|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online September 28, 2005
doi: 10.1242/10.1242/dev.02043
1 Department of Developmental Biology (VIB-07), Flanders Interuniversity
Institute for Biotechnology (VIB), and Laboratory of Molecular Biology
(Celgen), University of Leuven, B-3000 Leuven, Belgium
2 Wellcome Trust/Cancer Research UK Gurdon Institute and Department of Zoology,
University of Cambridge, Tennis Court Road, Cambridge CB2 1QN, UK
* Authors for correspondence (e-mail: jim{at}gurdon.cam.ac.uk and danny.huylebroeck{at}med.kuleuven.be)
Accepted 10 August 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Smicl, Xenopus, Chordin, Smad, Nodal, Spemann's organiser
| Introduction |
|---|
|
|
|---|
The Nieuwkoop centre induces the formation of Spemann's organiser in
overlying equatorial cells and, through the action of Nodal-related proteins
such as Xnr1, Xnr2, Xnr4, Xnr5 and Xnr6, activates the expression of genes
such as Noggin and Chordin, which encode secreted inhibitors
of BMP signalling (Agius et al.,
2000
; De Robertis and Kuroda,
2004
). The mechanism by which the Nodal-related proteins induce
these genes is poorly understood, although it is known that Chordin
is an indirect target of the Nodal-related proteins and of Activin, because
its activation is inhibited by the protein synthesis inhibitor cycloheximide
(Howell and Hill, 1997
;
Sasai et al., 1994
).
In this paper, we provide new insight into the regulation of
Chordin through our analysis of the novel Smad-interacting protein
Smicl (Collart et al., 2005
).
Receptors of TGFß family members such as the Nodal-related proteins and
Activin signal by phosphorylating, and thereby activating Smad2 and Smad3
(Miyazawa et al., 2002
). Once
activated, these Smad proteins bind Smad4 and translocate to the nucleus where
they regulate gene expression. This is achieved through direct interaction
with DNA or by interaction with other transcriptional regulators such as Fast1
(Massague and Wotton, 2000
).
We show here that Smicl is expressed maternally in the
Xenopus embryo and is required for the expression of
Chordin, but not of Goosecoid or Xnr3, in Spemann's
organiser. Significantly, the phenotype of embryos lacking Smicl resembles
that of embryos in which Chordin is depleted. Smicl interacts specifically
with Smad3 and is involved in the second step of an indirect pathway through
which the Nodal-related proteins activate Chordin. In the first step,
Smad3 activates the expression of Xlim. In the second a complex
containing Smicl, Smad3 and the newly induced Xlim1 activates expression of
Chordin in a direct manner. Our work defines the role of Smicl in the
early Xenopus embryo and contributes new findings to the hitherto
poorly understood regulation of Chordin.
| Materials and methods |
|---|
|
|
|---|
Western blotting
The efficacy of antisense morpholino oligonucleotide XtMO1, directed
against Xenopus tropicalis Smicl, was tested by injecting embryos
with XtMO1 or the control oligonucleotide coMO followed by RNA encoding an
HA-tagged form of XtSmicl. Embryos were allowed to develop to early gastrula
stage 10 and were then subjected to SDS polyacrylamide gel electrophoresis and
western blotting, using rat monoclonal anti-HA antibody 3F10 (Roche
Diagnostics) to detect the HA epitope and a mouse monoclonal anti-GAPDH
antibody (HyTest Ltd) as a loading control.
Whole-mount in situ hybridisation
In situ hybridisation was carried out essentially as described previously
(Harland, 1991
), except that
BMP purple was used as a substrate. A Chordin probe was as described
(Sasai et al., 1994
) and
expression of XtSmicl was detected by transcription of a
Smicl cDNA in the vector pCS107 derived from the Xenopus
tropicalis EST database
(http://www.sanger.ac.uk/Projects/X_tropicalis/;
GenBank Accession Number AL675957). The plasmid was linearised with
EcoRI and transcribed with T3 RNA polymerase.
Real time RT-PCR
Total RNA was prepared from five pooled X. laevis embryos, 30
X. tropicalis embryos or 10 X. laevis animal caps using the
TriPure reagent (Roche), followed by DNAseI digestion, proteinase K treatment,
phenol/chloroform extraction and ethanol precipitation. RNA was dissolved in
water and used as a template for real-time RT-PCR.
Real-time RT-PCR with the LightCycler (Roche) was carried out using the
manufacturer's RNA amplification kit. All determinations included a negative
control and a serial dilution of embryo RNA was used to create a standard
curve. Primers specific for Xbra, Goosecoid, Chordin and
Ornithine decarboxylase (ODC) were as described previously
(Piepenburg et al., 2004
),
Sox17 and Xlim1 were as described previously
(Xanthos et al., 2001
),
Xnr3 was as described previously
(Kofron et al., 1999
) and
Siamois was as described previously
(Heasman et al., 2000
).
