|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 21 September 2005
doi: 10.1242/dev.02032
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Howard Hughes Medical Institute and Department of Biochemistry and Cell Biology, MS-140, Rice University, 6100 South Main Street, Houston, TX 77005-1892, USA
* Author for correspondence (e-mail: richard{at}bioc.rice.edu)
Accepted 8 August 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Chalone, Proliferation, Growth, Size regulation
| Introduction |
|---|
|
|
|---|
However, for many tissues the factors are unknown. For example, when a
spleen is removed from an animal and small fragments of the spleen are
transplanted into various sites in a splenectomized syngeneic animal, the
spleen fragments grow until the integrated mass of the fragments is equivalent
to that of an individual, normal spleen
(Metcalf, 1964
). This
suggested that some factor might mediate signaling between the different
spleen fragments, but the factor has not been identified. When part of the
liver is removed from a mammal, the remaining liver cells begin to
proliferate, and a variety of experiments indicate that a factor secreted by
liver cells limits the proliferation and thus limits the size of the
regenerating liver, but as above the factor remains unknown
(Alison, 1986
). In the
phenomenon of tumor dormancy, tumors appear to secrete factors that inhibit
proliferation of metastatic foci, so that when an individual has a primary
tumor and metastases, surgical removal of the primary tumor appears to
stimulate cell proliferation in the metastatic foci
(Demicheli, 2001
;
Guba et al., 2001
). Although
the primary tumor appears to inhibit angiogenesis in the metastases
(Holmgren et al., 1995
), there
is strong evidence that the primary tumor also secretes factors that inhibit
the proliferation of single metastatic cells
(Cameron et al., 2000
;
Guba et al., 2001
;
Luzzi et al., 1998
). Despite
the potential use of such factors to inhibit the proliferation of metastases,
these factors are also unknown.
Elucidating mechanisms such as the regulation of cell proliferation can be
greatly facilitated by using a simple model system such as Dictyostelium
discoideum (Kessin,
2001
). This eukaryote normally exists as vegetative amoebae that
eat bacteria on soil and decaying leaves. The amoebae, which are haploid,
increase in number by fission. When the amoebae are starved for bacteria, they
cease dividing and begin secreting an 80 kDa glycoprotein called conditioned
medium factor (CMF). When there is a high density of starving cells, as
indicated by a high concentration of CMF
(Jain et al., 1992
;
Yuen et al., 1995
), the cells
aggregate between 5 and 10 hours after starvation
(Aubry and Firtel, 1999
). The
aggregating cells form large streams that break up into groups of
20,000
cells (Shaffer, 1957
). Each
group develops into a fruiting body consisting of a mass of spore cells
supported on a
1 mm high column of stalk cells.
We have partially purified a secreted
450 kDa complex of proteins
called counting factor (CF) that modulates adhesion and motility during
aggregation to regulate stream breakup and thus group and fruiting body size
(Brock and Gomer, 1999
;
Gao et al., 2004
;
Jang and Gomer, 2005
;
Roisin-Bouffay et al., 2000
;
Tang et al., 2002
). The CF
preparation contains eight proteins (Brock
and Gomer, 1999
). To determine which of these are true components
of CF and which are contaminants, we have been examining whether each protein
in the preparation is part of a 450 kDa complex. In this report, we show that
a 60 kDa protein is not a component of CF but part of a
150 kDa complex,
and that this protein appears to have to have the properties of a
Dictyostelium chalone.
| Materials and methods |
|---|
|
|
|---|
Cell culture and sieving chromatography
Cell culture was carried out according to Brock et al. (Brock et al., 1999)
using the wild-type Ax2 strain. Conditioned starvation medium (CM) and
conditioned growth medium were prepared and concentrated according to Brock et
al. (Brock et al., 2002
). For
growth in submerged unshaken culture, cells were grown in type 3003 tissue
culture dishes (Falcon, Franklin Lakes, NJ). For size fractionation, 0.3 ml of
concentrated conditioned medium was loaded on a 24 ml bed volume Superose 12
10/300 GL gel filtration chromatography column (Amersham, Piscataway, NJ),
which was run at 0.3 ml/minute in PBM [20 mM KH2PO4,
0.01 mM CaCl2, 1 mM MgCl2 (pH 6.1) with KOH], collecting
fractions every minute. To assess the effect on proliferation, 5 µl of the
fractions were added to 1.25x104 wild-type cells in 500 µl
of HL5 in the well of a type 353047 24-well plate (Becton Dickinson, Franklin
Lakes, NJ), and cells were counted 24 hours later. Photography of 48 hour
aggregates was performed as described by Brock et al.
