain. Mech. Dev.
70, 49-63.[CrossRef][Medline]
Solomon, K. S. and Fritz, A. (2002). Concerted
action of two dlx paralogs in sensory placode formation.
Development 129,3127
-3136.
Solomon, K. S., Kudoh, T., Dawid, I. B. and Fritz, A.
(2003). Zebrafish foxi1 mediates otic placode formation and jaw
development. Development
130,929
-940.
Solomon, K. S., Kwak, S. J. and Fritz, A.
(2004). Genetic interactions underlying otic placode induction
and formation. Dev. Dyn.
230,419
-433.[CrossRef][Medline]
Stuart, E. T., Kioussi, C. and Gruss, P.
(1994). Mammalian Pax genes. Annu. Rev.
Genet. 28,219
-236.[CrossRef][Medline]
Tavassoli, K., Ruger, W. and Horst, J. (1997).
Alternative splicing in PAX2 generates a new reading frame and an extended
conserved coding region at the carboxy terminus. Hum.
Genet. 101,371
-375.[CrossRef][Medline]
Torres, M. and Giraldez, F. (1998). The
development of the vertebrate inner ear. Mech. Dev.
71, 5-21.[CrossRef][Medline]
Torres, M., Gomez-Pardo, E. and Gruss, P.
(1996). Pax2 contributes to inner ear patterning and optic nerve
trajectory. Development
122,3381
-3391.[Abstract]
Treisman, J., Harris, E. and Desplan, C.
(1991). The paired box encodes a second DNA-binding domain in the
paired homeo domain protein. Genes Dev.
5, 594-604.
Underhill, D. A. and Gros, P. (1997). The
paired-domain regulates DNA binding by the homeodomain within the intact Pax-3
protein. J. Biol. Chem.
272,14175
-14182.
Vogan, K. J., Underhill, D. A. and Gros, P.
(1996). An alternative splicing event in the Pax-3 paired domain
identifies the linker region as a key determinant of paired domain DNA-binding
activity. Mol. Cell. Biol.
16,6677
-6686.[Abstract]
Walther, C., Guenet, J. L., Simon, D., Deutsch, U., Jostes, B.,
Goulding, M. D., Plachov, D., Balling, R. and Gruss, P.
(1991). Pax: a murine multigene family of paired box-containing
genes. Genomics 11,424
-434.[Medline]
Whitfield, T. T., Riley, B. B., Chiang, M. Y. and Phillips,
B. (2002). Development of the zebrafish inner ear.
Dev. Dyn. 223,427
-458.[CrossRef][Medline]
Wiellette, E. L. and Sive, H. (2004). Early
requirement for fgf8 function during hindbrain pattern formation in zebrafish.
Dev. Dyn. 229,393
-399.[CrossRef][Medline]
Wright, T. J. and Mansour, S. L. (2003). Fgf3
and Fgf10 are required for mouse otic placode induction.
Development 130,3379
-3390.
Xu, W., Rould, M. A., Jun, S., Desplan, C. and Pabo, C. O.
(1995). Crystal structure of a paired domain-DNA complex at 2.5 A
resolution reveals structural basis for Pax developmental mutations.
Cell 80,639
-650.[CrossRef][Medline]
Zwollo, P., Arrieta, H., Ede, K., Molinder, K., Desiderio, S.
and Pollock, R. (1997). The Pax-5 gene is
alternatively spliced during B-cell development. J. Biol.
Chem. 272,10160
-10168.
This article has been cited by other articles:
![]() |
S. Cruz, J.-C. Shiao, B.-K. Liao, C.-J. Huang, and P.-P. Hwang Plasma membrane calcium ATPase required for semicircular canal formation and otolith growth in the zebrafish inner ear J. Exp. Biol., March 1, 2009; 212(5): 639 - 647. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Dutton, L. Abbas, J. Spencer, C. Brannon, C. Mowbray, M. Nikaido, R. N. Kelsh, and T. T. Whitfield A zebrafish model for Waardenburg syndrome type IV reveals diverse roles for Sox10 in the otic vesicle Dis. Model. Mech., January 1, 2009; 2(1-2): 68 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Jayasena, T. Ohyama, N. Segil, and A. K. Groves Notch signaling augments the canonical Wnt pathway to specify the size of the otic placode Development, July 1, 2008; 135(13): 2251 - 2261. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wendl, D. Adzic, J. J. Schoenebeck, S. Scholpp, M. Brand, D. Yelon, and K. B. Rohr Early developmental specification of the thyroid gland depends on han-expressing surrounding tissue and on FGF signals Development, August 1, 2007; 134(15): 2871 - 2879. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hans and M. Westerfield Changes in retinoic acid signaling alter otic patterning Development, July 1, 2007; 134(13): 2449 - 2458. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nechiporuk, T. Linbo, K. D. Poss, and D. W. Raible Specification of epibranchial placodes in zebrafish Development, February 1, 2007; 134(3): 611 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Millimaki, E. M. Sweet, M. S. Dhason, and B. B. Riley Zebrafish atoh1 genes: classic proneural activity in the inner ear and regulation by Fgf and Notch Development, January 15, 2007; 134(2): 295 - 305. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Clarke, S. R. Patel, R. M. Raymond Jr, S. Andrew, B. G. Robinson, G. R. Dressler, and P. D. Brophy Regulation of c-Ret in the developing kidney is responsive to Pax2 gene dosage Hum. Mol. Genet., December 1, 2006; 15(23): 3420 - 3428. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Bricaud and A. Collazo The Transcription Factor six1 Inhibits Neuronal and Promotes Hair Cell Fate in the Developing Zebrafish (Danio rerio) Inner Ear J. Neurosci., October 11, 2006; 26(41): 10438 - 10451. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||