|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 December 2004
doi: 10.1242/dev.01577
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The McKusick-Nathans Institute of Genetic Medicine, The Johns Hopkins University School of Medicine, 733 N. Broadway, BRB 455, Baltimore, MD 21205, USA
* Author for correspondence (e-mail: sfisher{at}jhmi.edu)
Accepted 9 November 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Chordin, Twisted gastrulation, BMP, Dorsoventral patterning, Zebrafish
| Introduction |
|---|
|
|
|---|
Chordin contains four cysteine-rich (CR) domains, similar to those found in
a number of extracellular matrix proteins
(Sasai et al., 1994
).
High-affinity binding of Chordin for BMPs resides in its CR domains
(Larraín et al., 2000
);
CR1 and CR3 have significant binding affinity as individual domains, although
approximately one-tenth that of the full-length (FL) protein, and the
biological activity of FL Chordin and its fragments roughly parallels their
binding affinities. These data predict that cleavage of Chordin into smaller
fragments would significantly reduce its biological activity as a BMP
inhibitor.
tolloid (tld) was first identified as a zygotic
Drosophila gene required for dorsoventral (DV) patterning, and
homologous to vertebrate Bmp1
(Shimell et al., 1991
). Tld
cleaves Sog at two sites, presumably explaining its ability to enhance Dpp
signaling by decreasing the levels of a Dpp inhibitor
(Marques et al., 1997
). In
addition to Bmp1, several other Tld-related vertebrate enzymes have been
identified. Some of these similarly cleave Chordin in vitro
(Blader et al., 1997
;
Piccolo et al., 1997
;
Scott et al., 1999
), and when
misexpressed in the embryo can antagonize Chordin function
(Goodman et al., 1998
;
Piccolo et al., 1997
).
Direct genetic evidence for the importance of vertebrate Tld proteins in
regulating Chordin has been less clear. The zebrafish DV patterning gene
mini-fin (mfn; tll1 Zebrafish Information
Network) encodes a Tld-related enzyme
(Connors et al., 1999
), which
cleaves Chordin in vitro (Blader et al.,
1997
). However, mfn mutants have no phenotype during
gastrulation, when chordin expression is highest, and the mutation
has not been correlated with abnormalities in Chordin cleavage in vivo. In
mouse, the Bmp1 and Tll1 genes have each been knocked out
(Clark et al., 1999
;
Suzuki et al., 1996
),
revealing functions in heart septation, body wall closure and collagen
processing. However, none of these roles have been correlated with
abnormalities in Chordin cleavage in the single mutant mice. Analysis of cells
from single and double mutants has shown redundant function for the two
enzymes in cleaving Chordin and other substrates
(Pappano et al., 2003
).
Genetic analysis in vertebrates is clearly complicated by the fact that
multiple enzymes cleave Chordin, and redundancy masks the importance of this
regulatory mechanism.
The Drosophila twisted gastrulation (tsg) gene is
required for peak Dpp signaling in the dorsal embryo, and also cooperates with
Sog to inhibit Dpp signaling (Mason et
al., 1994
; Mason et al.,
1997
). Vertebrate Tsg genes have been reported both to enhance
(Oelgeschlager et al., 2000
;
Zakin and De Robertis, 2004
)
and inhibit (Blitz et al.,
2003
; Chang et al.,
2001
; Ross et al.,
2001
; Scott et al.,
2001
) BMP signaling. To reconcile these findings, a model has been
proposed in which Tsg acts in two steps, first enhancing the binding of
Chordin to BMP, then after cleavage helping to displace the Chordin fragments
(Larraín et al., 2001
).
According to this model, the amount of Tld activity determines the balance
between these two counteracting functions. In vitro, Tsg increases cleavage of
mouse Chordin at the two identified Tld cleavage sites and at an additional,
intermediate site not used in the absence of Tsg
(Scott et al., 2001
). A
similar cleavage of Sog occurs in the Drosophila embryo, generating a
more potent Dpp inhibitor termed `Supersog'
(Yu et al., 2000
). If such a
cleavage occurs in vivo for the vertebrate protein, it would ascribe a
positive role to both Tld and Tsg in Chordin regulation.
We assessed the role of Tld in regulation of Chordin in the zebrafish gastrula and examined the effect of Tsg on Chordin cleavage and function. Through alterations of conserved residues near the cleavage sites, we created Chordin mutants that retain BMP-inhibitory activity but are resistant to Tld cleavage at one or both sites. RNAs encoding wild-type and cleavage mutant (CM) Chordins were used to rescue zebrafish chordin/dino (din; chd Zebrafish Information Network) mutant embryos. Prevention of cleavage at either site enhances the ability of Chordin to rescue din mutants, confirming the importance of cleavage as a regulatory mechanism. We also provide evidence that the product of the downstream cleavage event is a stronger BMP inhibitor than the FL protein, suggesting a positive role for cleavage in Chordin regulation. We show that Chordin cleavage is extremely rapid in vivo, and that redundant enzymes cleave Chordin in mfn mutants. However, we find no evidence of alternative cleavage sites being used in either the wild-type or CM proteins. Furthermore, we show that endogenous Tsg decreases steady state Chordin in the embryo, reducing its effectiveness as a BMP inhibitor. We reassessed the tsg1 (tsga Zebrafish Information Network) morphant phenotype, both in wild-type and din mutant backgrounds; we find that the predominant effect of Tsg in the zebrafish gastrula is to enhance BMP signaling, and that it can also do so independently of Chordin.
| Materials and methods |
|---|
|
|
|---|
Site-directed mutagenesis
The QuikChange site-directed mutagenesis kit (Stratagene) was used to
introduce mutations into the zebrafish chordin coding sequence,
starting with a previously described injection construct in the pCS2+ vector
(Miller-Bertoglio et al.,
1997
). The sequence surrounding the upstream cleavage site was
altered to TTCTTCAACAACAGA, and surrounding the downstream
cleavage site to ATGTTGCAGGCGAACGGG (altered bases are in bold).