(Brock et al., 2002
). Doubling
times were calculated using DT=t ln(2)/ln(fd/sd) where DT is the doubling
time, ln is the natural logarithm, t is the time interval, fd is the final
density and sd is the starting density. Cell viability was determined by
videomicroscopy of cells (Tang et al.,
2002
).
cDNA isolation, sequencing, and generation of aprA- cells
To generate a gene disruption construct, PCR was carried out on Ax2 genomic
DNA with the primers CGATAATCATCCGCGGCTCCATTGGATGATTATGTC and
GCATGCTCTAGAGTCCAACCTCTCTATGATGCACC, yielding a 1060 bp fragment of the
5' side of aprA. This was digested with SacII and
XbaI, and ligated into the same sites in pBluescript SK+ (Stratagene,
La Jolla, CA) to generate pAprA-L. PCR was then carried out with
GCCAATGTAAGCTTGGACCACAAATGGTAGAATTAGC and
CGCATTGGGCCCCTATATTGTAATAGTGAATCAATAGAG on Ax2 genomic DNA to generate a 1123
bp fragment of the 3' side of aprA. The fragment was digested
with HindIII and ApaI, and ligated into the same sites in
pAprA-L to generate pAprA-LR. The construct pAprA-LR was digested with
XbaI and HindIII, blunt-ended, dephosphorylated, and then
the 1.4 kb SmaI cre-lox blasticidin resistance cassette from pLPBLP
(Faix et al., 2004
) was
ligated into pAprA-LR to generate pAprA-KO. This was digested with
SacII and ApaI, and the insert was purified by gel
electrophoresis and a Geneclean II kit (Qbiogene, Carlsbad, CA).
Dictyostelium Ax2 cells were transformed with the construct following
Shaulsky et al. (Shaulsky et al.,
1996
). Five clones with the same phenotype were isolated; all of
the results show data from clone DB60T3-8.
Expression of AprA in aprA- cells
Two constructs were made to express AprA. To make an expression construct
for AprA fused to a C-terminal myc tag, a PCR reaction was carried out using a
vegetative cDNA library and the primers GCGCCGGTACCATGTCAAAATTATTAATTTTATTG
and CGCTCGAGTTAAAGTTGCAGTTGAACTAGCAC to generate a fragment of the
aprA-coding region corresponding to the entire polypeptide starting
with the first methionine, with a KpnI site on one side and an
XhoI site on the other. After digestion with KpnI and
XhoI, the PCR product was ligated into the corresponding sites of
pDXA-3D (Ehrenman et al.,
2004
) to produce an overexpression construct with a C-terminal
Myc tag. Dictyostelium aprA- cells were
transformed following Manstein et al.
(Manstein et al., 1995
), and
expression of AprA was verified by staining western blots of whole cell
lysates with anti-AprA antibodies. The resulting strain was designated
aprA-/actin15::aprA-myc. Approximately 100 clones with the
same phenotype were isolated, and clone HDB60TOEmyc2 was used for this study.
The second construct was made as above with the exception that the reverse
primer was GGTCTAGATTATAAAGTTGCAGTTGAACTAGC. A TAA stop codon was incorporated
at the end of the coding region and the enzyme site was changed to
XbaI to eliminate the C-terminal Myc tag. This strain was
designated aprA-/actin15::aprA and clone HDB60TOE9S was
used. Both of the above strains synthesized and secreted AprA equally
well.
