|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 October 2005
doi: 10.1242/dev.02058
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Department of Cell Biology, Emory University School of Medicine, 615 Michael Street NE, Atlanta, GA 30322-3030, USA
Author for correspondence (e-mail:
mosesk{at}hhmi.org)
Accepted 24 August 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Egfr, Morphogenetic furrow, Drosophila, eye, Atonal, Photoreceptor
| Introduction |
|---|
|
|
|---|
Patterning in the Drosophila eye imaginal disc begins in the third
larval instar when the morphogenetic furrow begins to move from posterior to
anterior (Ready et al., 1976
).
This furrow produces the spaced array of ommatidia, with a new column made
roughly every two hours (Ready et al.,
1976
; Basler and Hafen,
1989
). The first photoreceptor cell to be specified and to
differentiate is R8 (Ready et al.,
1976
; Tomlinson and Ready,
1987
). R8 later induces the remaining cells of the facet and is
thus also known as the ommatidial founder cell
(Tomlinson, 1988
;
Freeman, 1997
).
Coincident with the process of R8/founder cell specification is the
expression of the proneural basic helix-loop-helix transcription factor
Atonal; in atonal loss-of-function mutants, R8 cells do not form
(Jarman et al., 1993
;
Jarman et al., 1994
;
Jarman et al., 1995
). The
level of Atonal first rises in all cell nuclei, then, deep in the furrow, it
is then lost from some cells to leave spaced groups (the `intermediate
groups'). Finally, Atonal is restricted to the single founder cells, where it
persists for a few columns (Baker et al.,
1996
; Dokucu et al.,
1996
). R8/founder cell specification and spacing involves the
Notch and Hedgehog pathways, through the regulation of atonal
transcription (Cagan and Ready,
1989
; Baker and Zitron,
1995
; Baker et al.,
1996
; Dominguez,
1999
; Suzuki and Saigo,
2000
; White and Jarman,
2000
; Baonza and Freeman,
2001
; Baker,
2004
).
In the developing eye, Egfr signaling is required for late R8 cell
maintenance, the induction of all cells following the R8/founder cell,
proliferation, ommatidial rotation and cell survival
(Freeman, 1994
;
Tio et al., 1994
;
Freeman, 1996
;
Freeman, 1997
;
Tio and Moses, 1997
;
Dominguez et al., 1998
;
Kumar et al., 1998
;
Kurada and White, 1998
;
Halfar et al., 2001
;
Brown and Freeman, 2003
;
Firth and Baker, 2003
;
Kumar et al., 2003
;
Strutt and Strutt, 2003
;
Yang and Baker, 2003
). It has
also been suggested that Egfr signaling has a primary function in the initial
specification and spacing of the Atonal-positive intermediate groups and/or
the R8/founder cells based on four observations: pMAPK is strongly expressed
in the intermediate groups; the gain-of function mutation
EgfrElp has reduced numbers of R8 cells; Ras pathway
signals promote the expression of the Rough transcription factor in the cells
that do not become R8s; and Ras pathway loss-of-function mosaic clones show
reduced precision in the array of R8 cells
(Baker and Rubin, 1989
;
Zak and Shilo, 1992
;
Dokucu et al., 1996
;
Kumar et al., 1998
;
Spencer et al., 1998
;
Baonza et al., 2001
;
Yang and Baker, 2001
;
Yang and Baker, 2003
). Of
these the most direct and elegant evidence is the last (Ras pathway
loss-of-function mosaic clones).
Egfr null clones are very small because of an early proliferation
defect (Xu and Rubin, 1993
).
Thus, we generated a conditional Egfr loss-of-function mutation
(Egfrtsla, a temperature-sensitive allele) and used it to
remove Egfr function at specific times, by-passing the proliferation
defect. We found that while this abolishes pMAPK in the intermediate groups,
it does not affect the establishment or spacing of the Atonal-positive
R8/founder cells (Kumar et al.,
1998
). We also observed that the high-level pMAPK antigen in the
intermediate groups is predominantly cytoplasmic and proposed that there is a
block to pMAPK nuclear translocation (`MAPK cytoplasmic hold')
(Kumar et al., 1998
;
Kumar et al., 2003
).
A second approach to overcome the proliferation defect was to use the
Minute technique to give Egfr null cells a growth advantage
(Baonza et al., 2001
;
Yang and Baker, 2001
). In
these clones, the single Atonal-positive cells are irregularly arranged rather
than accurately spaced. This observation was made independently by two groups
and led to the conclusion that Egfr signaling has a primary role in ommatidial
spacing (Baonza et al., 2001
;
Yang and Baker, 2001
).
How may these two views be reconciled? If Egfr signals do not regulate R8
spacing, then the pMAPK pattern may be explained by cytoplasmic hold, the
EgfrElp phenotype may be an indirect consequence of a
gain-of-function mutation, and the regulation of Rough expression in the
non-R8 cells could be through a direct Egfr function in these cells, not due
to any Egfr function in the R8s [indeed, a rough null has
normal early ommatidial development
(Tomlinson et al., 1988
)].
However, if Egfr signals do regulate R8 cell spacing then the pMAPK pattern
may be explained by a direct function, the EgfrElp
phenotype may be due to over-inhibition of R8 cell formation and Rough
expression in the non-R8 cells may be a direct result of Egfr signaling.
The two apparently direct loss-of-function experiments give different results: Egfrtsla temperature shift versus Egfr-null Minute mosaics. We have now re-examined these two experiments and have tested them for four possible flaws. (1) The Egfrtsla protein could be temperature-sensitive only during synthesis, so that after temperature shift the previously synthesized protein remains active and provides sufficient function for normal R8 patterning (a form of perdurance). (2) The Egfrtsla mutation might not be null at the restrictive temperature, and residual function could support normal R8 patterning. (3) At the time of the temperature shift, the furrow in Egfrtsla eyes might arrest, freezing the Atonal pattern so that it appears to be wild type. (4) Minute+ clones may have non-cell autonomous effects on Atonal patterning.
