|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 21 September 2005
doi: 10.1242/dev.02041
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Department of Systems Biology, Harvard Medical School, Boston, MA 02115, USA
Author for correspondence (e-mail:
marc{at}hms.harvard.edu)
Accepted 16 August 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Convergent extension, Microtubule, XLfc, Xenopus
| Introduction |
|---|
|
|
|---|
While the basis of convergent extension has been extensively addressed by
classical observational studies, the molecular mechanisms underlying cell
behaviors remain obscure. In particular, little is understood about the
regulation and function of actin and microtubules during these cell movements.
One striking observation suggesting a role for microtubules in convergent
extension is the ability of the microtubule depolymerizing drug nocodazole to
block mediolateral cell polarity (Lane and
Keller, 1997
). Exposure of embryos or explants to nocodazole from
stage 10 to 19 (the beginning of gastrulation to the end of neurulation)
inhibited convergent extension; however, nocodazole treatment from stage 10.5
to 19 (the first appearance of a fully circular blastopore to the end of
neurulation) had no effect on the process. Therefore, the microtubule
cytoskeleton appeared to be required for a very brief and specific period of
time. After stage 10.5, microtubules appear to be dispensable, although there
is little analysis of the cellular effects of microtubule
depolymerization.
The effect of nocodazole on convergent extension is unlikely to be due to
an effect on the cell cycle, as cell division is completely inhibited in the
chordamesoderm during this period, as assayed by phospho-histone H3 staining
(Saka and Smith, 2001
). In
fact, cell cycle blockade is actually necessary to allow the productive
cell-cell contacts integral to convergent extension movements
(Leise and Mueller, 2004
).
We have followed the microtubule requirement to questions of how cell shape and dynamics change during convergent extension. Using spinning disk confocal microscopy, we have documented the microtubule requirement for actin assembly and dynamics. These studies have led to a surprising function for microtubules as a bulk regulator of Rho-family GTPases through a specific Rho-GEF. These results tie signaling to polymer assembly and indicate a direct role for microtubules in regulating cell polarity.
| Materials and methods |
|---|
|
|
|---|
DMZ explants for whole-mount analysis were dissected at stage 10 or 10.5
(as noted) and cultured in 0.5xMMR until stage 19. DMZ explants for
confocal microscopy were dissected and cultured in 1xDanilchik's for Amy
(DFA) plus bovine serum albumin (BSA)
(Marsden and DeSimone, 2003
),
in chambered coverglasses (VWR) and secured below a separate coverslip using
Lubriseal stopcock grease (Thomas Scientific). Chambered coverglasses and
coverslips were coated overnight at 4°C with BSA (1% in water). Explants
for confocal microscopy were oriented with the inner cells down (toward the
objective on an inverted scope) and the epithelium up (away from the
objective). Confocal imaging was performed on deep chordamesoderm cells.
Transfection of NIH3T3 cells; immunofluorescence of cells and explants
NIH3T3 cells were grown in DMEM+10% calf serum. Cells were grown to 40-70%
confluence for transfection with TransIT-LT1 transfection reagent (Mirus).
Transfections were performed according to manufacturer's protocol, using 3-6
µg DNA and 15 µl transfection reagent.
Cells and explants were fixed in methanol, permeabilized in modified
Barth's solution (MBS) (Peng,
1991
) + 0.1% Triton X-100, and blocked in MBS + 0.1% Triton X-100
+ 2% BSA. DM1
(monoclonal antibody to tubulin) was used at 1:1000,
followed with appropriate secondary antibody. Explants were dehydrated,
cleared in 2:1 benzyl benzoate:benzyl alcohol (BB:BA), and mounted for
imaging. As methanol fixation destroys eGFP fluorescence, staining for
eGFP-tagged constructs was performed using a polyclonal antibody to eGFP
(Abcam 6556, 1:1000), followed with appropriate secondary antibody.
Imaging/image analysis
Confocal images were acquired in the Nikon Imaging Center at Harvard
Medical School using a Nikon TE2000U inverted microscope with a Perkin Elmer
Ultraview Spinning Disk Confocal Head, Hamamatsu Orca-ER cooled CCD Camera and
MetaMorph software (Universal Imaging).