Immunoprecipitation
To immunoprecipitate AprA, 1 mg of the affinity-purified anti-AprA
antibodies was conjugated to 1 ml of cyanogen bromide-activated Sepharose 4B
(Sigma, St Louis, MO) following the manufacturer's directions. HL5 growth
medium (100 ml) conditioned by aprA- cells or
aprA-/actin15::aprA cells was concentrated as described
above to 1 ml and incubated with 300 µl of the antibody resin overnight at
4°C with gentle rotation. The beads were collected by centrifugation at
5000 g for 10 seconds and washed in 20 mM sodium phosphate (pH
6.5). The beads were washed five times by resuspension in 1 ml of the sodium
phosphate buffer followed by centrifugation and eluted with PBS-100 mM glycine
(pH 4.0). A Profound c-Myc Tag IP/Co-IP Kit (Pierce, Rockport, IL) was used to
purify AprA-myc from concentrated conditioned HL-5 following the kit protocol
for functional applications. The immunoprecipitated AprA or AprA-myc was
dialyzed in a Spectrapor 12-14 kDa cutoff membrane (Spectrum, Rancho
Dominguez, CA) against HL5 before use in proliferation assays. Protein was
quantitated by electrophoresis along with a series of BSA standards, followed
by Coomassie staining and densitometry. To determine if immunoprecipitated
AprA could rescue the phenotype of aprA- cells,
aprA- cells were inoculated at 1x105
cells/ml in HL5 containing 10 ng/ml of immunoprecipitated AprA, and then
starved on filter pads soaked with PBM containing 10 ng/ml immunoprecipitated
AprA.
Cell mass, protein content, and DAPI staining
The approximate mass per 107 cells was calculated by measuring
the mass of a pellet of 5x107 vegetative cells, the volume
was calculated by marking the pellet, removing the cells, recounting them,
filling the tube with water to that level and weighing the tube, and the
protein content of a pellet of washed cells was measured using a Biorad
(Hercules, CA) protein assay. The values were then divided by 5 to obtain
values for 107 cells. The cell volumes invariably correlated with
the cell masses, and indicated a density in the cell pellets of 1.02 g/ml for
all cell lines. To stain nuclei, logphase cells in HL5 were diluted to
2x105 cells/ml with HL5 and 200 µl was placed on a glass
coverslip. After 1 hour, the medium was removed and cells were fixed with 70%
ethanol at room temperature and air-dried. Vectashield/DAPI (25 µl)
(Vector, Burlingame, CA) was used to simultaneously stain and mount the
coverslip on a slide. For each assay, at least 200 cells were examined by
epifluorescence with a 60x 1.4 NA lens.
Spore viability
To measure the viability of spores, cells were starved on filter pads as
previously described (Brock et al.,
1996
) using 1 ml of cells at 1x107 cells/ml in
PBM. After 5 days, the filter pad was placed in a 50 ml tube and washed
repeatedly with 2 ml of PB (20 mM potassium phosphate, pH 6.2) to remove
cells. All procedures were at room temperature. 0.8% v/v Nonidet P-40
alternative (2 ml) (Calbiochem, La Jolla, CA) in PB was then added to the tube
(Good et al., 2003
). The tube
was rocked gently for 10 minutes and the filter was then removed. PB (11 ml)
was then added and the cells were collected by centrifugation at 330
g for 10 minutes. The cells were then washed twice by
centrifugation in 15 ml of PB. The cells were resuspended in 5 ml of PB and
dissociated by trituration with a syringe and an 18 gauge needle. The density
of ovoid phase-dark spores was then counted with a hemacytometer. Serial
dilutions of the spores in PB were then plated with K. aerogenes
bacteria on SM/5 plates and the number of colonies was counted 9 days
later.
| Results |
|---|
|
|
|---|
150 kDa, while
CF components elute at
450 kDa (Fig.
2). These results suggest that AprA is part of a novel factor that
is distinct from CF.
|
|
|
10-fold
more AprA- cells and one tenth the number of
aprA-/actin15::aprA cells. Between the 24 and 48 hour
timepoints, the doubling times were 4.3 hours for wild-type cells, 3.0 hours
for aprA- cells and 9.7 hours for
aprA-/actin15::aprA cells. The observed doubling times for
wild-type cells in shaking culture and on bacteria are similar to what has
been observed previously (Loomis,
1982
|
150 kDa factor that represses cell proliferation
150 kDa in the medium conditioned by
wild-type cells, and no AprA in the fractions from the
aprA- cells (data not shown). There was no obvious effect
of any of the aprA- fractions (assaying the material in
the 450 kDa to 68 kDa range) on cell proliferation, while material at 150 kDa
from the wild-type cells inhibited cell proliferation
(Fig. 8). Although cells
proliferate more slowly in stationary submerged culture than in shaking
culture, the
150 kDa material from wild-type cells slowed the
proliferation further. The inhibition of cell proliferation by the
150
kDa material from growth medium conditioned by wild-type cells, and no effect
of fractions from medium from aprA- cells, was also seen
when the fractions were added to cells in shaking culture. These data suggest
the possibility that AprA is part of a 150 kDa secreted factor that inhibits
proliferation.
|
|
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
150 kDa and AprA is 60 kDa, it is unclear if this factor is a
multimer of AprA or consists of AprA and other proteins.