All constructs were verified by sequencing.
Construction of epitope-tagged chordins
The six-copy Myc tag was excised from the pCS2+MT vector with ClaI
and XbaI and inserted following the wild-type and CM-chordin
coding sequences. To verify that the tagged RNAs gave rise to full-length,
stable proteins, they were subjected to in vitro translation and the resulting
proteins detected by western blotting for Myc (data not shown). In initial
experiments, similar amounts of tagged and untagged RNAs rescued din
mutants, showing that the Myc sequences did not adversely affect protein
activity or stability (data not shown). Therefore, subsequent rescue
experiments were performed with the C-terminal tagged constructs.
To construct N-terminal tagged chordin vectors, a linker encoding the first 29 amino acids of Chordin was synthesized and inserted into the BamHI site of pCS2+MT. Then the remainder of the wild-type and CM-chordin coding sequences were amplified by PCR and inserted into the EcoRI and XbaI sites downstream of the Myc tags. Although placement of the Myc tag at the N-terminus does somewhat destabilize the protein, these RNAs also rescue din mutants at levels comparable with the untagged RNAs, showing that the proteins are functional.
To construct the vector encoding the N+I fragment containing the mutation of the upstream cleavage site (N+IA), the sequence encoding amino acids 1 to 849 of CMA was amplified and inserted into the pCS2+MT vector between BamHI and ClaI.
As a control for quantification of Myc-tagged Chordins, a construct was made encoding a GFP-Myc fusion protein with the signal peptide of Chordin added at its N terminus. This RNA was co-injected with tagged chordin RNAs, and the amount of its product used as an internal standard for quantification.
RNA and morpholino injections and phenotypic scoring of injected embryos
The sequence of tsg1-MO1 has been previously described
(Ross et al., 2001
). The
non-overlapping MO5 (CGCCGAACTCTGAGCTGAGCAGAAC), the four-base mismatch to MO1
(CTCATGTTGATGATGAACACCGCAT) and the five-base mismatch to MO5
(CCCCCAACTCTCAGCTCAGCACAAC) were gifts from M. Mullins.
RNAs for injection were transcribed with the mMessage mMachine Sp6 kit
(Ambion) from NotI linearized templates. RNAs were quantified by
spectrophotometry and the amounts confirmed by agarose gel electrophoresis.
For each injection experiment, the RNAs encoding different versions of Chordin
were synthesized, purified and quantified in parallel. RNA injections were
performed as previously described (Fisher
and Halpern, 1999
). On the following day, embryos were scored
using standard phenotypic indicators of excess or decreased BMP signaling
(Hammerschmidt et al., 1996
;
Mullins et al., 1996
). For the
rescue experiments, `ventralized' embryos resembled din mutants
(small brain and somites, excess blood in ventral tail, multiplicated fin
folds), `rescued' embryos appeared wildtype or mildly dorsalized (Class 1, or
partially absent ventral fin fold) and `dorsalized' embryos were those in
Class 2-5 (more severe tail defects or truncations, tail curled on top of
yolk, some or all somites expanded to encircle the yolk).
Some morphant embryos were fixed at 80% epiboly or 8 to 12 somite stages,
and in situ hybridizations performed as previously described
(Miller-Bertoglio et al.,
1997
), using bmp4, chd, evel, gsc, gata2, krox20
(egr2b Zebrafish Information Network) and myod as
markers indicative of DV patterning.
RNA encoding Tsg1 was transcribed as above and co-injected to rescue the tsg1 morphant phenotype. The construct containing the Xenopus tsg1 coding sequence, with the signal peptide replaced with that of ECM protein BM40/SPARC, was a gift from M. O'Connor.
Immunoprecipitation and western blotting
Embryos were collected and homogenized in ice cold extraction buffer [250
mM sucrose, 4 mM EDTA, 100 mM NaCl, 10 mM Tris-HCl (pH 7.6)] with added
protease inhibitor cocktail (Roche). After centrifugation, the supernatant was
incubated with agarose-coupled 9E10 anti-Myc antibody (Santa Cruz Biotech).