Color images of whole explants and embryos were acquired using a Sony 3CCD
Color Camera mounted on a Zeiss Stemi SV11 Stereoscope. Explant elongation was
quantitated similar to Tahinci and Symes
(2003
) by measuring the length
of the longest vector of each explant and the width of each explant at the
point where the mesoderm extends from the neurectoderm. The length/width ratio
was calculated for each explant. All images were acquired and measurements
performed using Metamorph software (Universal Imaging). Data were analyzed
using analysis of variance (ANOVA) and P-values determined using
Tukey's method.
RNAs/DNAs
Plasmid DNAs were linearized overnight and purified using the Qiagen PCR
Purification Kit. RNAs were synthesized using the mMessage mMachine kit
(Ambion) for capped RNA, purified using the Qiagen RNeasy Mini Kit,
precipitated in ethanol, and resuspended in RNAse-free water.
Morpholino oligonucleotide experiments
Two morpholinos (GeneTools, LLC) were synthesized. MoXLfc
(AGAAGAGGACTCAATCCGAGACATA) is complementary to XLfc and spans 1 to +24
of the coding sequence. MoCon, the control morpholino, is the same sequence as
MoXLfc, only reversed (ATACAGAGCCTAACTCAGGAGAAGA). Morpholinos were
resuspended and diluted in RNAse-free water.
Wobbled-XLfc (wXLfc) was created by altering as many nucleotides as possible in the sequence recognized by MoXLfc, while preserving the amino acid sequence (MSRIESSS). wXLfc has nine nucleotide changes from wild-type XLfc (ATGTCAAGAATAGAAAGCTCATCA; changes in bold). For rescue experiments, embryos were first injected in both cells of 2-cell embryos with morpholino oligonucleotides, and subsequently injected at the 4-cell stage in the marginal zone of the two dorsal cells with wXLfc RNA.
| Results |
|---|
|
|
|---|
To determine the effects of microtubule depolymerization at the cellular level, actin and microtubules were imaged simultaneously in live explants. To visualize the complete microtubule lattice, we utilized eGFP-tau. To visualize the growing ends of microtubules, we utilized eGFP-CLIP-170, a microtubule plus-end binding protein. By co-injection of eGFP-tau (100 pg RNA) or eGFP-CLIP-170 (300 pg RNA) with rhodamine-labeled actin protein (15 ng), we could image either actin and the complete microtubule lattice or actin and microtubule plus-ends in living explants. Injections were targeted to the marginal zone of the two dorsal cells of the 4-cell embryo. At the appropriate stage, DMZ explants were cut, secured between coverglasses, and imaged using spinning disk confocal microscopy.
|
|
Nocodazole treatment of cells fully depolymerized the microtubule
cytoskeleton, as assayed by fixation and antibody staining for microtubules
(Lane and Keller, 1997
).
Individual microtubules were replaced by diffuse eGFP-tau fluorescence
(Fig. 2D,F). Cell morphology
and actin-rich protrusions were also affected, in two time-dependent phases.
In the first phase, active protrusions were inhibited; many fewer cells
produced lamellipodia (Fig.
2C). This became apparent within 15-30 minutes of nocodazole
treatment. Prolonged nocodazole treatment produced a second phase of effects:
cell-cell contacts are lost and cells look almost dissociated
(Fig. 2E). The onset of this
phase varied between 1 and 3 hours after initial nocodazole treatment. These
effects are unlikely to be due to a pharmacological side effect of nocodazole,
as colcemid, a microtubule-depolymerizing drug structurally unrelated to
nocodazole, produced the same effects (data not shown).