At first glance, it seems odd that Dictyostelium cells would
deliberately slow their proliferation (for cells forming a specific tissue in
a higher eukaryote, however, there is a clear advantage to the whole organism
for a specific tissue to not grow beyond its appropriate size). Because we
observe AprA being produced by and then affecting cells that were cloned from
a single cell and have not yet begun to differentiate, and that all cells
contain AprA in a similar distribution and thus potentially all cells secrete
AprA, we consider AprA as having an autocrine effect. The fact that a secreted
factor is being used suggests that as the cell density and number increase,
the concomitant increase in the concentration of the proliferation-repressing
factor would slow proliferation more at high cell density than at low density.
This indicates that for Dictyostelium, there is an evolutionary
advantage to slowing proliferation when cells begin to get crowded. We have
found that when equal numbers of wild-type and aprA- cells
are starved, the aprA- cells produce fewer spores than
wild-type cells, suggesting that AprA potentiates normal development. It thus
appears that AprA represses proliferation because this confers an advantage to
the population of cells. There is an obvious evolutionary advantage to
efficient spore formation, so `cheater' mutants that do not respond to AprA
and thus proliferate faster would presumably have reduced spore formation and
thus would be at a disadvantage, as is the case with dimA-
cells, which do not respond to the DIF signal
(Foster et al., 2004
)
Comparing aprA-, wild-type and
aprA-/actin15::aprA cells, we observe that increasing
amounts of AprA correlate with a decrease in the number of cells with two
nuclei. Assuming that cells cannot significantly shorten the time it takes to
undergo cytokinesis, this might suggest that as AprA levels increase there are
fewer cells undergoing cytokinesis, which would then qualitatively correlate
with the division times of the three cell lines. Disruption of aprA
also leads to an increase in the percentage of cells with three or more
nuclei. Mutations in several genes necessary for cytokinesis in
Dictyostelium also result in multinucleate cells, although these
cells can have up to 50 nuclei per cell
(Adachi, 2001
). It is
interesting that several different human tumor types have multinucleate cells
(Jayaram and Abdul Rahman,
1997
; Long and Aisenberg,
1975
; Nonomura et al.,
1995
; Ramos et al.,
2002
). AprA thus effectively has two functions: the first to slow
the cell cycle and the second to coordinate cytokinesis with mitosis.
In addition to inhibiting cell proliferation, AprA also appears to reduce
the net mass and protein accumulation of a population of cells
(Table 2). Thus, by one
criterion AprA inhibits growth as well as proliferation. However, when we
normalized the mass and protein accumulation on a per nucleus basis, we
observed that the aprA- population accumulates mass at the
same rate as wild-type cells. Abnormally high levels of AprA, however, did
inhibit mass accumulation on a per nucleus basis. One possible explanation for
this is that there is an upper limit to the size of a cell
(Grewal and Edgar, 2003
;
Mitchison, 2003
;
Saucedo and Edgar, 2002
), so
that when the slowly proliferating aprA-/actin15::aprA
cells reach a certain size they stop accumulating mass. Also on a per nucleus
basis, abnormally high or low levels of AprA do not significantly affect the
rate of protein accumulation. With the exception of the effect of abnormally
high levels of AprA on mass accumulation, AprA does not affect growth on a per
nucleus basis. Assuming that each nucleus can drive mass and protein
accumulation at a fixed rate, this indicates that the effect of AprA on growth
can be attributed solely to its effect on cell proliferation.
For the aprA- cells, the connection between faster
proliferation during growth phase and the formation of larger structures when
the cells starve and consequently develop is unclear. However, alterations in
the metabolism of growing Dictyostelium cells affects structure size
during development; for example, increasing intracellular glucose levels
causes cells to form larger fruiting bodies
(Garrod and Ashworth, 1972
).
As aprA- cells proliferate faster than wild-type cells, a
reasonable conclusion is that the aprA- cells have a
different composition than wild-type cells; for example, we observe that
aprA- cells have less mass and protein per nucleus than
wild-type cells. Our working hypothesis is that the altered group size,
abnormal structures and reduced spore viability observed in
aprA- cells are in part a secondary consequence of the
effect of AprA on repressing the proliferation of growing cells.