The pellet was collected by centrifugation, washed four times with RIPA buffer
(PBS, 1%NP-40, 0.5% sodium deoxycholate, 0.1% SDS) and one time with 50 mM
Tris (pH 6.8). The pellet was resuspended in electrophoresis sample buffer and
analyzed by western blotting. Protein gel electrophoresis and immunoblotting
were performed according to standard protocols
(Harlow and Lane, 1988
;
Westerfield, 1995
). 9E10
anti-Myc antibody (Santa Cruz Biotech) was used to detect tagged Chordin
fragments, and blots were visualized with the ECL Plus kit (Amersham). Some
blots were scanned with a Storm Phosphorimager; individual bands were
quantified using the local average method.
| Results |
|---|
|
|
|---|
10-fold more potent than wild-type chordin in the rescue assay,
demonstrating the importance of Tld cleavage in vivo as a mechanism to limit
Chordin activity. We predicted that partial cleavage products of Chordin would
have reduced BMP-binding affinity, and therefore the partial cleavage mutants
would be intermediate in efficacy between wild-type and CMAB.
CMB was
3-fold more potent than wild type, fitting this
prediction. However, CMA was more potent than CMAB, a
result we have repeated in several independent experiments and with multiple
batches of RNA (see also Fig.
3A, Fig. 4A).
|
|
|
|
50 kDa is non-specific and also observed in negative control
samples not injected with Myc-tagged RNA. In conclusion, we see no evidence of
alternative cleavage products by examining proteins labeled at either the C or
N terminus, even when cleavage is prevented at both of the normal Tld
sites. Because of the enhanced accumulation of labeled protein from CMB, we wanted to also compare the stability of the N-terminal fragments. They generally appeared less stable than C-terminal fragments, but we directly tested the effect of Myc tag position on stability. We injected two groups of embryos with the same amount of CMAB RNA, labeled at either the C or N terminus, and processed the samples in parallel. Similar amounts of labeled proteins were detected 5 hours after injection, but substantially less N-terminal labeled protein at 20 hours (data not shown). Therefore, we could not compare the stability of FL Chordin and the cleavage products over longer periods. However, over shorter time periods, there did not appear to be greater accumulation of labeled protein from CMA than from CMAB (Fig. 1D and data not shown).
We examined the products of Chordin cleavage at several time points after injection. For wild-type Chordin, almost all detectable protein was in the form of the small C-terminal fragment 8 hours after injection (Fig. 2A). On longer exposure, small amounts of FL protein and I+C fragment were seen, and the amounts decreased slightly from 8-14 hours. For CMA a similar amount of FL protein was detected at the time points examined (Fig. 2A). For CMB, significantly more total Myc tag was detected at all time points, as noted above (Fig. 2A). Although in the blot in Fig. 2A it is impossible to resolve the faint band representing FL protein in the CMB samples, upon longer electrophoresis of additional samples, we verified that a similar amount of FL protein is present in embryos injected with CMB, CMA or wild-type chordin at 6 hours (Fig. 2C). Over the period examined, we did not observe large differences in cleavage kinetics for the different forms of Chordin, but because of the rapidity of cleavage, we cannot exclude subtle differences.
Our results demonstrate robust endogenous Tld activity in the zebrafish
embryo, even prior to gastrulation. The zebrafish DV patterning gene
mfn encodes a Tld-related enzyme
(Connors et al., 1999
), shown
to cleave Chordin in vitro (Blader et al.,
1997
). When wild-type chordin RNA was injected into
mfn;din double mutants, an increase in the amount of FL protein was
seen (Fig. 2B). However, the
majority (>75%) of detectable Myc tag was still on the small C-terminal
fragment, showing that redundant enzyme activity compensates for loss of
mfn. We also observed slight increases in FL protein for both of the
partial CM Chordins (Fig. 2C),
indicating that Mfn does not show a strong preference for cleavage either
site.
Our rescue data suggest that the N+I fragment of Chordin is a stronger BMP inhibitor than the FL protein. To test this directly, we constructed a version of chordin encoding the N+I fragment containing the mutations of the upstream cleavage site in CMA (N+IA). We compared its efficacy in the rescue of din mutants to CMA and CMAB-Chordin. The N+IA fragment was slightly more effective than CMA (Fig. 3A), and both were more effective than CMAB. These CM constructs are useful for separating the effects of cleavage and binding, although they admittedly give rise to stable fragments not present endogenously. However, the N+I fragment is normally produced in the embryo from wild-type Chordin, and is present at steady-state levels comparable with the FL protein (Fig. 3B), suggesting that it could significantly contribute to BMP inhibition in the embryo.
It is possible that an additional protein participates in the binding and
preferentially increases the affinity of the N+I fragment for BMPs. Although
Tsg displaces the N+I fragment from BMP in vitro
(Larraín et al., 2001
),
it has been shown to enhance the binding of other Chordin fragments and the FL
protein (Chang et al., 2001
;
Larraín et al., 2001
;
Oelgeschlager et al., 2000
;
Ross et al., 2001
;
Scott et al., 2001
). To test
Tsg as a candidate for this additional protein, we depleted embryos of Tsg
function using a previously described antisense morpholino directed against
tsg1 (tsg1-MO1) (Ross et
al., 2001
). We rescued din mutants with each
chordin RNA in the absence or presence of tsg1-MO1; in every
case, the depletion of Tsg resulted in a greater percentage of rescued or
dorsalized embryos (Fig. 4A). These data argue that Tsg does not preferentially enhance the binding of the
N+I fragment, and further support a general role for Tsg in decreasing the
effectiveness of Chordin as a BMP inhibitor.