Here, we report the characterization of Egfrtsla, including its mutant lesion, the effects of temperature on its activity and stability, and the relocalization of the protein from the cell surface into the cell. We show by biochemical and genetic means that Egfrtsla is temperature-sensitive for activity and that it is functionally null at the restrictive temperature. We also report that, indeed, the Minute technique artifactually disturbs ommatidial spacing in the Egfr null mosaic experiments. We conclude that Egfr signaling does not normally function in the initial spacing of the R8/founder cells.
| Materials and methods |
|---|
|
|
|---|
Egfrtsla Minute+ clones
y1 w1118 ey:FLP;
P{ry+=neoFRT}42D
P{w+mc=Ubi:GFP.nls}2R1P
{Ubi:GFP.nls}2R2/P{ry+=neoFRT}42D
Egfrtsla.
Egfrf2 Minute+ clones
y1 w1118 ey:FLP;
P{ry+=neoFRT}42D
P{w+mc=Ubi:GFP.nls}2R1P
{Ubi:GFP.nls}2R2/P{ry+=neoFRT}42D
Egfrf2.
Egfrf2 M(2)53 clones
P{ry+t7.2=hsFLP}1 w1118;
P{ry+=neoFRT}42D
Egfrf2/P{ry+t7.2= neoFRT}42D
P{w+mC=arm-lacZ.V}51D M(2)53.
Egfrtsla M(2)53 clones
P{ry+t7.2=hsFLP}1 w1118;
P{ry+=neoFRT}42D
Egfrtsla/P{ry+t7.2= neoFRT}42D
P{w+mC=arm-lacZ.V}51D M(2)53.
Egfrtop-18A M(2)56i clones
P{ry+t7.2=hsFLP}1 w1118;
P{ry+=neoFRT}42D
Egfrtop-18A/P{ry+t7.2= neoFRT}42D
P{w+mC=arm-lacZ.V}51D M(2)56i.
Egfrtsla M(2)56i clones
P{ry+t7.2=hsFLP}1 w1118;
P{ry+=neoFRT}42D
Egfrtsla/P{ry+t7.2= neoFRT}42D
P{w+mC=arm-lacZ.V}51D M(2)56i.
Wild-type M(2)53 clones
P{ry+t7.2=hsFLP}1 w1118;
P{ry+=neoFRT}42D/P{ry+t7.2 =neoFRT}42D
P{w+mC=arm-lacZ.V}51D M(2)53.
Sequencing of Egfrtsla DNA
PCR primer pairs were as follows.
Exon 1, type I: forward primer (fp), ATAGCTTGGAAGAGGGCTTGATTC; reverse primer (rp), TGGGCAGCCAGTCAGTCAGCCAGA.
Exon 1, type II: fp, TTGACTAGGCACCACAACGCCACC; rp, CAATATTTATGTGCCACATTTCAG;
Exon 2: fp1, GGGTCAACCGAAACAACAAAACCCATT; fp2, TGCATCGCCACTAAATCTCGG; rp1, GTACAGGGTATTAGGTCTAGTCCA; rp2, CTTGGGAAATACCACTTTCTT.
Exon 3: fp1, CTACAAATCATTCGCGGACGC; fp2, CCCAAGTGCCACGAGAGCTGC; fp3, CCGCCCATGCGCAAGTACAAT; fp4, GTCCTGCATGCCGGCAACATT; fp5, GGAACCCACCCGCAGTCCCGGAAT; fp6, TGGCCGGCCATTCAGAAGGAG; rp1, GCACTGATCCGAGCAAATGGT; rp2, TCTATTATGCTGGATGACCAC; rp3, GATCTCCTTCACCGTGGAGAA; rp4, GGGGCACGGTCCATTGCAGGG; rp5, CTCCTTGCATACGCCCTCGTC; rp6, ACACTCGCGCTCCGGAGCAGT.
Exon 4: fp1, GAGAAAAATGGAACCATTTGCTCG; fp2, GCACTGATCCGAGCAAATGGT.
Exon 5: fp1, GTCTGCCGAGAGTGCCACGCC; fp2, GAACAGGTGTGCTCCAAGTGC; fp3, GCCATTGGACCCTACTGTGCA; fp4, GCCAATCTATGCAAGTTGCGC; fp5, GTGCGAAATAACCGGGACAAG; fp6, GCACTGGAGTGCATTCGCAAT; fp7, TGGCACTTGGATGCCGCCATG; fp8, ACCGACTGCACGGATGAGATA; fp9, AATATGGCAGCTGTGGGCGTG; rp1, GACTCCCATCACCGGTATCCCGAT; rp2, CACGCCCACTTCCCGGGCACT; rp3, AATGGCCAGATAGCGACCCGG; rp4, CACACCAAAGGCCCAGACATC; rp5, ACCCTCCGGCACCCAAACGCC; rp6, CACCAGAACAGCACCAGTGATGTGATCGGCCGGACACTCGGT.
Sequencing was done at the University of Iowa facility.