We do not know the signal transduction pathway that cells use to sense
AprA. Three Dictyostelium transformants, crlA-,
yakA- and qkgA-, have phenotypes
resembling that of aprA- in that they proliferate faster
and reach a higher stationary phase density than parental cells. In addition,
crlA- and qkgA- cells, like
aprA- cells, also form abnormally large structures. CrlA
has similarity to seven-transmembrane G-protein-coupled cAMP receptors
(Raisley et al., 2004
). YakA
is a kinase, and appears to stop growth in response to stresses such as
starvation, and thus regulates the growth to development transition
(Taminato et al., 2002
). The
predicted QkgA amino acid sequence contains a predicted kinase domain
(Abe et al., 2003
). It is thus
possible that some of the associated proteins may be part of the AprA signal
transduction pathway, and that similar proteins may be components of chalone
signal transduction pathways in higher eukaryotes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abe, T., Langenick, J. and Williams, J. G.
(2003). Rapid generation of gene disruption constructs by in
vitro transposition and identification of a Dictyostelium protein
kinase that regulates its rate of growth and development. Nucl.
Acids Res. 31,107
-116.
Adachi, H. (2001). Identification of proteins
involved in cytokinesis of Dictyostelium. Cell Struct.
Funct. 26,571
-575.[Medline]
Alison, M. (1986). Regulation of hepatic
growth. Physiol Rev. 66,499
-541.
Ashworth, J. M. and Watts, D. J. (1970).
Metabolism of the cellular slime mold Dictyostelium discoideum grown
in axenic culture. Biochem. J.
119,175
-182.[Medline]
Aubry, L. and Firtel, R. A. (1999). Integration
of signaling networks that regulate Dictyostelium differentiation.
Annu. Rev. Cell Dev. Biol.
15,469
-517.[CrossRef][Medline]
Brock, D. A. and Gomer, R. H. (1999). A
cell-counting factor regulating structure size in Dictyostelium.Genes Dev. 13,1960
-1969.
Brock, D. A., Buczynski, F., Spann, T. P., Wood, S. A.,
Cardelli, J. and Gomer, R. H. (1996). A
Dictyostelium mutant with defective aggregate size determination.
Development 122,2569
-2578.[Abstract]
Brock, D. A., Hatton, R. D., Giurgiutiu, D.-V., Scott, B.,
Ammann, R. and Gomer, R. H. (2002). The different components
of a multisubunit cell number-counting factor have both unique and overlapping
functions. Development
129,3657
-3668.
Cameron, M. D., Schmidt, E. E., Kerkvliet, N., Nadkarni, K. V.,
Morris, V. L., Groom, A. C., Chambers, A. F. and MacDonald, I. C.
(2000). Temporal progression of metastasis in lung: cell
survival, dormancy, and location dependence of metastatic inefficiency.
Cancer Res. 60,2541
-2546.
Demicheli, R. (2001). Tumour dormancy: findings
and hypotheses from clinical research on breast cancer. Semin.
Cancer Biol. 11,297
-306.[CrossRef][Medline]
Dolznig, H., Grebien, F., Sauer, T., Beug, H. and Mullner,
E. (2004). Evidence for a size-sensing mechanism in animal
cells. Nat. Cell Biol.
6, 899-905.[CrossRef][Medline]
Ehrenman, K., Yang, G., Hong, W.-P., Gao, T., Jang, W., Brock,
D. A., Hatton, R. D., Shoemaker, J. D. and Gomer, R. H.
(2004). Disruption of aldehyde reductase increases group size in
Dictyostelium. J. Biol. Chem.
279,837
-847.
Faix, J., Kreppel, L., Shaulsky, G., Schleicher, M. and Kimmel,
A. R. (2004). A rapid and efficient method to generate
multiple gene disruptions in Dictyostelium using a single selectable
marker and the Cre-loxP system. Nucl. Acids Res.
32, e143.
Foster, K., Shaulsky, G., Strassmann, J., Queller, D. and
Thompson, C. (2004). Pleiotropy as a mechanism to stabilize
cooperation. Nature 431,693
-696.[CrossRef][Medline]
Gamer, L., Nove, J. and Rosen, V. (2003).
Return of the Chalones. Dev. Cell
4, 143-151.[CrossRef][Medline]
Gao, T., Knecht, D., Tang, L., Hatton, R. D. and Gomer, R.