XtSmicl primers were 5'-AGCGCAGTCTGGCCATCATC-3' and
5'-TCGGGAGACATAGACGTGGC-3'. All values were normalised to the
level of ODC in each sample.
Expression constructs and transcription
A mouse Smicl cDNA comprising the entire open reading frame except for the
first six amino acids was cloned between the EcoRI and XbaI
sites of pCS3, thereby introducing six N-terminal Myc tags. The construct was
linearised with Asp718 and sense RNA was transcribed with SP6 RNA
polymerase. An X. tropicalis cDNA comprising the entire XtSmicl open
reading frame and 45 bp of 5' UTR (GenBank Accession Number AY887083)
was provided with a C-terminal HA tag by PCR and cloned between the
EcoRI and XbaI sites of pCS2. Sense RNA was produced using
SP6 RNA polymerase after linearisation of the plasmid with Asp718. A
Myc-tagged Smad2 construct, cloned in pFTX5
(Howell and Hill, 1997
), was
linearised with XbaI and sense RNA was transcribed with T7 RNA
polymerase. The open reading frame of Chordin, cloned in pSP35T (the
gift of E. De Robertis), was linearised with XbaI and transcribed
with SP6 polymerase. The open reading frame of Xnr1 cloned in pCS2
(Williams et al., 2004
) was
linearised with Asp718, and sense RNA was transcribed with SP6 RNA
polymerase. A Smad3 construct in pCS2 was linearised with Asp718, and
sense RNA was transcribed with SP6 RNA polymerase. Flag-Xlim1/3m, cloned in
pCS2 (Yamamoto et al., 2003
),
was linearised with NotI and sense RNA was transcribed with SP6 RNA
polymerase. A cDNA encoding Siamois, cloned in pBluescript RN3
(Lemaire et al., 1995
), was
linearised with SfiI and sense RNA was transcribed with T3 RNA
polymerase. A constitutively active ß-catenin construct cloned in pSP64T
(Domingos et al., 2001
), was
linearised with SfiI and sense RNA was synthesised using SP6 RNA
polymerase. Myc-tagged Smad constructs were a gift from Dr K. Miyazono.
Constitutively active forms of ALK6 and ALK4 were as described
(Armes and Smith, 1997
).
Cell lines and transfections
HEK293T cells were grown in Dulbecco's modified Eagle's medium containing
10% foetal bovine serum (FBS) supplemented with 4.5 g/l glucose. Cells were
grown to 50% confluence in 9 cm dishes and transfected using Fugene (Roche
Molecular Biochemicals) according to the manufacturer's protocol.
Co-immunoprecipitation experiments
Transiently transfected HEK293T cells were frozen in liquid nitrogen,
thawed on ice and solubilised in lysis buffer containing 1% NP40, 150 mM NaCl,
20 mM Tris pH 7.5, 2 mM EDTA, 50 mM NaF, 1 mM sodium pyrophosphate,
supplemented with protease inhibitors (Roche Molecular Biochemicals). Cell
lysates were cleared by centrifugation, and precipitations were performed by
overnight incubations with beads coupled to mouse monoclonal anti HA (Roche),
mouse monoclonal M2Flag or mouse monoclonal 9E10 anti Myc (Santa Cruz).
Unbound proteins were removed by washing four times with lysis buffer and once
with phosphate-buffered saline at 4°C. Bound proteins were harvested by
boiling in sample buffer, and they were resolved by SDS-polyacrylamide gel
electrophoresis. Myc-tagged, Flag-tagged, HA-tagged proteins and endogenous
Smad3 were visualised after western blotting using mouse monoclonal 9E10
anti-Myc (a gift from Innogenetics), anti-M2Flag (Santa Cruz), anti-HA (Roche)
and rabbit polyclonal anti-Smad3 (Abcam) antibodies, in combination with
horseradish peroxidase-conjugated anti-mouse and anti-rabbit secondary
antibodies (Jackson), and the enhanced chemiluminescence kit (New England
Nuclear).
Biotinylated oligonucleotide precipitation assay
DNA precipitations using biotinylated double-stranded oligonucleotides
corresponding to base pairs -696 to -621 relative to the translation start
site of X. tropicalis Chordin
(http://genome.jgi-psf.org/Xentr3/Xentr3.home.html)
were carried out as described (Hata et
al., 2000
). The sequence of the wild-type oligonucleotide was
5'
CCATACTGATTATTCCCCAAATCTTGTCAAATTCTATGTAGCTTTCCCACATGCAATTATCTGCATGTCCCCCACT
3'. The sequence of a mutated oligonucleotide was 5'
CCATACCTTTTATTCCCCAAATCTTGTCAAATTCTATGTAGCTTTCCCACATGACCAAGTCTGCATGTCCCCCACT
3'. Wild type and mutated Xlim1 binding sites
(Mochizuki et al., 2000
) are
indicated in italics. DNA-bound proteins were collected with
streptavidine-agarose beads (Sigma) and analyzed by western blotting.