Antibodies and histochemistry
Two rabbits were injected with an Egfr C-terminal peptide
[(C)QRELQPLHRNRNTETR] (Lesokhin et al.,
1999
), coupled to keyhole limpet hemocyanin. Sera were affinity
purified (by Zymed). For imaging, S2 cells were cultured on cover slips after
transfection and prepared as previously described
(Lee et al., 2001
). Eye discs
(except those used for the anti-Egfr stains) were prepared as previously
described (Tomlinson and Ready,
1987
), modified as described by Tio and Moses
(Tio and Moses, 1997
), mounted
in Vectashield (Vector Labs, H-1000) and imaged by confocal microscopy. For
Egfr staining, the fix was 4% paraformaldehyde in PBS for 30 minutes at room
temperature; eye discs were then washed and blocked as above, then incubated
with primary antibody overnight at room temperature
(Moberg et al., 2004
). Primary
antibodies: rabbit anti-Egfr [1:3000 for blots, gift of N. Baker
(Lesokhin et al., 1999
)],
rabbit anti-Egfr (1:100 for immunoprecipitation, 1:500 for
immunohistochemistry), rat anti-Spitz [1:20
(Schweitzer et al., 1995
)],
mouse anti pTyr (PY20, 1:500, Santa Cruz Biotechnology SC-508), mouse
anti-pMAPK [1:5000 for blots, 1:500 for immunohistochemistry, Sigma M-8159
(Gabay et al., 1997
)], rabbit
anti-MAPK (anti-ERK, 1:1000, Cell Signaling Technologies 9102), rabbit
anti-Ato [1:1000 (Jarman et al.,
1993
)], rat anti-Elav [1:500, 7E8A10 from DSHB
(O'Neill et al., 1994
)],
guinea-pig anti-Senseless [1:1000, gift of G. Mardon
(Nolo et al., 2000
)], mouse
anti-ß-gal (1:1000, Promega 23783), guinea-pig anti-Hrs [1:100, gift from
Ursula Weber (Lloyd et al.,
2002
)], mouse anti-Armadillo [1:10, DSHB N2 7A1
(Riggleman et al., 1990
)].
Secondary antibodies were mainly from Jackson ImmunoResearch: goat anti-mouse
Cy5 (1:500, 115-175-003), goat anti-rabbit TRITC (1:250, 111-025-003), goat
anti-rat Cy5 (1:200, 112-175-003), goat anti-mouse HRP (1:40, 115-035-003),
goat anti-guinea pig TRITC, (1:150, 106-025-003). Goat anti-rabbit-HRP
(1:8,000, 65-6120) was from Zymed. Syto-24 was used to stain DNA (1:10,000,
Molecular Probes S-7559).
Tissue culture
The Egfr+ plasmid pMtEgfrType I was a gift of N. Baker
(Lesokhin et al., 1999
). The
Egfrtsla plasmid pMtEgfrtslaType I was derived
from pMtEgfrType I using a Stratagene `QuickChange' Site-Directed Mutagenesis
Kit. The secreted Spitz plasmid is pMTsSpitz, a gift of B.-Z. Shilo
(Schweitzer et al., 1995
).
Schneider line 2 (S2) cells were maintained in Drosophila Schneider's
medium (Invitrogen 11720-034) with 10% heat-inactivated Fetal Bovine Serum at
25°C. Transfections were performed with Cellfectin (Invitrogen 10362-010)
in serum-free medium for 4 hours 25°C. DNA concentrations used for
transfections were: 2-3 µg/ml for wild-type and mutant Egfr
plasmids, or 12 µg/ml for pMtsSpitz. Egfr transfections were
incubated at 18°C for 15-16 hours in serum + medium, then for 24 hours in
serum-free medium with 100 µM CuSO4. Fresh medium containing 10
µg/ml cycloheximide (CHX) was added and the cells were then treated as
described in the text. We tested cycloheximide between 0 and 100 µg/ml, as
assayed by 35S-methionine incorporation (data not shown). Spitz transfections
were incubated at 25°C, following the same protocol except for the use of
0.7 mM CuSO4. Spitz supernatants were validated by immunoblot (data
not shown). Cells were lysed with RIPA buffer as described previously
(Schweitzer et al., 1995
). Gel
blots were performed by standard protocols (BioRad). Immunoprecipitation was
performed as previously described
(Schweitzer et al., 1995
).
For surface biotinylation, the transfections and temperature shifts were as
above, the cells were then incubated with 0.5 mg/ml EZ-LinkTM
sulfo-NHS-Biotin (Pierce, 21217) at 4°C for 30 minutes and the extract was
precipitated with streptavidin beads (Pierce 2349) as described previously
(Salazar and Gonzalez, 2002
).
Quantification was by the following steps. (1) Densitometry from non-saturated
films to measure total band intensities (integrated over a standard area) for
Egfr antigen from the untransfected control cells and from those transfected
for Egfr+ and Egfrtsla, and for pMAPK.
(2) Track background (measured below each band) was subtracted from each total
band density. (3) The untransfected control value was subtracted from each
experimental transfection (Egfr+ and
Egfrtsla). (4) The pMAPK value was divided by the Egfr
antigen value (for each track) to give the activity per receptor. (5) Values
were standardized to make the activity of Egfr+ at 30°C 100;
all other values are percentages of wild type. (6) Three replicates were used
for the mean and the standard error of the mean.
| Results |
|---|
|
|
|---|
Egfrtsla protein is thermo-labile for activity
To determine if the Egfrtsla protein is temperature sensitive
only during its synthesis or for its activity, we developed a tissue culture
assay system using Drosophila Schneider line 2 cells (S2 cells)
[Fig. 1A, assay adapted from
Schweitzer et al. and Lesokhin et al.
(Schweitzer et al., 1995
;
Lesokhin et al., 1999
)]. These
cells express low levels of endogenous Egfr, so all of the experiments were
done in parallel with untransfected controls. We transfected cells to express
additional Egfr+ or Egfrtsla at 18°C (the permissive
temperature). One day later, we shifted the cells to 30°C and added
cycloheximide to inhibit new protein synthesis. One hour later, we added
conditioned media containing Spitz and harvested the cells at different time
points. The levels of Egfr+ antigen remained fairly constant after
60 minutes with cycloheximide, suggesting that the wild-type protein has a
much longer half-life than one hour under these conditions;
Egfrtsla antigen was also detectable, although less so than wild
type (Fig. 1B). In this assay,
Egfr+ drives a ligand-dependent, high level of pMAPK within 5
minutes (asterisk in Fig. 1C),
whereas Egfrtsla does not.