To determine the mechanism of this effect, we compared the Chordin cleavage
products in the absence and presence of tsg1-MO1
(Fig. 4B). These experiments
were first performed in mfn;din double mutants, to enhance the
accumulation of FL protein and more readily reveal alterations in the ratio of
cleavage products. For all versions of Chordin, more total protein was
observed in the presence of tsg1-MO1, indicating that endogenous Tsg
decreases Chordin levels (Fig.
4C). The ratio of FL protein to cleavage products seen in the
wild-type, CMA and CMB samples was also slightly greater
(6-10%) in the presence of tsg1-MO1. This is consistent with previous
reports that Tsg enhances Tld cleavage rates
(Larraín et al., 2001
;
Scott et al., 2001
;
Shimmi and O'Connor, 2003
),
and further suggests that Tsg does not have a differential effect on cleavage
at the two sites. We performed additional experiments in din mutants,
to verify the effect of Tsg in the presence of Mfn, and also to examine
N-terminal fragments. These experiments were performed with the addition of a
control RNA encoding Myc-tagged GFP. When the amount of GFP was used as an
internal standard to normalize Chordin, we observed similar increases in total
Chordin in the presence of tsg1-MO1
(Fig. 4D,E). Experiments
performed with a control morpholino showed no increase in Chordin (data not
shown). We also did not observe products of cleavage at any site between the A
and B sites, even when cleavage was prevented at those sites. When wild-type
chordin was co-injected with tsg1 RNA to increase Tsg
activity, we still observed no additional fragments, nor did we see a large
decrease in total Chordin (Fig.
4D,E). This suggests that our failure to observe alternative
cleavage was not due to insufficient Tsg.
Our data are inconsistent with previous reports that depletion of Tsg
promotes BMP signaling (Blitz et al.,
2003
; Chang et al.,
2001
; Scott et al.,
2001
) and ventralizes the zebrafish embryo
(Ross et al., 2001
). To test
the possibility that Tsg has different roles that predominate at different
protein levels, we re-examined the tsg1 morphant phenotype, injecting
different amounts of tsg1-MO1 into wild-type embryos. At a lower MO
level, we observed some features suggestive of ventralization in the morphants
(Fig. 5B,C,N), including a
reduced anterior nervous system and blood accumulation in the ventral tail.
However, the morphants did not have multiplicated ventral fin folds, which is
a prominent feature of ventralized din and ogon mutants
(Hammerschmidt et al., 1996
).
Importantly, at higher MO levels we observed primarily dorsalized phenotypes
in the morphants (Fig. 5I,N),
consistent with our rescue data and the effect of Tsg depletion on Chordin
levels.
|
As an additional control for the specificity of the morphant phenotypes, we co-injected tsg1-MO with tsg1 RNA (data not shown). At the lower MO level, 1 pg of tsg1 RNA rescued the phenotype of blood accumulation in the ventral tail, but did not correct the narrowing of the anterior nervous system, supporting our belief that it is non-specific. At the higher MO level, tsg1 RNA also corrected the features of dorsalization. We also performed injections with mismatch control MOs, and observed none of the phenotypes produced with either high or low amounts of the specific MOs.
Another possible explanation for the disparate roles ascribed to Tsg is that it acts on Chordin to decrease its efficacy as a BMP inhibitor, and simultaneously inhibits BMP signaling through an independent mechanism. To test this hypothesis, we injected tsg1-MO1 into din mutants. Surprisingly, this depletion of Tsg partially rescued or even dorsalized din mutants (Fig. 5E,F,L,M). These results provide strong evidence that Tsg also can act independently of Chordin, but to further enhance rather than inhibit BMP signaling.
| Discussion |
|---|
|
|
|---|
Chordin cleavage is an important regulatory mechanism in the zebrafish gastrula
Previously we have shown that chordin RNA injected into embryos at
the one-cell stage is detectable by in situ hybridization for
10 hours
(Fisher and Halpern, 1999
).
Therefore, at 5 hours after injection there is still RNA available for new
protein synthesis. However, at this time point the large majority of Chordin
has been cleaved, demonstrating robust endogenous Tld activity even prior to
gastrulation. Our data further show that cleavage at the A and B sites occurs
independently and that the kinetics of cleavage are not significantly
different for wild-type and CM Chordins.
The unexpectedly mild phenotype of the zebrafish mutant mfn has
led to speculation that, at least in zebrafish, Chordin cleavage does not play
an important role in DV patterning during gastrulation
(Connors et al., 1999
;
Oelgeschlager et al., 2003
;
Zakin and De Robertis, 2004
).
We show instead that redundant enzyme activity compensates for loss of
mfn. Both during and after gastrulation, the majority of Chordin
protein is cleaved in mfn mutants, although measurably less than in
wild type. In mouse, the Tld-related Bmp1 and Tll1 gene
products function redundantly to cleave Chordin and other substrates
(Pappano et al., 2003
). The
mfn gene is most closely homologous to Tll1
(Scott et al., 1999
); we have
identified zebrafish ESTs corresponding to a second ortholog of Tll1,
which is strongly expressed in the early embryo (J.X. and S.F., unpublished).
The product of this gene is a likely candidate for at least some of the Tld
activity present in mfn mutants.
Positive role for Tld in Chordin regulation
Although mutating either cleavage site increased the efficacy of Chordin as
a BMP inhibitor, the effect of alterations at the two sites was not equal.