| Results |
|---|
|
|
|---|
We first carried out co-immunoprecipitation experiments in HEK293T cells to determine whether XtSmicl, like mouse Smicl, is a Smad-interacting protein. XtSmicl was co-expressed with Smad1 or Smad5 (which act downstream of BMP family members), Smad2 or Smad3 (which act downstream of TGFß, Activin and Nodal family members), or the common mediator Smad4, in the presence or absence of their cognate constitutively active (ca) receptors. Smad proteins were immunoprecipitated from cell extracts with anti-Myc antibody and the presence of HA-tagged XtSmicl in the immunoprecipitate was detected by western blotting. XtSmicl proved to interact weakly with Smad2 (Fig. 1B, lanes 3 and 4, either co-transfected with caALK4 or not) and strongly with Smad3 and Smad4 when co-transfected with a constitutively active ALK4 receptor (Fig. 1B, lanes 6 and 11). A strong interaction between overexpressed HA-XtSmicl and endogenous Smad3 in presence of caALK4 could be detected after immunoprecipitation of HA-XtSmicl with anti-HA antibody and analysis of the immunoprecipitate after western blotting with anti-Smad3 antibody (Fig. 1C, lane 2).
|
|
Injection of the three Smicl antisense morpholino oligonucleotides causes similar phenotypes in X. tropicalis and X. laevis. The first observed effect is a delay in the onset of gastrulation (Fig. 2C, parts b,d) and by neurula stages this delay manifests itself as a failure of the blastopore to close (Fig. 2C, parts f,h). At tadpole stages dorsoanterior structures are reduced and ventroposterior structures somewhat expanded; the anteroposterior axis is shortened; and embryos are microcephalic (Fig. 2C, parts j,l). Injection of coMO causes no detectable defects in development.
We note that injection of XtMO1, but not of coMO, causes the upregulation of Smicl mRNA at stage 10.5 (Fig. 2E). This elevated transcription may reflect an attempt by the embryo to regulate levels of Smicl protein following inhibition of translation by the antisense morpholino oligonucleotide, or it may be due to stabilisation of the RNA.
The observation that three different morpholino oligonucleotides yield similar phenotypes in two species of Xenopus argues that the effects of these reagents are specific. To confirm this impression, we carried out rescue experiments in Xenopus laevis using a mouse Smicl construct that lacks the first six amino acids and contains a Myc tag (see Materials and methods), so that its translation is not inhibited by the antisense oligonucleotide. This mRNA caused significant rescue of the phenotype caused by XlMO (Fig. 2D, part d), and indeed XlMO was able to rescue the spina bifida phenotype that is caused by mis-expression of the mouse Smicl construct (Fig. 2D, part c). Together, these experiments indicate that our Smicl antisense morpholino oligonucleotides function in a specific manner and that the mouse and Xenopus proteins are functional homologues.
Smicl is required for normal expression of Chordin mRNA
One way in which inhibition of Smicl function might disrupt gastrulation is
by interfering with gene expression in the organiser, and indeed the Smicl
phenotype resembles quite closely that of the organiser-specific gene
Chordin, obtained by targeting both Xenopus laevis Chordin
pseudo-alleles with antisense morpholino oligonucleotides
(Oelgeschlager et al., 2003
).
To address this point, we studied expression levels of the pan mesodermal
marker Xbra (Fig. 3A),
the endodermal marker Sox17 (Fig.
3B) and the organiser-specific genes Xnr3
(Fig. 3C), Goosecoid
(Fig. 3D) and Chordin
(Fig. 3E-G). The only one of
these genes to be affected by inhibition of Smicl function, in X.
laevis and in X. tropicalis, was Chordin. This was
confirmed by in situ hybridisation, which showed that inhibition of Smicl
function both reduces the expression level of Chordin and decreases
the size of its expression domain (Fig.
3H), while the expression pattern of the other organiser markers,
also analyzed by in situ hybridisation, is normal (data not shown). As an
additional control, we observed that the X. tropicalis
oligonucleotide XtMO1, which differs by ten bases from XlMO, did not decrease
expression of Chordin in X. laevis (data not shown), and the
downregulation of Chordin caused by XlMO was rescued by co-injection
of mRNA encoding mouse Smicl (Fig.
3H).
To ask whether the Smicl loss-of-function phenotype is caused in part by the downregulation of Chordin, we attempted to rescue the effects of the Xenopus laevis Smicl antisense oligonucleotide by co-injection of RNA encoding Chordin. This mRNA brought about partial rescue of the anterior structures of the embryos (Fig. 3J, part d), which are significantly reduced in embryos injected with XlMO (Fig. 3J, part c).
