|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 October 2005
doi: 10.1242/dev.02051
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Molecular and Cellular Biology, Division of Genetics and Development, University of California, Berkeley, CA 94720, USA
* Author for correspondence (e-mail: bandl{at}berkeley.edu)
Accepted 22 August 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Cardiac specification, Migration, Chordate, Mesp
| Introduction |
|---|
|
|
|---|
Mesp is expressed in the emerging heart field of mouse embryos
prior to expression of the core cardiac regulatory genes
(Saga et al., 2000
). There are
two Mesp paralogs, and chimeric cells lacking both (Mesp1
and Mesp2) display cell autonomous defects in heart formation
(Kitajima et al., 2000
).
Ciona contains a single Mesp gene. Morpholino-based
suppression of Mesp function in Ciona savignyi causes a
block in heart cell migration and specification, leading to the formation of
supernumerary tail muscle cells (Satou et
al., 2004
). Despite the central importance of Mesp
function in early chordate heart development, the factors that direct
Mesp expression in the emerging heart field have not been defined
(Haraguchi et al., 2001
).
Furthermore, it remains to be determined whether Mesp functions
primarily as a migration factor, as inferred from vertebrate analyses, or as a
specification factor, as proposed in the Ciona study.
Here, we present evidence that Ciona Mesp is directly activated by
the T-box transcription factor Tbx6c. There are three Tbx6
paralogs in Ciona, Tbx6a, Tbx6b and Tbx6c. Tbx6b and
Tbx6c are activated by the maternal muscle determinant Macho
1, and initiate muscle gene expression
(Yagi et al., 2005
). While
Tbx6b has a predominant role in muscle specification, Tbx6c
independently regulates gene expression in the anterior tail muscle lineage
(Yagi et al., 2005
).
The Mesp enhancer was used to selectively express an activator form of Mesp in the early heart field. Heart cell migration is inhibited, but beating heart tissue nonetheless differentiates at an ectopic location in the anterior tail. These results demonstrate that heart specification and migration can be uncoupled, and implicate Mesp as a crucial cardiac determinant.
| Materials and methods |
|---|
|
|
|---|
Construction of transgenic DNAs
Genomic DNA was isolated from the pooled sperm of 3-4 adults, using the
PureGene DNA Isolation kit (Gentra Systems), and used as a template for
PCR-based isolation of the required genomic fragments. These fragments were
then cloned into either the pCES vector
(Harafuji et al., 2002
) or
modified versions of this vector, as described below.
Mesp reporter constructs
The 5' flanking DNAs from Ci-Mesp and Cs-Mesp were
initially isolated using the following primers [numbers indicate the base-pair
(bp) distance 5' of the EST predicted transcript]:
The use of lowercase letters indicates padding on the primer that is not incorporated into the construct.
These fragments were fused in-frame with lacZ in the pCES vector
using the PCR-generated Xba1 and Not1 sites, replacing the
Ci-forkhead minimal promoter. These constructs were then used as
templates for further 5' deletions using the appropriate forward
primers. Mesp reporter constructs containing
200 bp or less
5' DNA began to drive ectopic expression of lacZ in the tail
muscles and sometimes in the notochord. However, it was determined that this
ectopic expression was due to a vector artefact that was eliminated by
removing an
320 bp fragment of the vector in between the Xba1
site and an EcoO1091 site upstream of the polylinker. In all
subsequent constructs this area of the vector was removed. Single nucleotide
mutations were generated by PCR amplification using primers with appropriately
altered sequences. Mesp-GFP was constructed by replacing the
lacZ-coding region from the Mesp1916-lacZ construct
with the enhanced-GFP (eGFP)-coding region.
Recombinant Mesp, MyoD constructs
The Mesp and MyoD bHLH DNA-binding domains were amplified
from the Mesp EST clone (CiGC13m15) or the MyoD
[Ci-MDF (Meedel et al.,
1997
)] EST clone (GC42d13), respectively, which were obtained from
the Ciona intestinalis Gene Collection Release1
(Satou et al., 2002
), using
the following primers:
They were then sub-cloned using the PCR-generated NheI and
SpeI sites into a modified pCES vector in which the
lacZ-coding region was replaced by a small fragment containing
NheI and SpeI sites. (This vector was generated by using the
primer CCGCGATATTGAGCTAGCGTTTCAACTAGTTGGGAATTCCAGCTGAGCGCCGGTCG along with its
reverse complement.) A VP16 fragment was generated from the Ci-SnaVP16
construct (Fujiwara et al.,
1998
) using the primers VP16f (aaaaCtaGtGCaCCaCCGACCG) and VP16b
(aaaGAATTCCCTACCCACCGTACTCGTCAATTCC). This fragment was then sub-cloned onto
the 3' end of the bHLH domains by using PCR-generated Spe1 and
EcoR1 sites.