Prevention of cleavage at both sites resulted in a stable FL protein
10
times more effective as a BMP inhibitor. However, by preventing cleavage at
the upstream site, we created a C-terminally truncated Chordin fragment that
was even more effective than the stable FL protein. Another protein may
participate in Chordin-BMP binding in vivo, selectively increasing the
effectiveness of the truncated Chordin. Our data indicate that Tsg is unlikely
to play this role, as it decreases the efficacy of all cleavage forms of
Chordin. In fact, although there is evidence from a number of in vitro binding
studies that Tsg enhances the binding of FL Chordin to BMP
(Larraín et al., 2001
;
Oelgeschlager et al., 2000
;
Scott et al., 2001
), our data
indicate that this is not its predominant role in vivo. If it were, then the
efficacy of CMAB would decrease in embryos depleted of Tsg.
The N+I fragment may be more stable than the FL protein, as we observed for
the I+C fragment. It is difficult to assess this because of the destabilizing
effect of N-terminal Myc epitopes. However, at several time points there
appeared to be comparable levels of labeled protein accumulated from the
CMA and CMAB constructs (see
Fig. 1D; data not shown),
making this unlikely. We favor the possibility that CR4, which has little BMP
binding affinity or biological activity on its own
(Larraín et al., 2000
;
Scott et al., 2001
), actually
decreases the overall binding affinity of the FL protein.
There is evidence in Drosophila for an alternative cleavage
product of Sog with enhanced Dpp inhibitory activity, whose creation is
promoted by Tsg (Yu et al.,
2000
). Tsg also enhances Chordin cleavage at an intermediate site
in vitro, suggesting that a parallel event occurs for the vertebrate proteins
(Scott et al., 2001
). However,
we see no evidence of alternative cleavage products, either when cleavage is
prevented at both of the normal Tld sites or when tsg1 is
overexpressed by RNA injection. We cannot rule out that this cleavage event
takes place in a small region of the embryo, or in specific tissues later in
development. However, the necessary components (Chordin, Tld enzymes, and Tsg)
are all present in the gastrula, and we should be able to detect fragments
present even at less than 1% of the total label on our western blots.
Therefore, we conclude that such cleavage is not likely to play a significant
role in the gastrula.
Tld cleavage might also play a positive role if Chordin fragments have
novel activities, independent of BMP binding. However, several lines of
evidence argue against this. In particular, the epistatis between
dino and the BMP mutants swirl and snailhouse has
been examined (Wagner and Mullins,
2002
). That study confirmed that the BMP mutant phenotypes are
epistatic to dino, and importantly discovered no additional
phenotypes in the double mutants, as would be expected if Chordin or its
fragments had functions independent of BMP. We also find that
CMAB-Chordin is capable of fully rescuing the din
phenotype, which would not be the case if the fragments had independent
functions.
Tsg decreases steady-state levels of Chordin
To test the effect of Tsg on Chordin efficacy in our system, and the
dependence of the effect on cleavage by Tld at either site, we performed
rescue experiments with wild-type and CM-chordin RNAs in the absence
or presence of tsg1-MO. In every case, the rescue was more effective
under conditions of lowered Tsg, suggesting that Tsg normally acts to suppress
Chordin function in the zebrafish embryo. To determine the molecular basis of
this effect, we examined Chordin cleavage products resulting from these
experiments. The consistent effect of Tsg depletion was to increase
steady-state Chordin levels. It has been previously shown that Tsg has the net
effect of destabilizing Chordin
(Oelgeschlager et al., 2003
)
and that Drosophila Tsg has a similar effect on Sog
(Shimmi and O'Connor, 2003
),
consistent with our data. However, proposed mechanisms for this
destabilization have invoked Tld cleavage. We see a similar effect on levels
of wild-type and CMAB-chordin in tsg1 morphants,
suggesting that this effect is in part independent of Tld cleavage. We do
observe a low level of cleavage or degradation of CMAB-Chordin,
although it appears not to represent cleavage at the normal site, it may still
be mediated by Tld. To resolve this question definitively would require
elimination of all Tld activity from the zebrafish gastrula, a challenge given
the genetic redundancy.
Endogenous Tsg enhances BMP signaling through Chordin dependent and independent mechanisms
Contradictory roles have been ascribed to Tsg in modulating vertebrate BMP
signaling. However, Tsg has been reported in zebrafish embryos to cooperate
with Chordin to inhibit BMPs (Ross et al.,
2001
). To reconcile our data with these published results, we
performed additional Tsg depletions with different levels of
tsg1-MOs. By injecting lower amounts, we did produce features
suggestive of a ventralized phenotype. However, we did not see multiplicated
ventral fin folds in any of the morphants, although this is a sensitive
indicator of increased BMP signaling and is a consistent feature of the
ventralized din and ogon mutants
(Hammerschmidt et al., 1996
).
We did observe narrowing of the anterior nervous system, but morpholinos can
induce non-specific toxic effects in zebrafish
(Heasman, 2002
), including
widespread cell death and neural degeneration
(Braat et al., 2001
;
Lele et al., 2001
). In support
of this possibility, increased apoptosis occurs in the brains of tsg1
morphants (Little and Mullins,
2004
) and is not seen in ventralized din mutants
(Fisher et al., 1997
).