Together, these experiments indicate that Smicl is required for expression of Chordin in the Xenopus organiser, and that the phenotype caused by loss of Smicl function is due in part to the downregulation of Chordin. We therefore went on to investigate the role of this Smad-interacting protein in the regulation of Chordin in more detail.
Smicl is not involved in ß-catenin-mediated induction of Chordin via Siamois
Previous work indicates that the expression of Chordin in the
organiser of Xenopus is initiated by ß-catenin signalling and
that its maintenance depends on high levels of Nodal related proteins such as
Xnr1 derived from the Nieuwkoop centre
(Wessely et al., 2001
).
Consistent with this idea, activation of Chordin in isolated animal
pole regions by members of the TGFß family is inhibited by cycloheximide
(Howell and Hill, 1997
;
Sasai et al., 1994
),
suggesting that induction requires the synthesis of intermediate proteins and
is therefore indirect.
To investigate the activation of Chordin in more detail, we first asked whether its activation by ß-catenin is direct or indirect. RNA encoding Xnr1 or ß-catenin was injected into Xenopus embryos at the one-cell stage, and animal pole regions were dissected before the mid-blastula transition (that is, before the onset of zygotic transcription) and incubated in the presence or absence of cycloheximide until the equivalent of the early gastrula stage. Xnr1 and ß-catenin both activate expression of Chordin in animal caps, but induction by ß-catenin, like induction by Xnr1, is inhibited by cycloheximide and is therefore indirect (Fig. 4A,B).
It is possible that the indirect induction of Chordin by
ß-catenin occurs through Siamois
(Lemaire et al., 1995
), a
transcription factor that is expressed in the organiser in response to
ß-catenin and that can activate transcription of Chordin
(Wessely et al., 2004
).
Further experiments demonstrated that Siamois activates Chordin in a
direct manner (Fig. 5A). To
examine the possibility that Smicl is involved in this process, we asked
whether Smicl antisense morpholino oligonucleotides prevent induction of
Chordin by Siamois in animal caps. This proved not to be the case
(Fig. 5C). Moreover, inhibition
of Smicl function does not inhibit Siamois expression in intact
embryos (Fig. 5B). We conclude
that Smicl is not involved in the induction of Chordin through the
ß-catenin/Siamois pathway, although we cannot exclude the possibility
that ß-catenin induces Chordin via other genes.
Smicl is involved in the induction of Chordin through the Smad pathway
The inductive effects of Nodal-related signalling are mediated by Smad2 and
Smad3, which, on receptor activation, associate with a co-Smad and accumulate
in the nucleus where they are recruited to particular promoters by specific
transcription factors (Hill,
2001
). Preliminary experiments revealed that both Smad2 and Smad3
are able to induce expression of Chordin in isolated Xenopus
laevis animal caps (Fig.
6A). Smad3 proved to be a more powerful inducer of Chordin than
did Smad2, and further experiments using Smad3 revealed that induction of
Chordin by both Xnr1 and by Smad3 requires Smicl
(Fig. 6B).
To ask whether a Smicl/Smad3 complex might activate Chordin directly, animal pole regions were dissected from embryos expressing exogenous Smad3 and in which endogenous Smicl is also present. The animal caps were incubated in the presence or absence of cycloheximide, and assayed for expression of Chordin at the early gastrula stage. Cycloheximide proved to inhibit activation of Chordin (Fig. 6A), indicating that Smad3 acts indirectly, presumably through the induction of another gene `X'. This gene is unlikely to be Smicl, because neither Xnr1 nor Smad3 increases expression of Smicl in animal caps or in intact embryos (data not shown).
|
To investigate whether Xlim1 is involved in the Xnr1/Smad3 signalling cascade that leads to induction of Chordin, we first tested the abilities of Smad2 and Smad3 to activate Xlim1 in isolated animal pole regions. Smad3 proved to induce strong expression of Xlim1 in a direct manner; induction by Smad2 was weaker and indirect (Fig. 7A).
We next asked whether Xlim1, as would be expected of factor X, can induce
expression of Chordin in isolated animal pole regions. These
experiments made use of Xlim1/3m, a constitutively active variant of Xlim1 in
which two inhibitory Lim domains are inactivated
(Taira et al., 1994
). As
previously reported (Taira et al.,
1994
), expression of Xlim1/3m does activate Chordin in
isolated animal pole regions, and this induction proved to be direct
(Fig. 7B). Depletion of
Xlim in Xenopus embryos does not cause downregulation of
Chordin or other organiser-specific genes at very early gastrula
stages, but it remains possible that Xlim1 plays a role in the
maintenance of their expression (Hukriede
et al., 2003
).