As a second test for receptor activity we measured autophosphorylation. Again, we transfected S2 cells at 18°C for Egfr+ or Egfrtsla expression. The cells were grown at either 18°C or 30°C for one hour and then treated with ligand (Fig. 1D). We assayed anti-Egfr immunoprecipitates for phospho-Tyrosine (Fig. 1E,F). We detected phosphorylated Egfr for both Egfr+ and Egfrtsla at 18°C, but only for Egfr+ at 30°C (white asterisks). Egfr antigen was detected under all conditions (Fig. 1G,H); however, we detected reduced levels of Egfrtsla at 30°C, perhaps through instability (see below).
We previously reported that Egfrtsla mutants loose
pathway activity within 30 minutes at 29°C in vivo
(Kumar et al., 1998
). We
therefore determined whether Egfrtsla becomes inactive in this
system in a similar time frame after temperature shift. S2 cells were treated
as described above, shifted to 30°C (for 0, 15, 30 or 60 minutes,
Fig. 2A) and then treated with
ligand. We detected reduced levels of Egfrtsla antigen after the
temperature shift. We always detected robust levels of MAPK phosphorylation
driven by both Egfr+ and Egfrtsla at 18°C. However,
Egfrtsla lost this activity within 15 minutes at 30°C in all
experiments (Fig. 2B-D).
|
Egfrtsla activity at the restrictive temperature is not detectably different to zero
We quantified the experiments in Fig.
2, at the 0- and 60-minute time points. Each condition was
repeated in triplicate and two such experiments were quantified per receptor
at 30°C (see Materials and methods and
Fig. 3). From the two
experiments, we conclude that the activity of Egfrtsla is wild type
at 18°C but that at 30°C its activity is very low, and is
indistinguishable from no activity at all.
Furthermore, we directly visualized the activity of Egfr in individual cells by immunofluorescence (Fig. 4). We examined cells at the 60-minute time point, as above (Fig. 2A). Untransfected cells show low background levels of Egfr antigen (Fig. 4A,D) and a low level of pMAPK antigen (Fig. 4B,D). Transfected cells express elevated levels of Egfr antigen (Fig. 4E-P). Cells that express additional Egfr+ at 30°C (white arrowheads in Fig. 4E-H) and 18°C (not shown), and Egfrtsla at 18°C (Fig. 4I-L), drive increased levels of nuclear pMAPK antigen (arrows in Fig. 4F,H,J,L), but cells expressing Egfrtsla at 30°C do not (Fig. 4N,P).
|
|
|
Egfrtsla antigen is rapidly removed from the cell surface after a shift to 30°C
We detected reduced levels of Egfr antigen in cells transfected with
Egfrtsla at 30°C (see above). It could be that after
temperature shift, the Egfrtsla protein is removed from the cell
surface and targeted for degradation. To study this, we labeled transfected S2
cells with a non-membrane permeable biotinylation reagent to separate
superficial from intracellular Egfr (Fig.
5A). We compared biotinylated Egfr antigen (see asterisk in
Fig. 5B) to total Egfr antigen
(see asterisk in Fig. 5C). We
detected biotinylated Egfr at all time points from cells transfected with
Egfr+. Biotinylated Egfrtsla is also seen at
18°C, but is rapidly lost so that none is detectable after 60 minutes at
30°C (Fig. 5B), and a low
level of total antigen remains (Fig.
5C). These results strongly suggest that Egfrtsla
protein undergoes a ligand-independent conformational change at 30°C,
leading to rapid internalization.
To investigate this relocalization in vivo, we raised a new anti-Egfr serum
[to the same C-terminal peptide as previously reported
(Lesokhin et al., 1999
)]. We
tested it for specificity by staining eye imaginal disc
Egfrf2 homozygous clones (data not shown). We stained
wild-type eye discs and saw an Egfr expression pattern as has been previously
described (data not shown) (Lesokhin et
al., 1999
). We see the wild-type pattern in
Egfrtsla homozygous retinal clones raised at 18°C
(Fig. 6A,B). In the furrow, we
observed antigen concentrated in a subset of the Armadillo-positive cell
junctions and the first two columns of ommatidial preclusters (see white
arrrowhead in Fig. 6B)
(Takahashi et al., 1996
;
Ahmed et al., 1998
). This
junctional stain occurs around all sides of the cells deep in the furrow (see
white arrrowhead in Fig. 6B), but, at the edges of the furrow, it becomes lost from the faces of the cells
that lie away from the furrow. The junctions between the cells within the
precluster are heavily stained (see white arrrowhead in
Fig. 6B, inset); however, the
junctions between the precluster cells and the surrounding cells are not (see
black arrrowhead in Fig. 6B,
inset). We also saw numerous cytoplasmic granules in the assembling ommatidia
(see arrows in Fig. 6A,B).
|
|
|
Egfrtsla is null by genetic criteria
Egfr null mosaic clones are small
(Xu and Rubin, 1993
), so we
compared the sizes of Egfrtsla clones to Egfr
null clones. We used ey:Flp to induce
Egfrtsla clones and raised the animals
continuously at 18°C (Fig.
7A), at 18°C and then at 30°C for their last day
(Fig. 7B), or continuously at
30°C (Fig. 7C). The total
area of the Egfrtsla clone territory was roughly equal in
size to the total area of wild-type twin-spots when raised continuously at
18°C and after one day at 30°C (although they are reduced towards the
posterior side). However, the clones are very much smaller after continuous
growth at 30°C. Likewise, Egfr homozygous null clones made
without Minute mutations are very small and are similar to
Egfrtsla homozygous clones after continuous growth at
30°C (compare Fig. 7C and
7D).
Egfr is required for late ommatidial development, so we stained
Egfrtsla clones (raised at 30°C for 24 hours) for a
late R8 marker, Senseless (Fig.