|
|
Microtubule dynamics are not obviously different after stage 10.5. Velocity measurements of microtubule plus-end growth (using eGFP-CLIP-170, 300 pg RNA) revealed that dynamic growth was not significantly different before and after stage 10.5. In Fig. 3B, each point represents the velocity of growth of a single microtubule, tracked for at least 20 seconds. Blue points are microtubules from stage 10 explants (37 microtubules from eight cells in two explants), while red points are microtubules from stage 10.5 explants (34 microtubules from seven cells in two explants). At stage 10, the average velocity of microtubule growth was 0.514±0.042 µm/sec, while at stage 10.5, the average velocity was 0.486±0.056 µm/sec; there was no significant change in velocity of growth. These data suggest that significant changes in the microtubule cytoskeleton or dynamics are not responsible for the change in the sensitivity of convergent extension to microtubule depolymerization. It should be noted, however, that these experiments have only monitored the velocity of microtubule growth, not disassembly, as eGFP-CLIP-170 marks only growing ends of microtubules. As a result, it is possible that there is a change in the velocity of microtubule disassembly, the proportion of microtubules undergoing shrinkage, or the fraction of stable microtubules. However, the similar growth characteristics of microtubules and continued sensitivity to nocodazole suggest that their intrinsic properties change little, if at all, between stages 10 and 10.5.
Microtubule mass is a crucial factor in convergent extension
It has been reported that the microtubule-stabilizing drug taxol has no
effect on convergent extension movements
(Lane and Keller, 1997
).
Although taxol stabilizes, rather than depolymerizes, microtubules, it also
interferes with dynamic functions of microtubules. We have confirmed the
insensitivity to taxol, using continuous treatment of explants with taxol (20
µg/ml) from stage 10 to 19 (Fig.
5A,B). Confocal microscopy revealed that unlike nocodazole, taxol
had no effect on active protrusions or cell-cell contacts
(Fig. 2I). Taxol-stabilized
microtubules bound eGFP-CLIP-170 uniformly, not just at their plus-ends, an
indication that the microtubules are static
(Fig. 2J).
Taxol treatment, while abolishing the dynamic properties of microtubules, left them structurally intact, allowing continued interaction with microtubule-associated proteins and vesicular trafficking via motor proteins. To distinguish the role of polymer mass independent of microtubule structure, we utilized another pharmacological inhibitor of microtubule dynamics, vinblastine. In mammalian cells, high concentrations of vinblastine completely convert microtubules into paracrystalline arrays of tubulin protofilaments, which have none of the biological features of microtubules that rely on their dynamics. As shown in Fig. 5C, vinblastine (2 µM) induced paracrystalline arrays of tubulin in Xenopus explants; however, continuous exposure of explants to vinblastine from stage 10 to 19 did not significantly inhibit convergent extension (Fig. 5D,E).
Although taxol and vinblastine inhibit microtubule dynamics, the stabilized microtubules or tubulin protofilaments are in a conformation to which microtubule-associated proteins can still bind; proteins that might bind to microtubules under normal conditions should still bind in the presence of either taxol or vinblastine. These data suggest that although there is a microtubule requirement at stage 10 for convergent extension, the requirement does not include the structure and dynamics of the microtubule array. Instead, the crucial microtubule requirement during convergent extension is protofilament mass.
The microtubule mass requirement can be rescued by dominant negative Rho and Rho-kinase inhibitor
The link between microtubules and actin has not been shown to be a direct
physical one, which suggests a role of microtubules in regulating signaling or
other activities. Small GTPases of the Rho family have long been demonstrated
to regulate cell morphology and the actin cytoskeleton
(Hall and Nobes, 2000
). These
small GTPases, including Rac, Rho and Cdc42, cycle between an active,
GTP-bound state, and an inactive, GDP-bound state. The nucleotide state of the
GTPase is regulated intrinsically by the nucleotide hydrolysis activity of the
GTPase, and extrinsically by factors such as guanine-nucleotide exchange
factors (GEFs) and GTPase-activating proteins (GAPs). There is evidence that
microtubule depolymerization can lead to the activation of certain Rho-family
GTPases, which then induce changes in cell morphology
(Etienne-Manneville and Hall,
2002
). In HeLa cells, microtubule depolymerization induces cell
retraction and formation of stress fibers, a phenotype characteristic of Rho
activation (Krendel et al.,
2002
). Based on this, we tested the involvement of Rho in
convergent extension.
|
As dn Rho rescued the inhibition of convergent extension by nocodazole, we tested the involvement of a downstream effector of Rho, Rho kinase, via the small molecule inhibitor Y-27632. Inhibition of Rho kinase (10 µM Y-27632) partially rescued the inhibition of convergent extension by nocodazole (Fig. 6C,D). The extent of elongation in explants treated with both nocodazole and Y-27632 was significantly greater than the elongation of explants treated only with nocodazole (P<0.01). Y-27632 also rescued the inhibition of lamellipodia by nocodazole, without affecting nocodazole-mediated microtubule depolymerization (Fig. 2M,N).