Together, these experiments indicate that Xlim1 can be induced directly by Smad3 and that Xlim1 in turn can activate Chordin in a direct fashion. Smicl is not involved in the first of these steps, because inhibition of Smicl function by injection of XlMO does not affect expression levels of Xlim1 in Xenopus laevis (Fig. 7C). However, use of the same antisense morpholino oligonucleotide shows that Smicl is required for activation of Chordin by Xlim1/3m (Fig. 7D). Together, these experiments indicate that the factor X that is required downstream of Xnr1 and Smad3 is Xlim1, and that induction of Chordin by Xlim1 requires the Smad-interacting protein Smicl.
Xlim1 is present in a complex with Smad3 and Smicl
The requirement for Smicl in the induction of Chordin by Xlim1
suggests that the two proteins might physically interact. This possibility was
tested by co-immunoprecipitation experiments showing that XtSmicl associates
with Xlim1/3m following expression of the two proteins in HEK293T cells
(Fig. 7E, lane 5). Xlim1 does
not interact directly with Smad3 (Fig.
7E, lane 4), but the Smad-interacting protein Smicl can recruit
Smad3 to create a complex containing these two proteins and Xlim1
(Fig. 7E, lane 1).
|
|
| Discussion |
|---|
|
|
|---|
Our results are of interest for three reasons. First, they define the
function of a novel Xenopus Smad-interacting protein, and in doing so
they reveal a surprising degree of specificity in this protein; although we
have not examined a large panel of markers, inhibition of Smicl function does
not downregulate all genes expressed in the organiser, just Chordin.
In this regard, we note that expression of Chordin in the embryo is
not completely inhibited by antisense morpholino oligonucleotides directed
against Smicl. There are four possible explanations for this observation.
First, the concentration of the Smicl antisense oligonucleotides used in these
experiments may be too low to elicit the most extreme phenotype. Second,
maternal protein may persist long enough to provide some `rescue' of the
effects of inhibiting de novo translation. Third, Smicl antisense morpholino
oligonucleotides may not inhibit the initial activation of Chordin
expression, but may prevent its maintenance. And finally, other signalling
pathways may be involved in Chordin regulation, although it is not
clear, at present, whether FGF signalling plays a role
(Delaune et al., 2005
;
Mitchell and Sheets,
2001
).
A second point of interest concerns the regulation of Chordin,
which has long been recognised as an indirect target of TGFß signalling,
to the extent that it is sometimes used as a control for the efficacy of
cycloheximide treatment (Howell and Hill,
1997
). Our work defines the steps involved in this indirect
activation. And finally, our results are of note because they define
differential activities for Smad2 and Smad3 in the early Xenopus
embryo. This point and the other issues mentioned above are discussed
below.
|
To investigate the role of Smicl during early Xenopus development,
we injected specific antisense morpholino oligonucleotides into embryos of
Xenopus laevis and Xenopus tropicalis. Such embryos develop
with small heads, reduced dorsal tissues, increased ventral and posterior
structures, and shortened trunks. Interestingly, this phenotype resembles that
of Xenopus and zebrafish embryos in which Chordin function is
inhibited or absent (Leung et al.,
2005
; Oelgeschlager et al.,
2003
; Schulte-Merker et al.,
1997
), and indeed of the genes we investigated only
Chordin proved to be affected by the inhibition of Smicl function
(Fig. 3). Consistent with this
observation, the phenotype of embryos lacking Smicl can be rescued quite
significantly by injection of RNA encoding Chordin
(Fig. 3J), although the fact
that rescue is not complete suggests that there are other Smicl target genes
yet to be identified. Some such genes have been identified in a preliminary
microarray analysis, but none of these has yet proved to be organiser-specific
(C.C., J. Ramis and J.C.S., unpublished).
The phenotype of embryos lacking Smicl function differs from that of
zebrafish embryos lacking no arches, the zebrafish homologue of CPSF30
(Gaiano et al., 1996
). Such
embryos, as their name implies, lack pharyngeal arches and eyes. Preliminary
experiments using an antisense morpholino directed against Xenopus
tropicalis CPSF30 reveal a more severe phenotype in which epidermal cells
no longer adhere to the underlying mesodermal tissue (A.R., C.C. and J.C.S.,
unpublished). We do not yet know why the two phenotypes should differ; perhaps
there is another CPSF30 in the zebrafish genome.
Regulation of Chordin
Chordin is expressed in the organiser of the Xenopus
embryo. It encodes a secreted factor that binds to, and inhibits the function
of, BMP family members such as BMP4, and thereby functions as an important
mediator of the inducing and patterning activities of the organiser
(Sasai et al., 1995
;
Sasai et al., 1994
). Previous
work has demonstrated that Chordin is an indirect target of TGFß
signalling and more recent experiments suggest that its expression is
initiated by ß-catenin-mediated transcriptional activation via Siamois
and maintained by Nodal-related signalling pathways
(Wessely et al., 2001
).
|
|
The activity of Xlim1 is regulated by Ldb1
(Breen et al., 1998
;
Jurata et al., 1998
), which is
believed to counteract the effects of an inhibitory protein and thereby cause
Xlim1 to shift to an activated state in which it can bind cell specific
transcriptional co-activators (Hiratani et
al., 2001
). Our data suggest that Smicl is such a co-activator.