(2004). A cell number counting factor regulates Akt/Protein
Kinase B to regulate group size in Dictyostelium discoideum group
size. Eukaryot. Cell 3,1176
-1184.
Garrod, D. R. and Ashworth, J. M. (1972).
Effect of growth conditions on development of the cellular slime mould
Dictyostelium discoideum. J. Embryol. Exp. Morph.
28,463
-479.[Medline]
Gomer, R. H. (1987). A strategy to study
development and pattern formation: use of antibodies against products of
cloned genes. Methods Cell Biol.
28,471
-487.[Medline]
Gomer, R. H. (2001). Not being the wrong size.
Nat. Rev. Mol. Cell Biol.
2, 48-54.[CrossRef][Medline]
Good, J. R., Cabral, M., Sharma, S., Yang, J., Van Driessche,
N., Shaw, C. A., Shaulsky, G. and Kuspa, A. (2003). TagA, a
putative serine protease/ABC transporter of Dictyostelium that is required for
cell fate determination at the onset of development.
Development 130,2953
-2965.
Grewal, S. and Edgar, B. (2003). Controlling
cell division in yeast and animals: does size matter? J.
Biol. 2,5
.[CrossRef][Medline]
Guba, M., Cernaianu, G., Koehl, G., Geissler, E. K., Jauch,
K.-W., Anthuber, M., Falk, W. and Steinbauer, M. (2001). A
primary tumor promotes dormancy of solitary tumor cells before inhibiting
angiogenesis. Cancer Res.
61,5575
-5579.
Holmgren, L., O'Reilly, M. S. and Folkman, J.
(1995). Dormancy of micrometastases: balanced proliferation and
apoptosis in the presence of angiogenesis suppression. Nat.
Med. 1,149
-153.[CrossRef][Medline]
Jain, R., Yuen, I. S., Taphouse, C. R. and Gomer, R. H.
(1992). A density-sensing factor controls development in
Dictyostelium. Genes Dev.
6, 390-400.
Jang, W. and Gomer, R. H. (2005). Exposure of
cells to a cell-number counting factor decreases the activity of
glucose-6-phosphatase to decrease intracellular glucose levels in
Dictyostelium. Eukaryot. Cell
4, 991-998.
Jayaram, G. and Abdul Rahman, N. (1997).
Cytology of Ki-1-positive anaplastic large cell lymphoma. A report of two
cases. Acta Cytol. 41,1253
-1260.[Medline]
Jorgensen, P. and Tyers, M. (2004). How cells
coordinate growth and division. Curr. Biol.
14,R1014
-R1027.[CrossRef][Medline]
Kessin, R. H. (2001).
Dictyostelium-Evolution, Cell Biology, And The Development Of
Multicellularity. Cambridge, UK: Cambridge University
Press.
Lee, S. and McPherron, A. (1999). Myostatin and
the control of skeletal muscle mass. Curr. Opin. Genet.
Dev. 9,604
-607.[CrossRef][Medline]
Long, J. and Aisenberg, A. (1975). Richter's
syndrome. A terminal complication of chronic lymphocytic leukemia with
distinct clinicopathologic features. Am. J. Clin.
Pathol. 63,786
-795.[Medline]
Loomis, W. F. (1982). The
Development of Dictyostelium discoideum. New York: Academic
Press.
Luzzi, K. J., MacDonald, I. C., Schmidt, E. E., Kerkvliet, N.,
Morris, V. L., Chambers, A. F. and Groom, A. C. (1998).
Multistep nature of metastatic inefficiency: dormancy of solitary cells after
successful extravasation and limited survival of early micrometastases.
Am. J. Pathol. 153,865
-873.
Manstein, D., Schuster, H., Morandini, P. and Hunt, D.
(1995). Cloning vectors for the production of proteins in
Dictyostelium discoideum. Gene
162,129
-134.[CrossRef][Medline]
McPherron, A. and Lee, S. (1997). Double
muscling in cattle due to mutations in the myostatin gene. Proc.
Natl. Acad. Sci. USA 94,12457
-12461.
McPherron, A. C., Lawler, A. M. and Lee, S.-J.
(1997). Regulation of skeletal muscle mass in mice by a new
TGF-beta superfamily member. Nature
387, 8390.