|
The microtubule depolymerization effects can be overcome by V12 Rac, but not V12 Cdc42
Because actin assembly and protrusive activity can be mediated by Rac and
Cdc42, we asked whether the nocodazole-mediated inhibition of convergent
extension could be overcome by activated forms of Rac (V12) or Cdc42 (V12). In
mammalian cell culture, activated Rac induces the formation of lamellipodia,
while activated Cdc42 induces the formation of filopodia
(Nobes and Hall, 1995
); these
effects are recapitulated in Xenopus cells
(Hens et al., 2002
;
Kwan and Kirschner, 2003
).
Therefore, active protrusions induced by these proteins might bypass the
effects of microtubule depolymerization, thereby rescuing convergent extension
movements.
V12 Rac (25 pg DNA) partially overcame the inhibition of convergent
extension by nocodazole (Fig.
7A,B). The extent of elongation in explants expressing V12 Rac and
treated with nocodazole (15 µg/ml) was significantly greater than the
elongation of explants treated with only nocodazole (P<0.05).
Confocal microscopy revealed that active protrusions were restored, even
though microtubules remained depolymerized
(Fig. 2O,P). It should be noted
that higher amounts of V12 Rac (50-200 pg DNA) did not rescue convergent
extension. Under these conditions, cells are unpolarized, displaying
protrusive activity around the entire perimeter of the cells (data not shown).
Such dysregulation of active protrusions has been shown to be sufficient to
inhibit convergent extension (Wallingford
et al., 2000
). When V12 Cdc42 was tested for its ability to rescue
convergent extension blocked by nocodazole, it was ineffective
(Fig. 7C,D). This was true over
the entire range of DNA concentrations tested (25-100 pg DNA).
These data suggest that induction of lamellipodia by V12 Rac, and not induction of filopodia by V12 Cdc42, is sufficient to overcome nocodazole-mediated inhibition of convergent extension.
Cloning and alignment of XLfc
We have shown that a sufficient mass of oligomerized or polymerized tubulin
is crucial for convergent extension, and that dn Rho, Rho kinase inhibition,
and activated Rac can partially overcome the inhibition of convergent
extension by nocodazole. This is reminiscent of a phenomenon reported in HeLa
cells, where microtubule depolymerization induces cell retraction and
formation of stress fibers downstream of Rho
(Krendel et al., 2002
). A
microtubule-binding Rho-GEF, GEF-H1, was identified, which is inactivated by
binding to microtubules. Microtubule depolymerization liberates GEF-H1, which
activates Rho; Rho then induces cell retraction and stress fiber
formation.
A small fragment of the Xenopus homolog of GEF-H1 had already been
cloned (Morgan et al., 1999
).
Xenopus Lfc (XLfc, after the mouse homolog of GEF-H1, Lfc) was
reported to be a zygotic transcript, with expression beginning at stage 9.5
(late blastula). In-situ analysis demonstrated that XLfc is expressed in the
ectoderm and mesoderm, with expression restricted to the neural ectoderm
during neurula stages (Morgan et al.,
1999
). As XLfc is expressed at the right time and place to be
involved in convergent extension, we cloned the full-length gene to see if its
activity is responsible for the effects induced by microtubule
depolymerization.
Full-length XLfc is 981 amino acids
(Fig. 8A), with a predicted
molecular weight of 131 kD. Like its mouse and human homologs, XLfc contains a
C1/zinc-binding region near the N-terminus, which has been demonstrated to be
required for microtubule binding (Krendel
et al., 2002
), as well as a Dbl-homology (DH) domain, responsible
for nucleotide exchange activity, a pleckstrin-homology (PH) domain, and a
coiled-coil (CC) region.