Interestingly, we did observe increased expression of gata2 in
embryos receiving a lower dose of MO. Increased gata2 expression was
also previously reported in tsg1 morphants, and cited as evidence of
their ventralization (Ross et al.,
2001
). However, the increase is apparently downstream of
alterations in DV patterning, and may point to a specific role for
tsg1 in limiting formation of blood or ventral ectoderm. Injection of
higher levels of tsg1-MOs dorsalized the morphants, which we
confirmed by examination of multiple markers during gastrulation. Our results
show that endogenous Tsg enhances BMP signaling in vivo, in part by
destabilizing Chordin.
Several previous studies of the effects of Tsg in the embryo relied on RNA
overexpression. In our hands, tsg1 RNA dorsalizes both wild-type and
din-/- embryos, showing that the effect does not depend on
Chordin (data not shown). This result is apparently at odds with our analysis
of tsg1 morphants, and might suggest a normal role for Tsg in
inhibiting BMPs. However, Tsg binds BMPs with an affinity comparable with that
of individual Chordin CR domains (Chang et
al., 2001
; Oelgeschlager et
al., 2000
; Scott et al.,
2001
). We speculate that, when overexpressed, Tsg can bind BMPs
sufficiently to prevent receptor activation, although this does not reflect
its normal function. Interestingly, mutated versions of Tsg which do not bind
BMPs hyperventralize the zebrafish embryo
(Oelgeschlager et al., 2003
),
consistent with the possibility that the dorsalization seen with
overexpression is due to direct BMP binding.
Many proteins in addition to Chordin contain repeated CR domains, and it
has been proposed that Tsg could also interact with some of these
(Garcia Abreu et al., 2002
;
Oelgeschlager et al., 2003
).
We tested the possibility that Tsg decreases the efficacy of Chordin while
simultaneously inhibiting BMP signaling through another interaction. However,
depletion of Tsg in din mutants ameliorated features of the mutant phenotype
and even dorsalized the mutants. Thus, endogenous Tsg enhances BMP signaling
both in the presence and absence of Chordin, either through direct interaction
with BMPs or in conjunction with other unidentified modulating proteins.
Although we cannot rule out that Tsg inhibits BMP signaling under some
circumstances, we show that it does not do so in the zebrafish gastrula.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Balemans, W. and van Hul, W. (2002).
Extracellular regulation of BMP signaling in vertebrates: a cocktail of
modulators. Dev. Biol.
250,231
-250.[CrossRef][Medline]
Blader, P., Rastegar, S., Fischer, N. and Strahle, U.
(1997). Cleavage of the BMP-4 antagonist chordin by zebrafish
tolloid. Science 278,1937
-1940.
Blitz, I. L., Cho, K. W. and Chang, C. (2003).
Twisted gastrulation loss-of-function analyses support its role as a BMP
inhibitor during early Xenopus embryogenesis.
Development 130,4975
-4988.
Braat, A. K., van de Water, S., Korving, J. and Zivkovic, D.
(2001). A zebrafish vasa morphant abolishes vasa protein but does
not affect the establishment of the germline. Genesis
30,183
-185.[CrossRef][Medline]
Chang, C., Holtzman, D., Chau, S., Chickering, T., Woolf, E.,
Holmgren, L., Bodorova, J., Gearing, D., Holmes, W. and Brivanlou,
A. (2001). Twisted gastrulation can function as a BMP
antagonist. Nature 410,483
-487.[CrossRef][Medline]
Clark, T. G., Conway, S. J., Scott, I. C., Labosky, P. A.,
Winnier, G., Bundy, J., Hogan, B. L. and Greenspan, D. S.
(1999). The mammalian Tolloid-like 1 gene, Tll1, is necessary for
normal septation and positioning of the heart.
Development 126,2631
-2642.[Abstract]
Connors, S. A., Trout, J., Ekker, M. and Mullins, M. C.
(1999). The role of tolloid/mini fin in dorsoventral
pattern formation of the zebrafish embryo. Development
126,3119
-3130.[Abstract]
Fisher, S. and Halpern, M. E. (1999).
Patterning the zebrafish axial skeleton requires early chordin
function. Nat. Genet.
23,442
-446.[CrossRef][Medline]
Fisher, S., Amacher, S. L. and Halpern, M. E.
(1997). Loss of cerebum function ventralizes the zebrafish
embryo. Development 124,1301
-1311.[Abstract]
Francois, V. and Bier, E. (1995). Xenopus
chordin and Drosophila short gastrulation genes encode homologous proteins
functioning in dorsal-ventral axis formation. Cell
80, 19-20.[CrossRef][Medline]
Garcia-Abreu, J., Coffinier, C., Larrain, J., Oelgeschlager, M.
and de Robertis, E. M. (2002). Chordin-like CR domains
and the regulation of evolutionarily conserved extracellular signaling
systems. Gene 287,39
-47.[Medline]
Goodman, S. A., Albano, R., Wardle, F. C., Matthews, G.,
Tannahill, D. and Dale, L. (1998). BMP1-related
metalloproteinases promote the development of ventral mesoderm in early
Xenopus embryos. Dev. Biol.