Metcalf, D. (1964). Restricted growth capacity
of multiple spleen grafts. Transplantation
2, 387-392.
Mitchison, J. (2003). Growth during the cell
cycle. Int. Rev. Cytol.
226,165
-258.[Medline]
Nonomura, A., Mizukami, Y., Shimizu, J., Watanabe, Y.,
Kobayashi, T., Kamimura, R., Takashima, T., Nakamura, S. and Tanimoto, K.
(1995). Small giant cell carcinoma of the lung diagnosed
preoperatively by transthoracic aspiration cytology. A case report.
Acta Cytol. 39,129
-133.[Medline]
Raisley, B., Zhang, M., Hereld, D. and Hadwiger, J.
(2004). A cAMP receptor-like G protein-coupled receptor with
roles in growth regulation and development. Dev. Biol.
265,433
-445.[CrossRef][Medline]
Ramos, D., Monteagudo, C., Carda, C., Ramon, D.,
Gonzalez-Devesa, M. and Llombart-Bosch, A. (2002).
Ultrastructural and immunohistochemical characterization of the so-called
giant multinucleate cells in cutaneous collagenomas.
Histopathology 41,134
-143.[Medline]
Roisin-Bouffay, C., Jang, W. and Gomer, R. H.
(2000). A precise group size in Dictyostelium is
generated by a cell-counting factor modulating cell-cell adhesion.
Mol. Cell 6,953
-959.[Medline]
Saucedo, L. and Edgar, B. (2002). Why size
matters: altering cell size. Curr. Opin. Genet. Dev.
12,565
-571.[CrossRef][Medline]
Shaffer, B. M. (1957). Variability of behavior
of aggregating cellular slime moulds. Quart. J. Micr.
Sci. 98,393
-405.
Shaulsky, G., Escalante, R. and Loomis, W. F.
(1996). Developmental signal transduction pathways uncovered by
genetic suppressors. Proc. Natl. Acad. Sci. USA
93,15260
-15265.
Taminato, A., Bagattini, R., Gorjao, R., Chen, G. K., Kuspa, A.
and Souza, G. M. (2002). Role for YakA, cAMP, and protein
kinase A in regulation of stress responses of Dictyostelium
discoideum cells. Mol. Biol. Cell
13,2266
-2275.
Tang, L., Gao, T., McCollum, C., Jang, W., Vickers, M. G.,
Ammann, R. and Gomer, R. H. (2002). A cell number-counting
factor regulates the cytoskeleton and cell motility in Dictyostelium.Proc. Natl. Acad. Sci. USA
99,1371
-1376.
Thomas, M., Langley, B., Berry, C., Sharma, M., Kirk, S., Bass,
J. and Kambadur, R. (2000). Myostatin, a negative regulator
of muscle growth, functions by inhibiting myoblast proliferation.
J. Biol. Chem. 275,40235
-40234.
Yuen, I. S., Jain, R., Bishop, J. D., Lindsey, D. F., Deery, W.
J., Van Haastert, P. J. M. and Gomer, R. H. (1995). A
density-sensing factor regulates signal transduction in Dictyostelium.J. Cell Biol. 129,1251
-1262.
Related articles in Development:
This article has been cited by other articles:
![]() |
S. Cornillon, R. Froquet, and P. Cosson Involvement of Sib Proteins in the Regulation of Cellular Adhesion in Dictyostelium discoideum Eukaryot. Cell, September 1, 2008; 7(9): 1600 - 1605. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bakthavatsalam, D. A. Brock, N. N. Nikravan, K. D. Houston, R. D. Hatton, and R. H. Gomer The secreted Dictyostelium protein CfaD is a chalone J. Cell Sci., August 1, 2008; 121(15): 2473 - 2480. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Calvo-Garrido, S. Carilla-Latorre, F. Lazaro-Dieguez, G. Egea, and R. Escalante Vacuole Membrane Protein 1 Is an Endoplasmic Reticulum Protein Required for Organelle Biogenesis, Protein Secretion, and Development Mol. Biol. Cell, August 1, 2008; 19(8): 3442 - 3453. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Brock, W. N. van Egmond, Y. Shamoo, R. D. Hatton, and R. H. Gomer A 60-Kilodalton Protein Component of the Counting Factor Complex Regulates Group Size in Dictyostelium discoideum. Eukaryot. Cell, September 1, 2006; 5(9): 1532 - 1538. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||