As localization of GEF-H1 and Lfc to microtubules is crucial for regulation of nucleotide exchange activity, the localization of XLfc was tested. NIH3T3 cells were transfected with eGFP-XLfc, fixed, and stained for eGFP and tubulin. In transfected cells, eGFP-XLfc colocalizes with microtubules (Fig. 8B).
|
|
|
To confirm the specificity of the morpholino effects, we designed a version of full-length XLfc not recognized by the morpholino; the amino acid sequence is conserved while the nucleotide sequence is altered. This version of XLfc is referred to as wobbled-XLfc (wXLfc). For these experiments, embryos were first injected at the 2-cell stage with morpholinos. At the 4-cell stage, embryos were injected in the DMZ with wXLfc RNA. At these doses, expression of wXLfc alone had only modest effects on convergent extension (Fig. 10C, compare panels I and III); because wXLfc has an intact microtubule-binding site, it is presumably buffered by microtubules. Expression of wXLfc restored, in a dose-dependent manner, the ability of nocodazole to inhibit convergent extension (Fig. 10C, panel II). These data suggest that XLfc is a major endogenous effector of microtubule depolymerization during convergent extension.
| Discussion |
|---|
|
|
|---|
|
We have confirmed that there is an abrupt switch at stage 10.5, after which
convergent extension is insensitive to microtubule depolymerization
(Lane and Keller, 1997
). This
switch does not seem to correspond to changes in the structure or dynamics of
the microtubule cytoskeleton (Fig.
2G,H and Fig. 3).
It seemed unusual that convergent extension is not affected by either taxol or
vinblastine, both of which impair filament organization and dynamics in
mechanistically distinct ways from each other and from nocodazole. Taxol
stabilizes microtubule polymers but completely blocks dynamics. Vinblastine
completely dissolves microtubules, dissembling them into short protofilaments
that aggregate into large paracrystals. Although normal microtubule functions
are inhibited, both of these represent stabilized forms of tubulin polymer
still capable of binding microtubule-associated proteins. The most likely
explanation for the sensitivity of convergent extension to nocodazole and
insensitivity to vinblastine and taxol is that it is not microtubule dynamics
that are important, but simply the mass of assembled protofilaments.
Because of the effects of nocodazole on lamellipodial protrusions, we
tested the role of Rho-family GTPases downstream of microtubule
depolymerization. Inhibition of convergent extension by nocodazole could be
partially rescued by dn Rho (N19), Rho-kinase inhibitor (Y-27632), or V12 Rac
(Fig. 6,
Fig. 7A,B). Confocal microscopy
revealed that each of these factors restored lamellipodia, suggesting that
microtubule depolymerization inhibits convergent extension via alterations of
the actin cytoskeleton (Fig.
2K-P). Similarly, it has been demonstrated that alterations of
active protrusions are sufficient to inhibit convergent extension
(Wallingford et al., 2000
). It
is worth mentioning that some of the factors tested here, such as Rho and Rho
kinase, can, at high levels, inhibit convergent extension
(Marlow et al., 2002
;
Tahinci and Symes, 2003
). In
the experiments reported here, we have used levels of dn Rho and Rho-kinase
inhibitor 2- to 4-fold lower than the levels that inhibit convergent
extension. There exists a continuum of effects that goes from no protrusive
activity (convergent extension is blocked), to sufficient protrusive activity
to maintain polarity (favoring convergent extension), to exuberant protrusive
activity (polarity is lost and convergent extension is again blocked). For
example, with V12 Rac, 25 pg DNA is sufficient to overcome the inhibition of
convergent extension by nocodazole, but higher amounts (50-200 pg DNA) induce
lamellipodia indiscriminately, in an unpolarized manner, and block convergent
extension (data not shown). This suggests that whatever signals lead to cell
polarization, directed motility can be blocked by inhibition of protrusive
activity and also by excessive protrusive activity that occurs around the
entire cell. This underscores the dynamic nature of the process; although many
cell biological regulators are required for convergent extension, their levels
and activity must be tightly regulated. It has been previously noted that the
expression level of many regulators is crucial for convergent extension
(Djiane et al., 2000
;
Wallingford et al., 2002
).