Indeed, the ability of Xnr1 to induce expression of Goosecoid in
Xenopus animal caps is abolished by inhibition of Smicl function
(data not shown), although the fact that loss of Smicl activity does not
inhibit expression of Goosecoid in the dorsal mesoderm of intact
embryos (Fig. 3C) suggests that
another factor can substitute for Smicl in this region of the embryo.
Differential activities of Smad2 and Smad3
Our observations suggest that the closely related proteins Smad2 and Smad3
play different roles in the early Xenopus embryo and that these roles
differ not only because Smad2 is expressed at much higher levels than Smad3
(Howell et al., 2001
). In
particular, we note that Smad3 activates expression of Xlim1 directly, while
Smad2 induces Xlim1 in an indirect fashion, in the sense that activation is
inhibited by cycloheximide. Previous work has demonstrated that induction of
Xlim1 by Activin and Nodal-related signalling requires the
Smad-interacting protein Fast1. This transcription factor, together with
receptor activated Smad proteins, acts as a direct transcriptional inducer of
Xlim1 through a cluster of Fast1/Smad4 sites located in the first
intron of the gene (Watanabe et al.,
2002
). Fast1 contains two Smad-binding domains, the Smad
interaction motif (SIM) and the Fast/FoxH1 motif (FM)
(Randall et al., 2004
). While
the SIM can bind both Smad2 and Smad3, the FM binding site is highly specific
for Smad2. This observation, together with our own data, suggests that the
Smad interaction motif of Fast1 but not the Fast/FoxH1 motif is required for
direct transcriptional activation of Xlim1. The existence of these
distinct Smad-binding motifs in Fast1 might provide the molecular basis for
the differential activities of Smad2 and Smad3 in the induction of
Xlim1 transcription.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Agius, E., Oelgeschlager, M., Wessely, O., Kemp, C. and De Robertis, E. M. (2000). Endodermal Nodal-related signals and mesoderm induction in Xenopus. Development 127,1173 -1183.[Abstract]
Armes, N. A. and Smith, J. C. (1997). The ALK-2 and ALK-4 activin receptors transduce distinct mesoderm-inducing signals during early Xenopus development but do not co-operate to establish thresholds. Development 124,3797 -3804.[Abstract]
Breen, J. J., Agulnick, A. D., Westphal, H. and Dawid, I. B.
(1998). Interactions between LIM domains and the LIM
domain-binding protein Ldb1. J. Biol. Chem.
273,4712
-4717.
Chan, A. P. and Etkin, L. D. (2001). Patterning and lineage specification in the amphibian embryo. Curr. Top. Dev. Biol. 51,1 -67.[Medline]
Collart, C., Remacle, J. E., Barabino, S., van Grunsven, L.,
Nelles, L., Schellens, A., Van de Putte, T., Pype, S., Huylebroeck, D. and
Verschueren, K. (2005). Smicl is a novel Smad interacting
protein and Cleavage and Polyadenylation Specificity Factor associated
protein. Genes Cells 10,897
-906.
De Robertis, E. M. and Kuroda, H. (2004). Dorsal-ventral patterning and neural induction in Xenopus embryos. Annu. Rev. Cell Dev. Biol. 20,285 -308.[CrossRef][Medline]
Delaune, E., Lemaire, P. and Kodjabachian, L.
(2005). Neural induction in Xenopus requires early FGF signalling
in addition to BMP inhibition. Development
132,299
-310.