Gel shift assays
Binding assays were conducted as described previously
(Fujiwara et al., 1998
).
Labeled and competitor DNAs were prepared by annealing the following
oligonucleotides with their complementary fragments (bold underlined bases
indicate putative T-box binding sites):
The GST-Tbx6c fusion protein was expressed using a partial Tbx6c
cDNA (containing the full T-box DNA-binding domain) obtained from the
Ciona intestinalis Gene Collection Release1
(Satou et al., 2002
)
(CiGC43g03). This coding region was fused into the pGEX-5x-1 expression vector
and purified from bacterial extracts using glutathione agarose beads.
Confocal microscopy
Transgenic embryos with GFP-expressing cells were fixed for 1 hour in 0.3%
formaldehyde in seawater, mounted in Vectashield mounting medium (Vector labs,
CA) and stored at 20°C. Confocal images were obtained on a Leica
TCS SL1 laser scanning confocal microscope. Images were processed using the
BitPlane Imaris 3.3 software package.
| Results |
|---|
|
|
|---|
Tbx6c binds to the Mesp enhancer and participates directly in Mesp activation
In a comprehensive survey of Ciona regulatory genes,
Tbx6c is the only T-box factor specifically expressed in the B7.5
blastomeres prior to Mesp activation
(Imai et al., 2004
). In early
cleavage stages, Tbx6c is expressed in adjoining tail muscle
blastomeres (Takatori et al.,
2004
) (Fig. 2A),
and Mesp-lacZ is transiently expressed in these cells
(Fig. 2B). By the 110-cell
stage, Tbx6c expression has become restricted to the B7.5 blastomeres
(Fig. 2C). At this stage,
Mesp-lacZ staining is initiated in the B7.5 blastomeres and
co-hybridization assays demonstrate the overlapping expression of
Mesp-lacZ and Tbx6c (Fig.
2D). Thus, Mesp-lacZ reporter expression mirrors the
Tbx6c expression pattern. Later, as gastrulation proceeds,
Tbx6c expression expands to include the tail muscle lineages
(Fig. 2E). However,
Mesp expression (and Mesp-lacZ reporter expression) remains
confined to the B7.5 cells as they divide
(Fig. 2F) and invaginate
(Fig. 2G,H).
Gel shift assays confirm specific binding of the Tbx6c protein to
the three T-box sites contained in the minimal Ci-Mesp enhancer
(Fig. 2I). The same single
nucleotide substitutions in the distal Tbx6-binding motif that disrupt
reporter gene expression also inhibit competition by unlabeled
oligonucleotides (Fig. 1F,
Fig. 2I; Ci-B-Mut-1). Alignment
of orthologous sequences upstream of vertebrate Mesp genes reveals an
abundance of conserved putative Tbx6-binding sites
(Fig. 2J, see Discussion).
Although Tbx6c is the best candidate for the endogenous Mesp
activator, it is possible that the Mesp enhancer may also respond to
the more broadly expressed Ciona Tbx6 paralogs, Tbx6a or
Tbx6b. Both genes are expressed in the B7.5 lineages, as well as in
the tail muscle lineages, throughout early embryogenesis
(Fig. 2H)
(Takatori et al., 2004
).
Tbx6c and Tbxb recognize nearly identical consensus
sequences (Yagi et al., 2005
).
Thus, an additional activator may be required to mediate a selective response
to Tbx6c (or to Tbx6b in the B7.5 blastomeres, see
Discussion). Determination of the precise roles of these Tbx6 factors
in Mesp regulation will require further testing.
Mesp-GFP expression visualizes heart cell migration
We employed the Ci-Mesp enhancer fused to GFP for visualization of
embryonic heart cell migration (Fig.
3). By the end of neurulation, each B7.5 blastomere has divided
twice. The four descendants have a similar morphology (although the rostral
TVCs are smaller) and display close membrane adhesion
(Fig. 3A). During tail
extension, the rostral TVCs separate from their caudal sisters, adhere to the
head endoderm and migrate anteriorly along the ventral surface of this
rudimentary tissue (Fig. 3B-D).