195,144
-157.[CrossRef][Medline]
Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A., van
Eeden, F. J., Granato, M., Brand, M., Furutani-Seiki, M., Haffter, P.,
Heisenberg, C. P. et al. (1996). dino and
mercedes, two genes regulating dorsal development in the zebrafish
embryo. Development 123,95
-102.[Abstract]
Harlow, E. and Lane, D. (1988).
Antibodies: A Laboratory Manual. Cold Spring Harbor,
NY: Cold Spring Harbor Laboratory Press.
Heasman, J. (2002). Morpholino oligos: making
sense of antisense? Dev. Biol.
243,209
-214.[CrossRef][Medline]
Holley, S. A., Jackson, P. D., Sasai, Y., Lu, B., de Robertis,
E. M., Hoffmann, F. M. and Ferguson, E. L. (1995). A
conserved system for dorsal-ventral patterning in insects and vertebrates
involving sog and chordin. Nature
376,249
-253.[CrossRef][Medline]
Larraín, J., Bachiller, D., Lu, B., Agius, E., Piccolo,
S. and de Robertis, E. M. (2000). BMP-binding modules
in chordin: a model for signalling regulation in the extracellular space.
Development 127,821
-830.[Abstract]
Larraín, J., Oelgeschlager, M., Ketpura, N. I.,
Reversade, B., Zakin, L. and de Robertis, E. M. (2001).
Proteolytic cleavage of Chordin as a switch for the dual activities of Twisted
gastrulation in BMP signaling. Development
128,4439
-4447.
Lele, Z., Bakkers, J. and Hammerschmidt, M.
(2001). Morpholino phenocopies of the swirl, snailhouse,
somitabun, minifin, silberblick, and pipetail mutations.
Genesis 30,190
-194.[CrossRef][Medline]
Little, S. C. and Mullins, M. C. (2004).
Twisted gastrulation promotes BMP signaling in zebrafish dorsal-ventral axial
patterning. Development
131,5825
-5835.
Marques, G., Musacchio, M., Shimell, M. J.,
Wunnenberg-Stapleton, K., Cho, K. W. and O'Connor, M. B.
(1997). Production of a DPP activity gradient in the early
Drosophila embryo through the opposing actions of the SOG and TLD proteins.
Cell 91,417
-426.[CrossRef][Medline]
Mason, E. D., Konrad, K. D., Webb, C. D. and Marsh, J. L.
(1994). Dorsal midline fate in Drosophila embryos requires
twisted gastrulation, a gene encoding a secreted protein related to human
connective tissue growth factor. Genes Dev.
8,1489
-1501.
Mason, E. D., Williams, S., Grotendorst, G. R. and Marsh, J.
L. (1997). Combinatorial signaling by Twisted Gastrulation
and Decapentaplegic. Mech. Dev.
64, 61-75.[CrossRef][Medline]
Miller-Bertoglio, V., Fisher, S., Sánchez, A., Mullins,
M. and Halpern, M. E. (1997). Differential regulation
of chordin expression in zebrafish mutants. Dev. Biol.
192,537
-550.[CrossRef][Medline]
Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J.,
Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Haffter,
P., Heisenberg, C. P. et al. (1996). Genes establishing
dorsoventral pattern formation in the zebrafish embryo: the ventral specifying
genes. Development 123,81
-93.[Abstract]
Oelgeschlager, M., Larrain, J., Geissert, D. and de Robertis, E.
M. (2000). The evolutionarily conserved BMP-binding protein
Twisted gastrulation promotes BMP signalling. Nature
405,757
-763.[CrossRef][Medline]
Oelgeschlager, M., Reversade, B., Larrain, J., Little, S.,
Mullins, M. C. and de Robertis, E. M. (2003). The pro-BMP
activity of Twisted gastrulation is independent of BMP binding.
Development 130,4047
-4056.
Pappano, W. N., Steiglitz, B. M., Scott, I. C., Keene, D. R. and
Greenspan, D. S. (2003). Use of Bmp1/Tll1 doubly
homozygous null mice and proteomics to identify and validate in vivo
substrates of bone morphogenetic protein 1/tolloid-like metalloproteinases.
Mol. Cell. Biol. 23,4428
-4438.
Piccolo, S., Sasai, Y., Lu, B. and de Robertis, E. M.
(1996). Dorsoventral patterning in Xenopus: inhibition of ventral
signals by direct binding of chordin to BMP-4. Cell
86,589
-598.[CrossRef][Medline]
Piccolo, S., Agius, E., Lu, B., Goodman, S., Dale, L. and de
Robertis, E. M. (1997). Cleavage of Chordin by Xolloid
metalloprotease suggests a role for proteolytic processing in the regulation
of Spemann organizer activity. Cell
91,407
-416.[CrossRef][Medline]
Ross, J., Shimmi, O., Vilmos, P., Petryk, A., Kim, H., Gaudenz,
K., Hermanson, S., Ekker, S., O'Connor, M. and Marsh, J.
(2001). Twisted gastrulation is a conserved extracellular BMP
antagonist. Nature 410,479
-483.[CrossRef][Medline]
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K.
and de Robertis, E. M. (1994). Xenopus
chordin: a novel dorsalizing factor activated by organizer-specific
homeobox genes. Cell 79,779
-790.[CrossRef][Medline]
Schmidt, J., Francois, V., Bier, E. and Kimelman, D.