7E,F) (Frankfort et al.,
2001
), and a neural marker, Elav
(Fig. 7G,H)
(Robinow and White, 1991
). As
previously reported (Dominguez et al.,
1998
; Kumar et al.,
1998
; Spencer et al.,
1998
; Baonza et al.,
2001
; Yang and Baker,
2001
), we find that R8 cells do form, although at later stages
they are sometimes abnormally close (Fig.
7E,F). Elav expression is lost from the non-R8 photoreceptors
(Fig. 7G,H) and also from most
of the R8s, because of a late maintenance requirement
(Kumar et al., 1998
).
Thus, by these proliferation and differentiation defects, Egfrtsla (at the restrictive temperature) is indistinguishable from nulls.
Egfrtsla does not affect the rate of furrow progression
Thus far, we have tested for the first two of the four possible artifacts
defined above: Egfrtsla is temperature sensitive for activity
(there is no perdurance of activity), and it is biochemically and genetically
indistinguishable from a null. The third possible artifact was that the normal
Atonal expression pattern in temperature-shifted Egfrtsla
eye discs might result from a rapid arrest of furrow movement with no further
change in the Atonal pattern. To test this, we stained
Egfrtsla homozygous clones that were raised at 18°C
and held at 30°C for 24 hours for Atonal. In this experiment, the
Egfrtsla territories abut Egfr+ twin
spots. If the loss of Egfr function causes the furrow to arrest with `frozen'
Atonal expression, we would see the furrow about twelve columns more advanced
in the wild-type tissue than in the mutant clones. As before
(Kumar et al., 1998
), we saw
normal Atonal expression in this mutant tissue. We also saw that the position
of the furrow was equally advanced in the mutant clones and in the wild-type
twin spots (Fig. 8A-C). Thus,
we conclude that Egfr does not regulate the rate of furrow progression. We
also confirm again that Egfrtsla has no effect on
R8/founder cell initial spacing, neither with a 24-hour shift
(Fig. 8A-C), nor when raised
continuously at the non-permissive temperature
(Fig. 8D-F).
Two different Minute mutations in mosaic clones have dominant and non-cell autonomous effects on Atonal expression
Having investigated the possible artifacts of the
Egfrtsla studies, we turned to the fourth possibility:
some artifact in the Egfr null Minute mosaic experiments. It
could be that the Egfr mutations used in these experiments have some
dominant effects on Atonal expression under these conditions (24 hours at
30°C). Therefore, we stained eye discs heterozygous for three
Egfr alleles in trans to wild type (Egfrtsla,
Egfrf2 and Egfrtop-18A,
Fig. 9A-C), and we found that
there was some variation in the Atonal antigen staining intensity in different
specimens, but that this does not correlate with the three Egfr
genotypes. In all three cases, Atonal expression was normal.
|
Furthermore, we find that the pattern of Atonal expression is different to that of wild type, both within the Egfr homozygous mutant territories and outside of them (in the Egfr Minute heterozygous cells). These abnormalities include the occasional twinning of Atonal-positive cells (Fig. 9E,F), reduced differentiation of the intermediate groups (all four cases) and reduced Atonal expression in some cases (arrows in Fig. 9K,L,N,O). Taken together, these data suggest that some factor in both Minute experiments causes dominant and non-cell autonomous defects in the pattern of Atonal expression and R8/founder cell/ommatidial spacing.
How could the use of the Minute mutations produce these effects?
The simplest possibility is that Minute(2)53 and
Minute(2)56i have a dominant effect on Atonal patterning on their
own. Indeed, as well as affecting body size, developmental time and bristle
morphology, some Minute mutants are reported to have dominant rough
eye phenotypes (Plough and Ives,
1934
; Dunn and Mossige,
1937
; Brehme,
1939
; Kalisch and Rasmuson,
1974
; Sinclair et al.,
1981
). However, neither Minute(2)53 nor
Minute(2)56i show a dominant rough eye phenotype. Furthermore, we
stained the heterozygous stocks for Atonal expression and saw no defects (data
not shown). Thus, the Atonal defects are not due to a simple dominant effect
of the Minute mutations.
It could be that the phenotype is due to a dominant synthetic interaction between the Minute mutations and Egfr. Again, this is not probable, as the Egfr mutant clones are Minute+ after the somatic recombination. We stained animals that were Egfr mutant in trans to the two Minute mutations (without inducing clones) for Atonal expression and again saw no defects (data not shown). Thus, the Atonal defects are not due to a dominant synthetic interaction between the Minute mutations and Egfr.
It may be that cell competition effects between the
Minute+ and Minute heterozygous territories
produce the Atonal patterning defects. Such competition effects have been
reported in other Minute experiments
(de la Cova et al., 2004
).
Another possibility is that the dying Minute cells
release developmental signals that affect retinal patterning in the
surrounding tissues. Indeed, it has been reported that dying cells release
both Wingless and Dpp (Perez-Garijo et
al., 2004
; Ryoo et al.,
2004
). If either of these possibilities is true, then we would
expect to see defects in the Atonal expression pattern when clones are induced
from Minute heterozygous flies, even without any Egfr
mutation present in trans. In other words, fully wild-type clones adjacent to
Minute heterozygous territories would have Atonal defects similar to
those seen in the Egfr mutant clone-containing discs. We stained such
wild-type clones for Atonal expression, and do indeed see just such defects,
both within and outside of the clones (Fig.
9P-R). We observed a total of fifteen such clones in the Atonal
expression domain, taken from five imaginal discs. Indeed, the Atonal pattern
in these Minute (alone) clones is indistinguishable from that in
clones for the same Minute with Egfr (compare
Fig. 9Q to 9E,H).