Microtubule depolymerization in HeLa cells induces cell retraction and
stress fiber formation, as a result of Rho activation. These effects can be
accounted for by activation of the microtubule-binding Rho-GEF, GEF-H1
(Krendel et al., 2002
). We have
cloned the full-length Xenopus homolog of GEF-H1, XLfc
(Fig. 8A). Previously, a
partial clone of XLfc was isolated (Morgan
et al., 1999
); in-situ analysis revealed that XLfc is expressed at
the right time and place to be involved in convergent extension. Dominant
negative XLfc (Y398A), which lacks nucleotide exchange activity, partially
rescued the effects of nocodazole on convergent extension
(Fig. 2Q,R,
Fig. 9A,B), suggesting that
nucleotide exchange activity of XLfc is required for microtubule
depolymerization to inhibit convergent extension. Conversely, constitutively
active XLfc (C55R), which does not localize to microtubules, is sufficient to
inhibit convergent extension (Fig.
9C-E), recapitulating the effects of microtubule depolymerization
at the cellular level: inhibition of lamellipodia and loss of cell-cell
contact (Fig. 2S,T).
Although dominant negative and constitutively active forms of XLfc affected convergent extension in the manner expected, this did not test directly the role of XLfc in convergent extension. Therefore, we designed a translation-blocking morpholino to knockdown endogenous XLfc. We reasoned that if nocodazole acts via XLfc, knockdown of XLfc would block the ability of nocodazole to inhibit convergent extension. XLfc morpholino diminished, in a dose-dependent manner, the ability of nocodazole to inhibit convergent extension (Fig. 10A,B). Expression of a wobbled XLfc construct not recognized by the morpholino restored the ability of nocodazole to inhibit convergent extension (Fig. 10C). Interestingly, knockdown of XLfc had no discernible effect on convergent extension in the absence of nocodazole, suggesting that under normal circumstances, endogenous polarization cues are strong enough to overcome the lack of XLfc, or that reduced levels of XLfc are still sufficient to carry out normal function. Alternately, as knockdown of XLfc gives only a partial block of the nocodazole effect, there may be other XLfc-like genes not recognized by the morpholino that can partially compensate in the absence of XLfc. In any case, the loss-of-function experiment suggests that XLfc is a major endogenous effector of microtubule depolymerization during convergent extension.
As XLfc activity is regulated by microtubules, at least before stage 10.5, we asked why such an unusual mechanism of regulation, among the many transcriptional, translational and post-translational means available. The unique feature of microtubules is that their distribution (and hence, mass) is non-uniform, dynamic and reflective of overall cell polarity. Summarizing our current model of XLfc regulation (Fig. 11A), XLfc binds microtubules and is inactive. Upon microtubule depolymerization, XLfc is released and becomes active for nucleotide exchange activity, thereby activating certain Rho-family GTPases. Activation of Rho-family GTPases leads to inhibition of lamellipodia and loss of cell-cell contact.
|
While it is possible that global regulation of XLfc by microtubule polymer
creates permissive conditions for lamellipodial activity and convergent
extension, microtubule binding creates the opportunity for XLfc to act locally
within cells; a speculative model is schematized
(Fig. 11B). While we might
expect the steady state concentration of unbound XLfc to be uniform in the
cell, this might not be true in transient states. Episodes of microtubule
turnover could induce local Rho activation and inhibition of lamellipodia.
Such local effects could help break the symmetry of lamellipodial extension
around the entire periphery of the cell. This proposed model is consistent
with the original work describing the establishment of polarity during
convergent extension (Shih and Keller,
1992
). The crucial step in establishment of polarity is not
induction of polarized mediolateral protrusions, but loss or repression of
anterior-posterior protrusions. Identification of the signals inducing
polarization during convergent extension will greatly aid the dissection of
these models.