(1995). Drosophila short gastrulation induces an ectopic axis in
Xenopus: evidence for conserved mechanisms of dorsal-ventral patterning.
Development 121,4319
-4328.[Abstract]
Scott, I. C., Blitz, I. L., Pappano, W. N., Imamura, Y., Clark,
T. G., Steiglitz, B. M., Thomas, C. L., Maas, S. A., Takahara, K., Cho,
K. W. Y. et al. (1999). Mammalian BMP-1/Tolloid-related
matalloproteinses, including novel family member mammalian tolloid-like 2,
have differential enzymatic activities and distributions of expression
relevant to patterning and skeletogenesis. Dev. Biol.
213,283
-300.[CrossRef][Medline]
Scott, I., Blitz, I., Pappano, W., Maas, S., Cho, K. and
Greenspan, D. (2001). Homologues of twisted gastrulation are
extracellular cofactors in antagonism of BMP signaling.
Nature 410,475
-478.[CrossRef][Medline]
Shimell, M. J., Ferguson, E. L., Childs, S. R. and O'Connor, M.
B. (1991). The Drosophila dorsal-ventral patterning
gene tolloid is related to human bone morphogenetic protein 1.
Cell 67,469
-481.[CrossRef][Medline]
Shimmi, O. and O'Connor, M. B. (2003). Physical
properties of Tld, Sog, Tsg and Dpp protein interactions are predicted to help
create a sharp boundary in Bmp signals during dorsoventral patterning of the
Drosophila embryo. Development
130,4673
-4682.
Suzuki, N., Labosky, P. A., Furuta, Y., Hargett, L., Dunn, R.,
Fogo, A. B., Takahara, K., Peters, D. M., Greenspan, D. S. and Hogan,
B. L. (1996). Failure of ventral body wall closure in mouse
embryos lacking a procollagen C-proteinase encoded by Bmp1, a
mammalian gene related to Drosophila tolloid.Development 122,3587
-3595.[Abstract]
Wagner, D. S. and Mullins, M. C. (2002).
Modulation of BMP activity in dorsal-ventral pattern formation by the chordin
and ogon antagonists. Dev. Biol.
245,109
-123.[CrossRef][Medline]
Westerfield, M. (1995). The
Zebrafish Book. Eugene, OR: University of Oregon
Press.
Yu, K., Srinivasan, S., Shimmi, O., Biehs, B., Rashika, K. E.,
Kimelman, D., O'Connor, M. B. and Bier, E. (2000).
Processing of the Drosophila Sog protein creates a novel BMP
inhibitory activity. Development
127,2143
-2154.[Abstract]
Zakin, L. and de Robertis, E. M. (2004).
Inactivation of mouse Twisted gastrulation reveals its role in promoting Bmp4
activity during forebrain development. Development
131,413
-424.
Related articles in Development:
This article has been cited by other articles:
![]() |
J.-L. Plouhinec and E. M. De Robertis Systems Biology of the Self-regulating Morphogenetic Gradient of the Xenopus Gastrula Cold Spring Harb Perspect Biol, August 1, 2009; 1(2): a001701 - a001701. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Zhang, Y. Huang, L.-Y. Qiu, J. Nickel, and W. Sebald von Willebrand Factor Type C Domain-containing Proteins Regulate Bone Morphogenetic Protein Signaling through Different Recognition Mechanisms J. Biol. Chem., July 6, 2007; 282(27): 20002 - 20014. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xie, S. L. Bessling, T. K. Cooper, H. C. Dietz, A. S. McCallion, and S. Fisher Manipulating Mitotic Recombination in the Zebrafish Embryo Through RecQ Helicases Genetics, June 1, 2007; 176(2): 1339 - 1342. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Tzachanis, L. Li, E. M. Lafuente, A. Berezovskaya, G. J. Freeman, and V. A. Boussiotis Twisted gastrulation (Tsg) is regulated by Tob and enhances TGF-{beta} signaling in activated T lymphocytes Blood, April 1, 2007; 109(7): 2944 - 2952. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schmidl, N. Adam, C. Surmann-Schmitt, T. Hattori, M. Stock, U. Dietz, B. de Crombrugghe, E. Poschl, and K. von der Mark Twisted Gastrulation Modulates Bone Morphogenetic Protein-induced Collagen II and X Expression in Chondrocytes in Vitro and in Vivo J. Biol. Chem., October 20, 2006; 281(42): 31790 - 31800. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Rentzsch, J. Zhang, C. Kramer, W. Sebald, and M. Hammerschmidt Crossveinless 2 is an essential positive feedback regulator of Bmp signaling during zebrafish gastrulation Development, March 1, 2006; 133(5): 801 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. O'Connor, D. Umulis, H. G. Othmer, and S. S. Blair Shaping BMP morphogen gradients in the Drosophila embryo and pupal wing Development, January 15, 2006; 133(2): 183 - 193. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zakin, B. Reversade, H. Kuroda, K. M. Lyons, and E. M. De Robertis Sirenomelia in Bmp7 and Tsg compound mutant mice: requirement for Bmp signaling in the development of ventral posterior mesoderm Development, May 15, 2005; 132(10): 2489 - 2499. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||