Our data suggest that the Atonal patterning defects seen in mosaic clone experiments, when the Minute technique is used, may be due to a genetic effect of the Minute, and not of the Egfr, mutation.
| Discussion |
|---|
|
|
|---|
|
Next, we turned to the possible problems associated with the
Minute+ mosaic method used to make the same observations
with the Egfr nulls (Baonza et
al., 2001
; Yang and Baker,
2001
). We replicated the Minute+ Egfr null
experiments exactly as previously reported, using the same Drosophila
stocks, except to run them at 30°C. In parallel, we did the same
experiments with Egfrtsla. If the known Egfr
nulls were to have a different phenotype to Egfrtsla, we
would be forced to conclude that Egfrtsla is not behaving
as a null in this assay. If, however, the two Egfr nulls have the
same phenotype in this assay as Egfrtsla does, then we
could conclude that the temperature-sensitive allele is indistinguishable from
the nulls at 30°C, and that the difference is due to the Minute
technique and not to Egfr. Indeed, we did find that the
Egfrtsla and Egfr null phenotypes are
indistinguishable, and thus we conclude that the Egfrtsla
phenotypes assayed without the Minute technique are valid and that
the discrepancy stems from some aspect of the use of the Minute
mutations. We went on to stain Minute clones made without any
Egfr mutation present and obtained the very same Atonal expression
defects. Taken together, these data suggest that the spacing defects
previously reported by others, and replicated by us here, are genetically
dependent on the presence of the Minute clones, and are not an affect
of the Egfr mutations.
Therefore, we conclude that Egfr has no primary role in R8/founder cell spacing and also that Egfrtsla is a rapidly acting temperature-sensitive mutation that is functionally null at the non-permissive temperature.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Ahmed, Y., Hayashi, S., Levine, A. and Wieschaus, E.
(1998). Regulation of Armadillo by a Drosophila APC
inhibits neuronal apoptosis during retinal development.
Cell 93,1171
-1182.[CrossRef][Medline]
Baker, N. E. (2004). Atonal points the
way-protein-protein interactions and developmental biology. Dev.
Cell 7,632
-634.[CrossRef][Medline]
Baker, N. E. and Rubin, G. M. (1989). Effect on
eye development of dominant mutations in Drosophila homologue of the
EGF receptor. Nature
340,150
-153.[CrossRef][Medline]
Baker, N. E. and Zitron, A. E. (1995).
Drosophila eye development: Notch and Delta amplify
a neurogenic pattern conferred on the morphogenetic furrow by scabrous.Mech. Dev. 49,173
-189.[CrossRef][Medline]
Baker, N. E., Yu, S. and Han, D. (1996).
Evolution of proneural atonal expression during distinct regulatory
phases in the developing Drosophila eye. Curr.
Biol. 6,1290
-1301.[CrossRef][Medline]
Baonza, A. and Freeman, M. (2001). Notch
signalling and the initiation of neural development in the Drosophila
eye. Development 128,3889
-3898.
Baonza, A., Casci, T. and Freeman, M. (2001). A
primary role for the epidermal growth factor receptor in ommatidial spacing in
the Drosophila eye. Curr. Biol.
11,396
-404.[CrossRef][Medline]
Basler, K. and Hafen, E. (1989). Dynamics of
Drosophila eye development and temporal requirements of
sevenless expression. Development
107,723
-731.
Bogdan, S. and Klambt, C. (2001). Epidermal
growth factor receptor signaling. Curr. Biol.
11,R292
-R295.[CrossRef][Medline]
Brehme, K. S. (1939). A study of the effect on
development of "Minute" mutations in Drosophila
melanogaster. Genetics 24,131
-161.
Brown, K. E. and Freeman, M. (2003). Egfr
signalling defines a protective function for ommatidial orientation in the
Drosophila eye. Development
130,5401
-5412.
Brunner, D., Ducker, K., Oellers, N., Hafen, E., Scholz, H. and
Klambt, C. (1994). The ETS domain protein pointed-P2 is a
target of MAP kinase in the sevenless signal transduction pathway.
Nature 370,386
-389.[CrossRef][Medline]
Burgess, A. W., Cho, H. S., Eigenbrot, C., Ferguson, K. M.,
Garrett, T. P., Leahy, D. J., Lemmon, M. A., Sliwkowski, M. X., Ward,
C. W. and Yokoyama, S. (2003). An open-and-shut case?
Recent insights into the activation of EGF/ErbB receptors. Mol.
Cell 12,541
-552.[CrossRef][Medline]
Burke, P., Schooler, K. and Wiley, H. S.
(2001). Regulation of epidermal growth factor receptor signaling
by endocytosis and intracellular trafficking. Mol. Biol.
Cell 12,1897
-1910.
Cagan, R. L. and Ready, D. F. (1989).
Notch is required for successive cell decisions in the developing
Drosophila retina. Genes Dev.
3,1099
-1112.
Carpenter, G. (2000). The EGF receptor: a nexus
for trafficking and signaling. BioEssays
22,697
-707.[CrossRef][Medline]
Clifford, R. and Schüpbach, T. (1994).
Molecular analysis of the Drosophila EGF receptor homolog reveals
that several genetically defined classes of alleles cluster in subdomains of
the receptor protein. Genetics
137,531
-550.[Abstract]
de la Cova, C., Abril, M., Bellosta, P., Gallant, P. and
Johnston, L. A. (2004). Drosophila myc regulates
organ size by inducing cell competition. Cell
117,107
-116.[CrossRef][Medline]
Dokucu, M. E., Zipursky, L. S. and Cagan, R. L.
(1996). Atonal, Rough and the resolution of proneural clusters in
the developing Drosophila retina. Development
122,4139
-4147.[Abstract]
Dominguez, M. (1999). Dual role for Hedgehog in
the regulation of the proneural gene atonal during ommatidia
development. Development
126,2345
-2353.[Abstract]
Dominguez, M., Wasserman, J. D. and Freeman, M.
(1998). Multiple functions for the EGF receptor in
Drosophila eye development. Curr. Biol.
8,1039
-1048.[CrossRef][Medline]
Dunn, L. C. and Mossige, J. C. (1937). The
effects of the Minute mutations of Drosophila melanogaster
on developmental rate. Hereditas
23, 70-90.