Later, as the TVCs meet along the ventral midline, they are closely apposed to
the underlying epidermis and extend filopodia (see bottom inset,
Fig. 3D-F). Thus, TVCs exhibit
two phases of directed cell migration: anterior movements along the ventral
endoderm followed by midline positioning associated with filopodial
extensions.
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
|
Tbx6-Mesp interactions in Ciona raise the possibility
that Tbx6 activated Mesp in the ancestral chordates. Vertebrates
contain two closely linked Mesp paralogs, one primarily involved in
heart development (Mesp1) and the other in somitogenesis
(Mesp2) (Kitajima et al.,
2000
; Takahashi et al.,
2005
). There are indications that both vertebrate Mesp
genes maintain the ancestral requirement for Tbx6 activation. Alignment of
vertebrate Mesp1 and Mesp2 5' flanking sequences
identify numerous potential T-box binding motifs
(Fig. 2F). Moreover, the
Tbx6 and Mesp1 expression domains overlap in the early
primitive streak of mice (Chapman et al.,
1996
; Saga et al.,
1996
), and Mesp2 expression is lost in
Tbx6/Tbx6 mutant mice
(White et al., 2003
). It is
conceivable that the ancestral gene was also regulated by Notch signaling.
Mesp2 is one of the first read-outs of the periodic expression of
Notch signaling genes (the somitogenic clock). In chick, the somitogenesis
clock is active in the emerging heart field at the time when Mesp1
may be activated (Jouve et al.,
2002
). The Ciona Mesp minimal enhancers lack obvious
Su(H)-binding sites. However, preliminary studies suggest that the inhibition
of Notch signaling diminishes Mesp expression (B.D., unpublished).
Further studies will be required to determine whether Tbx6 and Notch regulate
Mesp in the heart field of Ciona and vertebrates.
Constitutively active Mesp uncouples heart cell specification and migration
The detailed analysis of Mesp-GFP reporter expression in early
Ciona embryos provided single-cell resolution of the directed
migration of heart progenitors. Confocal imaging identified two phases in the
directed movement of heart cells: anterior migration and ventral fusion.
Intriguingly, a comparable, possibly conserved, bi-phasic mode of heart cell
migration has recently been characterized in zebrafish (Nathalia Glickman,
personal communication). The simplicity of Ciona cell lineages, and
the ability to independently manipulate cardiac migration and specification
programs (see below), should permit the systematic identification of the
signals and networks underlying the early migration of heart cells.
Previous studies of Mesp function have been interpreted as
indicating primary roles in either heart cell migration
(Kitajima et al., 2000
) or
specification (Satou et al.,
2004
). In mice, chimeric Mesp1/Mesp2 knockout
cells fail to migrate into the forming heart, but this might be secondary to a
disruption of early specification events. In Ciona, Mesp morpholinos
block the expression of heart markers, but this might be secondary to a
disruption of early migration. The present study indicates that the primary
function of Mesp is cardiac specification. The demonstration that an
activator form of Mesp can drive the differentiation of ectopic
beating heart tissue suggests that Mesp acts as a cardiac determinant
independently of any role in migration. The manipulation of Mesp
function led to the uncoupling of heart cell migration and specification. It
is not clear why the activator form of Mesp interferes with
migration. However, Mesp is transiently expressed in the B7.5
lineage, and is lost from the heart progenitors prior to the onset of
migration. Perhaps this downregulation is essential for migration and the
prolonged expression of Mesp-VP16 blocks migration. Regardless of the
mechanism, the uncoupling of heart cell migration and specification sets the
stage for the detailed investigation of each process.
Determination of the heart field within the Mesp expression domain
In both vertebrates and Ciona, the Mesp expression domain
extends beyond the definitive heart field into neighboring mesodermal
precursor populations. Thus, Mesp expression alone is not sufficient
to drive cardiac specification. Preliminary studies indicate that an inductive
event determines the definitive heart field within the Mesp
expression domain (B.D., unpublished). According to our current model
(Fig. 6A), Mesp specifies a
field of potential heart cells. Subsequently, inductive signals release this
latent cardiac potential in a subset of the Mesp expression domain.
This model is consistent with the ability of a constitutively active form of
Mesp to drive heart specification in the entire Mesp expression
domain, bypassing the inductive signal
(Fig. 6B). This model is also
consistent with recent findings regarding the broad cardiac potential of the
early chick mesoderm (Eisenberg and
Eisenberg, 2004
).