Domingos, P. M., Itasaki, N., Jones, C. M., Mercurio, S., Sargent, M. G., Smith, J. C. and Krumlauf, R. (2001). The Wnt/beta-catenin pathway posteriorizes neural tissue in Xenopus by an indirect mechanism requiring FGF signalling. Dev. Biol. 239,148 -160.[CrossRef][Medline]
Gaiano, N., Amsterdam, A., Kawakami, K., Allende, M., Becker, T. and Hopkins, N. (1996). Insertional mutagenesis and rapid cloning of essential genes in zebrafish. Nature 383,829 -832.[CrossRef][Medline]
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685 -695.[Medline]
Hata, A., Seoane, J., Lagna, G., Montalvo, E., Hemmati-Brivanlou, A. and Massague, J. (2000). OAZ uses distinct DNA- and protein-binding zinc fingers in separate BMP-Smad and Olf signaling pathways. Cell 100,229 -240.[CrossRef][Medline]
Heasman, J. (1997). Patterning the Xenopus blastula. Development 124,4179 -4191.[Abstract]
Heasman, J., Kofron, M. and Wylie, C. (2000). Beta-catenin signaling activity dissected in the early Xenopus embryo: a novel antisense approach. Dev. Biol. 222,124 -134.[CrossRef][Medline]
Hill, C. S. (2001). TGF-ß signalling in early Xenopus development. Curr. Opin. Genet. Dev. 11,533 -540.[CrossRef][Medline]
Hiratani, I., Mochizuki, T., Tochimoto, N. and Taira, M. (2001). Functional domains of the LIM homeodomain protein Xlim-1 involved in negative regulation, transactivation, and axis formation in Xenopus embryos. Dev. Biol. 229,456 -467.[CrossRef][Medline]
Howell, M. and Hill, C. S. (1997). XSmad2 directly activates the activin-inducible, dorsal mesoderm gene XFKH1 in Xenopus embryos. EMBO J. 16,7411 -7421.[CrossRef][Medline]
Howell, M., Mohun, T. J. and Hill, C. S. (2001). Xenopus Smad3 is specifically expressed in the chordoneural hinge, notochord and in the endocardium of the developing heart. Mech. Dev. 104,147 -150.[CrossRef][Medline]
Hukriede, N. A., Tsang, T. E., Habas, R., Khoo, P. L., Steiner, K., Weeks, D. L., Tam, P. P. and Dawid, I. B. (2003). Conserved requirement of Lim1 function for cell movements during gastrulation. Dev. Cell 4,83 -94.[CrossRef][Medline]
Jurata, L. W., Pfaff, S. L. and Gill, G. N.
(1998). The nuclear LIM domain interactor NLI mediates homo- and
heterodimerization of LIM domain transcription factors. J. Biol.
Chem. 273,3152
-3157.
Kofron, M., Demel, T., Xanthos, J., Lohr, J., Sun, B., Sive, H., Osada, S., Wright, C., Wylie, C. and Heasman, J. (1999). Mesoderm induction in Xenopus is a zygotic event regulated by maternal VegT via TGFbeta growth factors. Development 126,5759 -5770.[Abstract]
Lemaire, P., Garrett, N. and Gurdon, J. B. (1995). Expression cloning of Siamois, a Xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete secondary axis. Cell 81,85 -94.[CrossRef][Medline]
Leung, A. Y., Mendenhall, E. M., Kwan, T. T., Liang, R., Eckfeldt, C., Chen, E., Hammerschmidt, M., Grindley, S., Ekker, S. C. and Verfaillie, C. M. (2005). Characterization of expanded intermediate cell mass in zebrafish chordin morphant embryos. Dev. Biol. 277,235 -254.[CrossRef][Medline]
Massague, J. and Wotton, D. (2000). Transcriptional control by the TGF-beta/Smad signaling system. EMBO J. 19,1745 -1754.[CrossRef][Medline]
Mitchell, T. S. and Sheets, M. D. (2001). The FGFR pathway is required for the trunk-inducing functions of Spemann's organizer. Dev. Biol. 237,295 -305.[CrossRef][Medline]
Miyazawa, K., Shinozaki, M., Hara, T., Furuya, T. and Miyazono, K. (2002). Two major Smad pathways in TGF-beta superfamily signalling. Genes Cells 7,1191 -1204.[Abstract]
Mochizuki, T., Karavanov, A. A., Curtiss, P. E., Ault, K. T., Sugimoto, N., Watabe, T., Shiokawa, K., Jamrich, M., Cho, K. W., Dawid, I. B. et al. (2000). Xlim-1 and LIM domain binding protein 1 cooperate with various transcription factors in the regulation of the goosecoid promoter. Dev. Biol. 224,470 -485.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1975). Normal Table of Xenopus laevis. Amsterdam, North Holland: Daudin.
Oelgeschlager, M., Kuroda, H., Reversade, B. and De Robertis, E. M. (2003). Chordin is required for the Spemann organizer transplantation phenomenon in Xenopus embryos. Dev. Cell 4,219 -230.[CrossRef][Medline]
Piepenburg, O., Grimmer, D., Williams, P. H. and Smith, J.
C. (2004). Activin redux: specification of mesodermal pattern
in Xenopus by graded concentrations of endogenous activin B.
Development 131,4977
-4986.
Randall, R. A., Howell, M., Page, C. S., Daly, A., Bates, P. A.
and Hill, C. S. (2004). Recognition of
phosphorylated-Smad2-containing complexes by a novel Smad interaction motif.
Mol. Cell Biol. 24,1106
-1121.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79,779 -790.[CrossRef][Medline]
Sasai, Y., Lu, B., Steinbeisser, H. and De Robertis, E. M. (1995). Regulation of neural induction by the Chd and Bmp-4 antagonistic patterning signals in Xenopus. Nature 377, 757.[CrossRef][Medline]
Schulte-Merker, S., Lee, K. J., McMahon, A. P. and Hammerschmidt, M. (1997). The zebrafish organizer requires chordino. Nature 387,862 -863.[CrossRef][Medline]
Slack, J. M. W. (1984). Regional biosynthetic markers in the early amphibian embryo. J. Embryol. Exp. Morphol. 80,289 -319.[Medline]
Taira, M., Jamrich, M., Good, P. J. and Dawid, I. B.