Firth, L. C. and Baker, N. E. (2003). EGF
receptor signaling: a prickly proposition. Curr. Biol.
13,R773
-R774.[CrossRef][Medline]
Frankfort, B. J., Nolo, R., Zhang, Z., Bellen, H. and Mardon,
G. (2001). senseless Repression of rough Is
Required for R8 Photoreceptor Differentiation in the Developing
Drosophila Eye. Neuron
32,403
-414.[CrossRef][Medline]
Freeman, M. (1994). The spitz gene is
required for photoreceptor determination in the Drosophila eye where
it interacts with the EGF receptor. Mech. Dev.
48, 25-33.[CrossRef][Medline]
Freeman, M. (1996). Reiterative use of the EGF
receptor triggers differentiation of all cell types in the Drosophila
eye. Cell 87,651
-660.[CrossRef][Medline]
Freeman, M. (1997). Cell determination
strategies in the Drosophila eye. Development
124,261
-270.[Abstract]
Freeman, M. (2002). A fly's eye view of EGF
receptor signalling. EMBO J.
21,6635
-6642.[CrossRef][Medline]
Gabay, L., Seger, R. and Shilo, B.-Z. (1997).
In situ activation pattern of Drosophila EGF receptor pathway during
development. Science
277,1103
-1106.
Halfar, K., Rommel, C., Stocker, H. and Hafen, E.
(2001). Ras controls growth, survival and differentiation in the
Drosophila eye by different thresholds of MAP kinase activity.
Development 128,1687
-1696.[Abstract]
Jarman, A. P., Grau, Y., Jan, L. Y. and Jan, Y. N.
(1993). atonal is a proneural gene that directs
chordotonal organ formation in the Drosophila peripheral nervous
system. Cell 73,1307
-1321.[CrossRef][Medline]
Jarman, A. P., Grell, E. H., Ackerman, L., Jan, L. Y. and Jan,
Y. N. (1994). Atonal is the proneural gene for
Drosophila photoreceptors. Nature
369,398
-400.[CrossRef][Medline]
Jarman, A. P., Sun, Y., Jan, L. Y. and Jan, Y. N.
(1995). Role of the proneural gene, atonal, in formation
of the Drosophila chordotonal organs and photoreceptors.
Development 121,2019
-2030.[Abstract]
Kalisch, W. E. and Rasmuson, B. (1974). Changes
of zeste phenotype induced by autosomal mutations in Drosophila
melanogaster. Hereditas 78,97
-104.[Medline]
Kumar, J. P., Tio, M., Hsiung, F., Akopyan, S., Gabay, L.,
Seger, R., Shilo, B.-Z. and Moses, K. (1998).
Dissecting the roles of the Drosophila EGF receptor in eye
development and MAP kinase activation. Development
125,3875
-3885.[Abstract]
Kumar, J. P., Hsiung, F., Powers, M. and Moses, K.
(2003). Nuclear translocation of activated MAP kinase is
developmentally regulated in the developing Drosophila eye.
Development 130,3703
-3714.
Kurada, P. and White, K. (1998). Ras promotes
cell survival in Drosophila by downregulating hid
expression. Cell 95,319
-329.[CrossRef][Medline]
Lee, J. R., Urban, S., Garvey, C. F. and Freeman, M.
(2001). Regulated intracellular ligand transport and proteolysis
control EGF signal activation in Drosophila. Cell
107,161
-171.[CrossRef][Medline]
Lesokhin, A. M., Yu, S. Y., Katz, J. and Baker, N. E.
(1999). Several levels of EGF receptor signaling during
photoreceptor specification in wild-type, Ellipse, and null mutant
Drosophila. Dev. Biol.
205,129
-144.[CrossRef][Medline]
Lloyd, T. E., Atkinson, R., Wu, M. N., Zhou, Y., Pennetta, G.
and Bellen, H. J. (2002). Hrs regulates endosome membrane
invagination and tyrosine kinase receptor signaling in Drosophila.Cell 108,261
-269.[CrossRef][Medline]
Marshall, C. J. (1994). MAP kinase kinase
kinase, MAP kinase kinase and MAP kinase. Curr. Opin. Genet.
Dev. 4,82
-89.[CrossRef][Medline]
Moberg, K. H., Mukherjee, A., Veraksa, A., Artavanis-Tsakonas,
S. and Hariharan, I. K. (2004). The
Drosophila F box protein Archipelago regulates dMyc protein levels in
vivo. Curr. Biol. 14,965
-974.[CrossRef][Medline]
Nolo, R., Abbott, L. A. and Bellen, H. J.
(2000). Senseless, a Zn finger transcription factor, is necessary
and sufficient for sensory organ development in Drosophila.Cell 102,349
-362.[CrossRef][Medline]
O'Neill, E. M., Rebay, I., Tjian, R. and Rubin, G. M.
(1994). The activities of two Ets-related transcription factors
required for Drosophila eye development are modulated by the Ras/MAPK
pathway. Cell 78,137
-147.[CrossRef][Medline]
Perez-Garijo, A., Martin, F. A. and Morata, G.
(2004). Caspase inhibition during apoptosis causes abnormal
signalling and developmental aberrations in Drosophila.Development 131,5591
-5598.
Plough, H. H. and Ives, P. T. (1934). New
mutants report. Dros. Inf. Serv.
1, 31-34.
Ready, D. F., Hanson, T. E. and Benzer, S.
(1976). Development of the Drosophila retina, a
neurocrystalline lattice. Dev. Biol.
53,217
-240.[CrossRef][Medline]
Riggleman, B., Schedl, P. and Wieschaus, E.
(1990). Spatial expression of the Drosophila segment
polarity gene armadillo is posttranscriptionally regulated by
wingless. Cell 63,549
-560.[CrossRef][Medline]
Robinow, S. and White, K. (1991).
Characterization and spatial distribution of the ELAV protein during
Drosophila melanogaster development. J.