A role for Mesp in heart development may have first evolved in the
chordates. Despite conservation of the core cardiac gene network
(Nkx2.5-Gata4-Hand) in Drosophila and vertebrates
(Zaffran and Frasch, 2002
),
there is no ortholog of Mesp expressed in the Drosophila
heart field (Moore et al.,
2000
). In both mice and Ciona, Mesp is expressed in the
emerging cardiac mesoderm prior to the initial expression of the core heart
transcription factors (Saga et al.,
2000
; Satou et al.,
2004
). Thus it appears that Mesp was recruited during
chordate evolution to act upstream of these conserved regulatory genes in
setting up the initial heart field. Identification of Mesp downstream
targets in Ciona will clarify the link between Mesp and the
established heart gene network.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/21/4811/DC1
| REFERENCES |
|---|
|
|
|---|
Chapman, D. L., Agulnik, I., Hancock, S., Silver, L. M. and Papaioannou, V. E. (1996). Tbx6, a mouse T-Box gene implicated in paraxial mesoderm formation at gastrulation. Dev. Biol. 180,534 -542.[CrossRef][Medline]
Corbo, J. C., Levine, M. and Zeller, R. W. (1997). Characterization of a notochord-specific enhancer from the Brachyury promoter region of the ascidian, Ciona intestinalis. Development 124,589 -602.[Abstract]
Davidson, B. and Levine, M. (2003).
Evolutionary origins of the vertebrate heart: Specification of the cardiac
lineage in Ciona intestinalis. Proc. Natl. Acad. Sci.
USA 100,11469
-11473.
Eisenberg, L. M. and Eisenberg, C. A. (2004). An in vitro analysis of myocardial potential indicates that phenotypic plasticity is an innate property of early embryonic tissue. Stem Cells Dev. 13,614 -624.[CrossRef][Medline]
Fujiwara, S., Corbo, J. C. and Levine, M. (1998). The snail repressor establishes a muscle/notochord boundary in the Ciona embryo. Development 125,2511 -2520.[Abstract]
Harafuji, N., Keys, D. N. and Levine, M.
(2002). Genome-wide identification of tissue-specific enhancers
in the Ciona tadpole. Proc. Natl. Acad. Sci.
USA 99,6802
-6805.
Haraguchi, S., Kitajima, S., Takagi, A., Takeda, H., Inoue, T. and Saga, Y. (2001). Transcriptional regulation of Mesp1 and Mesp2 genes: differential usage of enhancers during development. Mech. Dev. 108, 59-69.[CrossRef][Medline]
Hirano, T. and Nishida, H. (1997). Developmental fates of larval tissues after metamorphosis in ascidian Halocynthia roretzi. I. Origin of mesodermal tissues of the juvenile. Dev. Biol. 192,199 -210.[CrossRef][Medline]
Imai, K. S., Hino, K., Yagi, K., Satoh, N. and Satou, Y.
(2004). Gene expression profiles of transcription factors and
signaling molecules in the ascidian embryo: towards a comprehensive
understanding of gene networks. Development
131,4047
-4058.
Jouve, C., Iimura, T. and Pourquie, O. (2002).
Onset of the segmentation clock in the chick embryo: evidence for oscillations
in the somite precursors in the primitive streak.
Development 129,1107
-1117.
Kitajima, S., Takagi, A., Inoue, T. and Saga, Y. (2000). Mesp1 and Mesp2 are essential for the development of cardiac mesoderm. Development 127,3215 -3226.[Abstract]
MacLean, D. W., Meedel, T. H. and Hastings, K. E.
(1997). Tissue-specific alternative splicing of ascidian troponin
I isoforms. Redesign of a protein isoform-generating mechanism during chordate
evolution. J. Biol. Chem.
272,32115
-32120.
Meedel, T. H., Farmer, S. C. and Lee, J. J. (1997). The single MyoD family gene of Ciona intestinalis encodes two differentially expressed proteins: implications for the evolution of chordate muscle gene regulation. Development 124,1711 -1721.[Abstract]
Moore, A. W., Barbel, S., Jan, L. Y. and Jan, Y. N.
(2000). A genome wide survey of basic helix-loop-helix factors in
Drosophila. Proc. Natl. Acad. Sci. USA
97,10436
-10441.