It is important to point out that dn Rho only partially rescued
nocodazole-mediated inhibition of convergent extension, suggesting that Rho
may not be the relevant or only target of XLfc. Two different forms of
activated Rho (V14 and L30) do not fully recapitulate the effects of
microtubule depolymerization on convergent extension (data not shown). V14 Rho
can indeed inhibit convergent extension, but lamellipodia are not lost (data
not shown). This result was also obtained in a study of GTPase overexpression
during convergent extension (Tahinci and
Symes, 2003
). These observations reinforce the importance of
combining whole explant analysis with cellular-level analysis. While
inhibition of lamellipodial protrusions is sufficient to inhibit convergent
extension, other mechanisms (e.g. subtle changes in cell morphology and
dynamics of active protrusions) are likely to be important and merit further
analysis. One hundred small GTPases have been tested in a simple morphological
assay; HeLa cells were transfected and observed for changes in cell shape,
polarity, and spreading (Heo and Meyer,
2003
). This work suggests that considering only Rac, Rho and Cdc42
is inadequate when evaluating cell morphology. Unfortunately, these reagents
are not readily available; therefore, it was not possible for us to test
involvement of other Rho-family GTPases in convergent extension. It is likely
that XLfc activates one or more small GTPases in addition to Rho; the activity
of these targets alone or in combination with Rho would be responsible for
mediating the effects of XLfc, which are clearly revealed only under
conditions of microtubule depolymerization.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/20/4599/DC1
* Present address: Department of Neurobiology and Anatomy, University of
Utah, Salt Lake City, UT 84132, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Bulinski, J. C. and Gundersen, G. G. (1991).
Stabilization of post-translational modification of microtubules during
cellular morphogenesis. Bioessays
13,285
-293.[CrossRef][Medline]
Djiane, A., Riou, J., Umbhauer, M., Boucaut, J. and Shi, D.
(2000). Role of frizzled 7 in the regulation of convergent
extension movements during gastrulation in Xenopus laevis.Development 127,3091
-3100.[Abstract]
Etienne-Manneville, S. and Hall, A. (2002). Rho
GTPases in cell biology. Nature
420,629
-635.[CrossRef][Medline]
Gerhart, J. and Keller, R. (1986).
Region-specific cell activities in amphibian gastrulation. Annu.
Rev. Cell Biol. 2,201
-229.[CrossRef][Medline]
Hall, A. and Nobes, C. D. (2000). Rho GTPases:
molecular switches that control the organization and dynamics of the actin
cytoskeleton. Philos. Trans. R. Soc. London Ser. B
355,965
-970.
Hens, M. D., Nikolic, I. and Woolcock, C. M.
(2002). Regulation of Xenopus embryonic cell adhesion by
the small GTPase, rac. Biochem. Biophys. Res. Commun.
298,364
-370.[CrossRef][Medline]
Heo, W. D. and Meyer, T. (2003).
Switch-of-function mutants based on morphology classification of Ras
superfamily small GTPases. Cell
113,315
-328.[CrossRef][Medline]
Keller, R., Davidson, L., Edlund, A., Elul, T., Ezin, M., Shook,
D. and Skoglund, P. (2000). Mechanisms of convergence and
extension by cell intercalation. Philos. Trans. R. Soc. London Ser.
B 355,897
-922.
Krendel, M., Zenke, F. T. and Bokoch, G. M.
(2002). Nucleotide exchange factor GEF-H1 mediates cross-talk
between microtubules and the actin cytoskeleton. Nat. Cell
Biol. 4,294
-301.[CrossRef][Medline]
Kwan, K. M. and Kirschner, M. W. (2003). Xbra
functions as a switch between cell migration and convergent extension in the
Xenopus gastrula. Development
130,1961
-1972.
Lane, M. C. and Keller, R. (1997). Microtubule
disruption reveals that Spemann's organizer is subdivided into two domains by
the vegetal alignment zone. Development
124,895
-906.[Abstract]
Leise, W. F., 3rd and Mueller, P. R. (2004).
Inhibition of the cell cycle is required for convergent extension of the
paraxial mesoderm during Xenopus neurulation.
Development 131,1703
-1715.
Marlow, F., Topczewski, J., Sepich, D. and Solnica-Krezel,
L. (2002). Zebrafish Rho kinase 2 acts downstream of Wnt11 to
mediate cell polarity and effective convergence and extension movements.
Curr. Biol. 12,876
-884.[CrossRef][Medline]
Marsden, M. and DeSimone, D. W. (2003).
Integrin-ECM interactions regulate cadherin-dependent cell adhesion and are
required for convergent extension in Xenopus. Curr.
Biol. 13,1182
-1191.[CrossRef][Medline]
Morgan, R., Hooiveld, M. H. and Durston, A. J.
(1999). A novel guanine exchange factor increases the competence
of early ectoderm to respond to neural induction. Mech.