Neurobiol. 22,443
-461.[CrossRef][Medline]
Ryoo, H. D., Gorenc, T. and Steller, H. (2004).
Apoptotic cells can induce compensatory cell proliferation through the JNK and
the Wingless signaling pathways. Dev. Cell
7, 491-501.[CrossRef][Medline]
Salazar, G. and Gonzalez, A. (2002). Novel
mechanism for regulation of epidermal growth factor receptor endocytosis
revealed by protein kinase A inhibition. Mol. Biol.
Cell 13,1677
-1693.
Schweitzer, R., Shaharabany, M., Seger, R. and Shilo, B.-Z.
(1995). Secreted Spitz triggers the DER signaling pathway and is
a limiting component in embryonic ventral ectoderm determination.
Genes Dev. 9,1518
-1529.
Shilo, B. Z. (2003). Signaling by the
Drosophila epidermal growth factor receptor pathway during
development. Exp. Cell Res.
284,140
-149.[CrossRef][Medline]
Sinclair, D. A., Suzuki, D. T. and Grigliatti, T. A.
(1981). Genetic and developmental analysis of a
temperature-sensitive Minute mutation of Drosophila melanogaster.Genetics 97,581
-606.
Spencer, S. A., Powell, P. A., Miller, D. T. and Cagan, R.
L. (1998). Regulation of EGF receptor signaling establishes
pattern across the developing Drosophila retina.
Development 125,4777
-4790.[Abstract]
Strutt, H. and Strutt, D. (2003). EGF signaling
and ommatidial rotation in the Drosophila eye. Curr.
Biol. 13,1451
-1457.[CrossRef][Medline]
Suzuki, T. and Saigo, K. (2000).
Transcriptional regulation of atonal required for Drosophila
larval eye development by concerted action of eyes absent, sine
oculis and hedgehog signaling independent of fused
kinase and cubitus interruptus. Development
127,1531
-1540.[Abstract]
Takahashi, F., Endo, S., Kojima, T. and Saigo, K.
(1996). Regulation of cell-cell contacts in developing
Drosophila eyes by Dsrc41, a new, close relative of vertebrate c-src.
Genes Dev. 10,1645
-1656.
Thomas, B. J., Gunning, D. A., Cho, J. and Zipursky, S. L.
(1994). Cell cycle progression in the developing
Drosophila eye: roughex encodes a novel protein required for
the establishment of G1. Cell
77,1003
-1014.[CrossRef][Medline]
Tio, M. and Moses, K. (1997). The
Drosophila TGF
homolog Spitz acts in photoreceptor recruitment
in the developing retina. Development
124,343
-351.[Abstract]
Tio, M., Ma, C. and Moses, K. (1994).
spitz, a Drosophila homolog of transforming growth
factor-
, is required in the founding photoreceptor cells of the
compound eye facets. Mech. Dev.
48, 13-23.[CrossRef][Medline]
Tomlinson, A. (1988). Cellular interactions in
the developing Drosophila eye. Development
104,183
-193.[Medline]
Tomlinson, A. and Ready, D. F. (1987). Neuronal
differentiation in the Drosophila ommatidium. Dev.
Biol. 120,366
-376.[Medline]
Tomlinson, A., Kimmel, B. E. and Rubin, G. M.
(1988). rough, a Drosophila homeobox gene
required in photoreceptors R2 and R5 for inductive interactions in the
developing eye. Cell 55,771
-784.[CrossRef][Medline]
Treisman, R. (1996). Regulation of
transcription by MAP kinase cascades. Curr. Opin. Cell.
Biol. 8,205
-215.[CrossRef][Medline]
Voas, M. G. and Rebay, I. (2004). Signal
integration during development: Insights from the Drosophila eye.
Dev. Dyn. 229,162
-175.[CrossRef][Medline]
Weber, U., Eroglu, C. and Mlodzik, M. (2003).
Phospholipid membrane composition affects EGF receptor and Notch signaling
through effects on endocytosis during Drosophila development.
Dev. Cell 5,559
-570.[CrossRef][Medline]
White, N. M. and Jarman, A. P. (2000).
Drosophila atonal controls photoreceptor R8-specific properties and
modulates both Receptor Tyrosine Kinase and Hedgehog signalling.
Development 127,1681
-1689.[Abstract]
Wolff, T. and Ready, D. F. (1991). The
beginning of pattern formation in the Drosophila compound eye: the
morphogenetic furrow and the second mitotic wave.
Development 113,841
-850.[Abstract]
Xu, T. and Rubin, G. M. (1993). Analysis of
genetic mosaics in developing and adult Drosophila tissues.
Development 117,1223
-1237.[Abstract]
Yang, L. and Baker, N. E. (2001). Role of the
EGFR/Ras/Raf pathway in specification of photoreceptor cells in the
Drosophila retina. Development
128,1183
-1191.[Abstract]
Yang, L. and Baker, N. E. (2003). Cell cycle
withdrawal, progression, and cell survival regulation by Egfr and its
effectors in the differentiating Drosophila eye. Dev.
Cell 4,359
-369.[CrossRef][Medline]
Zak, N. B. and Shilo, B.-Z. (1992).
Localization of DER and the pattern of cell divisions in wild-type and
Ellipse eye imaginal discs. Dev. Biol.
149,448
-456.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
G. I. Miura, J.-Y. Roignant, M. Wassef, and J. E. Treisman Myopic acts in the endocytic pathway to enhance signaling by the Drosophila EGF receptor Development, June 1, 2008; 135(11): 1913 - 1922. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Vrailas, D. R. Marenda, S. E. Cook, M. A. Powers, J. A. Lorenzen, L. A. Perkins, and K. Moses smoothened and thickveins regulate Moleskin/Importin 7-mediated MAP kinase signaling in the developing Drosophila eye Development, April 15, 2006; 133(8): 1485 - 1494. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||