Nagatomo, K. and Fujiwara, S. (2003). Expression of Raldh2, Cyp26 and Hox-1 in normal and retinoic acid-treated Ciona intestinalis embryos. Gene Expr. Patterns 3,273 -277.[CrossRef][Medline]
Rusch, J. and Levine, M. (1997). Regulation of a dpp target gene in the Drosophila embryo. Development 124,303 -311.[Abstract]
Saga, Y., Hata, N., Kobayashi, S., Magnuson, T., Seldin, M. F. and Taketo, M. M. (1996). Mesp1: a novel basic helix-loop-helix protein expressed in the nascent mesodermal cells during mouse gastrulation. Development 122,2769 -2778.[Abstract]
Saga, Y., Kitajima, S. and Miyagawa-Tomita, S. (2000). Mesp1 expression is the earliest sign of cardiovascular development. Trends Cardiovasc. Med. 10,345 -352.[CrossRef][Medline]
Satou, Y., Yamada, L., Mochizuki, Y., Takatori, N., Kawashima, T., Sasaki, A., Hamaguchi, M., Awazu, S., Yagi, K., Sasakura, Y. et al. (2002). A cDNA resource from the basal chordate Ciona intestinalis. Genesis 33,153 -154.[CrossRef][Medline]
Satou, Y., Imai, K. S. and Satoh, N. (2004).
The ascidian Mesp gene specifies heart precursor cells.
Development 131,2533
-2541.
Takahashi, Y., Kitajima, S., Inoue, T., Kanno, J. and Saga,
Y. (2005). Differential contributions of Mesp1 and
Mesp2 to the epithelialization and rostro-caudal patterning of
somites. Development
132,787
-796.
Takatori, N., Hotta, K., Mochizuki, Y., Satoh, G., Mitani, Y., Satoh, N., Satou, Y. and Takahashi, H. (2004). T-box genes in the ascidian Ciona intestinalis: characterization of cDNAs and spatial expression. Dev. Dyn. 230,743 -753.[CrossRef][Medline]
White, P. H., Farkas, D. R., McFadden, E. E. and Chapman, D.
L. (2003). Defective somite patterning in mouse embryos with
reduced levels of Tbx6. Development
130,1681
-1690.
Yagi, K., Takatori, N., Satou, Y. and Satoh, N. (2005). Ci-Tbx6b and Ci-Tbx6c are key mediators of the maternal effect gene Ci-macho1 in muscle cell differentiation in Ciona intestinalis embryos. Dev. Biol. 282,535 -549.[CrossRef][Medline]
Zaffran, S. and Frasch, M. (2002). Early
signals in cardiac development. Circ. Res.
91,457
-469.
Related articles in Development:
This article has been cited by other articles:
![]() |
L. Christiaen, B. Davidson, T. Kawashima, W. Powell, H. Nolla, K. Vranizan, and M. Levine The Transcription/Migration Interface in Heart Precursors of Ciona intestinalis Science, June 6, 2008; 320(5881): 1349 - 1352. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Beh, W. Shi, M. Levine, B. Davidson, and L. Christiaen FoxF is essential for FGF-induced migration of heart progenitor cells in the ascidian Ciona intestinalis Development, September 15, 2007; 134(18): 3297 - 3305. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. F. Farin, M. Bussen, M. K. Schmidt, M. K. Singh, K. Schuster-Gossler, and A. Kispert Transcriptional Repression by the T-box Proteins Tbx18 and Tbx15 Depends on Groucho Corepressors J. Biol. Chem., August 31, 2007; 282(35): 25748 - 25759. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G. Holtzman, J. J. Schoenebeck, H.-J. Tsai, and D. Yelon Endocardium is necessary for cardiomyocyte movement during heart tube assembly Development, June 15, 2007; 134(12): 2379 - 2386. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Satou and N. Satoh Gene regulatory networks for the development and evolution of the chordate heart Genes & Dev., October 1, 2006; 20(19): 2634 - 2638. [Full Text] [PDF] |
||||
![]() |
B. Davidson, W. Shi, J. Beh, L. Christiaen, and M. Levine FGF signaling delineates the cardiac progenitor field in the simple chordate, Ciona intestinalis Genes & Dev., October 1, 2006; 20(19): 2728 - 2738. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. N. Olson Gene regulatory networks in the evolution and development of the heart. Science, September 29, 2006; 313(5795): 1922 - 1927. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yasuhiko, S. Haraguchi, S. Kitajima, Y. Takahashi, J. Kanno, and Y. Saga Tbx6-mediated Notch signaling controls somite-specific Mesp2 expression PNAS, March 7, 2006; 103(10): 3651 - 3656. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||