(1992). The LIM domain-containing homeo box gene Xlim-1 is
expressed specifically in the organizer region of Xenopus gastrula embryos.
Genes Dev. 6,356
-366.
Taira, M., Otani, H., Saint-Jeannet, J. P. and Dawid, I. B. (1994). Role of the LIM class homeodomain protein Xlim-1 in neural and muscle induction by the Spemann organizer in Xenopus. Nature 372,677 -679.[CrossRef][Medline]
Tao, Q., Yokota, C., Puck, H., Kofron, M., Birsoy, B., Yan, D., Asashima, M., Wylie, C. C., Lin, X. and Heasman, J. (2005). Maternal wnt11 activates the canonical wnt signaling pathway required for axis formation in Xenopus embryos. Cell 120,857 -871.[CrossRef][Medline]
Verschueren, K., Remacle, J. E., Collart, C., Kraft, H., Baker,
B. S., Tylzanowski, P., Nelles, L., Wuytens, G., Su, M. T., Bodmer, R. et
al. (1999). SIP1, a novel zinc finger/homeodomain repressor,
interacts with Smad proteins and binds to 5'-CACCT sequences in
candidate target genes. J. Biol. Chem.
274,20489
-20498.
Watanabe, M., Rebbert, M. L., Andreazzoli, M., Takahashi, N., Toyama, R., Zimmerman, S., Whitman, M. and Dawid, I. B. (2002). Regulation of the Lim-1 gene is mediated through conserved FAST-1/FoxH1 sites in the first intron. Dev. Dyn. 225,448 -456.[CrossRef][Medline]
Weaver, C. and Kimelman, D. (2004). Move it or
lose it: axis specification in Xenopus. Development
131,3491
-3499.
Wessely, O., Agius, E., Oelgeschlager, M., Pera, E. M. and De Robertis, E. M. (2001). Neural induction in the absence of mesoderm: beta-catenin-dependent expression of secreted BMP antagonists at the blastula stage in Xenopus. Dev. Biol. 234,161 -173.[CrossRef][Medline]
Wessely, O., Kim, J. I., Geissert, D., Tran, U. and De Robertis, E. M. (2004). Analysis of Spemann organizer formation in Xenopus embryos by cDNA macroarrays. Dev. Biol. 269,552 -566.[CrossRef][Medline]
Williams, P. H., Hagemann, A., González-Gaitán, M. and Smith, J. C. (2004). Visualizing long-range movement of the morphogen Xnr2 in the Xenopus embryo. Curr. Biol. 14,1916 -1923.[CrossRef][Medline]
Xanthos, J. B., Kofron, M., Wylie, C. and Heasman, J. (2001). Maternal VegT is the initiator of a molecular network specifying endoderm in Xenopus laevis. Development 128,167 -180.[Abstract]
Yamamoto, S., Hikasa, H., Ono, H. and Taira, M. (2003). Molecular link in the sequential induction of the Spemann organizer: direct activation of the cerberus gene by Xlim-1, Xotx2, Mix.1, and Siamois, immediately downstream from Nodal and Wnt signaling. Dev. Biol. 257,190 -204.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
Y. Yasuoka, M. Kobayashi, D. Kurokawa, K. Akasaka, H. Saiga, and M. Taira Evolutionary origins of blastoporal expression and organizer activity of the vertebrate gastrula organizer gene lhx1 and its ancient metazoan paralog lhx3 Development, June 15, 2009; 136(12): 2005 - 2014. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Carpenter and W. Z. Cande Using Morpholinos for Gene Knockdown in Giardia intestinalis Eukaryot. Cell, June 1, 2009; 8(6): 916 - 919. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Hurt, R. A. Obar, B. Zhai, N. G. Farny, S. P. Gygi, and P. A. Silver A conserved CCCH-type zinc finger protein regulates mRNA nuclear adenylation and export J. Cell Biol., April 20, 2009; 185(2): 265 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Eisen and J. C. Smith Controlling morpholino experiments: don't stop making antisense Development, May 15, 2008; 135(10): 1735 - 1743. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. V. Esguerra, L. Nelles, L. Vermeire, A. Ibrahimi, A. D. Crawford, R. Derua, E. Janssens, E. Waelkens, P. Carmeliet, D. Collen, et al. Ttrap is an essential modulator of Smad3-dependent Nodal signaling during zebrafish gastrulation and left-right axis determination Development, December 15, 2007; 134(24): 4381 - 4393. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||