Dev. 88,67
-72.[CrossRef][Medline]
Nobes, C. D. and Hall, A. (1995). Rho, rac and
cdc42 GTPases: regulators of actin structures, cell adhesion and motility.
Biochem. Soc. Trans. 23,456
-459.[Medline]
Peng, H. B. (1991). Xenopus laevis:
practical uses in cell and molecular biology. Solutions and protocols.
Methods Cell Biol. 36,657
-662.[Medline]
Saka, Y. and Smith, J. C. (2001). Spatial and
temporal patterns of cell division during early Xenopus
embryogenesis. Dev. Biol.
229,307
-318.[CrossRef][Medline]
Shih, J. and Keller, R. (1992). Cell motility
driving mediolateral intercalation in explants of Xenopus laevis.Development 116,901
-914.[Abstract]
Sterpetti, P., Hack, A. A., Bashar, M. P., Park, B., Cheng, S.
D., Knoll, J. H., Urano, T., Feig, L. A. and Toksoz, D.
(1999). Activation of the Lbc Rho exchange factor proto-oncogene
by truncation of an extended C terminus that regulates transformation and
targeting. Mol. Cell. Biol.
19,1334
-1345.
Tahinci, E. and Symes, K. (2003). Distinct
functions of Rho and Rac are required for convergent extension during
Xenopus gastrulation. Dev. Biol.
259,318
-335.[CrossRef][Medline]
Wallingford, J. B., Rowning, B. A., Vogeli, K. M., Rothbacher,
U., Fraser, S. E. and Harland, R. M. (2000). Dishevelled
controls cell polarity during Xenopus gastrulation.
Nature 405,81
-85.[CrossRef][Medline]
Wallingford, J. B., Fraser, S. E. and Harland, R. M.
(2002). Convergent extension: the molecular control of polarized
cell movement during embryonic development. Dev. Cell
2, 695-706.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H. Lu, N. Murata-Kamiya, Y. Saito, and M. Hatakeyama Role of Partitioning-defective 1/Microtubule Affinity-regulating Kinases in the Morphogenetic Activity of Helicobacter pylori CagA J. Biol. Chem., August 21, 2009; 284(34): 23024 - 23036. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Kieserman and J. B. Wallingford In vivo imaging reveals a role for Cdc42 in spindle positioning and planar orientation of cell divisions during vertebrate neural tube closure J. Cell Sci., July 15, 2009; 122(14): 2481 - 2490. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hammerschmidt and D. Wedlich Regulated adhesion as a driving force of gastrulation movements Development, November 15, 2008; 135(22): 3625 - 3641. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Smith, H. A. Hager, R. Francis, D. M. Kilkenny, C. W. Lo, and D. M. Bader Bves directly interacts with GEFT, and controls cell shape and movement through regulation of Rac1/Cdc42 activity PNAS, June 17, 2008; 105(24): 8298 - 8303. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Efimov, N. Schiefermeier, I. Grigoriev, M. C. Brown, C. E. Turner, J. V. Small, and I. Kaverina Paxillin-dependent stimulation of microtubule catastrophes at focal adhesion sites J. Cell Sci., January 15, 2008; 121(2): 196 - 204. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E Fiedler, M. Bajpai, and D. W Carr Identification and Characterization of RHOA-Interacting Proteins in Bovine Spermatozoa Biol Reprod, January 1, 2008; 78(1): 184 - 192. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. H. Steinmetz, F. Zelada-Gonzales, C. Burgtorf, J. Wittbrodt, and D. Arendt Polychaete trunk neuroectoderm converges and extends by mediolateral cell intercalation PNAS, February 20, 2007; 104(8): 2727 - 2732. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Kolsch, T. Seher, G. J. Fernandez-Ballester, L. Serrano, and M. Leptin Control of Drosophila Gastrulation by Apical Localization of Adherens Junctions and RhoGEF2 Science, January 19, 2007; 315(5810): 384 - 386. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sato, D. K. Khadka, W. Liu, R. Bharti, L. W. Runnels, I. B. Dawid, and R. Habas Profilin is an effector for Daam1 in non-canonical Wnt signaling and is required for vertebrate gastrulation Development, November 1, 2006; 133(21): 4219 - 4231. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||