|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 October 2005
doi: 10.1242/dev.02061
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

,
Department of Cell Biology, Emory University School of Medicine, Atlanta GA 30322, USA
Author for correspondence (e-mail:
mosesk{at}hhmi.org)
Accepted 24 August 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Hedgehog, Pointed, Drosophila, Eye, Morphogenetic furrow, Transcription, Enhancer
| Introduction |
|---|
|
|
|---|
Posterior to the furrow, after the founder cell is specified, the rest of
the ommatidial cells are recruited by successive rounds of Ras pathway
induction, beginning with the other seven photoreceptors
(Ready et al., 1976
;
Tomlinson, 1985
;
Tomlinson, 1988
;
Wolff and Ready, 1993
;
Voas and Rebay, 2004
). In all
cases, this Ras signal involves MAPK phosphorylation and the activation of the
Ets domain transcription factors pointed and anterior open
(also known as Yan) (O'Neill et al.,
1994
; Dickson,
1995
; Rubin et al.,
1997
). An early effect in these receiving cells is the
upregulation of Pointed, and later the cells differentiate
(Tomlinson and Ready, 1987
).
In contrast to the other photoreceptors, the R8 does not require the Egfr/Ras
pathway or Pointed for its initial specification or early neural
differentiation (but does require Egfr signaling later for its maintenance)
(Kumar et al., 1998
;
Baonza et al., 2001
;
Yang and Baker, 2001
).
Progression of the morphogenetic furrow depends on hedgehog
signaling: if hedgehog function is removed by means of a conditional
mutation, mosaic clones or by an eye specific allele, the furrow arrests
(Heberlein et al., 1993
;
Ma et al., 1993
). If, anterior
to the furrow, hedgehog is ectopically and locally expressed, or if
the negative hedgehog pathway elements patched or
Pka are locally removed, an ectopic furrow propagates away from the
triggering site in all directions
(Heberlein et al., 1995
;
Li et al., 1995
;
Ma and Moses, 1995
;
Strutt et al., 1995
). From in
situ hybridization and the expression of two lacZ enhancer-trap lines,
hedgehog is thought to be expressed in all the developing
photoreceptor cells posterior to the furrow
(Lee et al., 1992
;
Heberlein et al., 1993
;
Ma et al., 1993
). Thus,
hedgehog, expressed posterior to the furrow is necessary and
sufficient for furrow progression.
Cells anterior to the furrow respond to the Hedgehog signal via the
receptor Smoothened (Smo) and other downstream elements, including the
transcription factor Cubitus interruptus (Ci)
(Strutt and Mlodzik, 1996
;
Strutt and Mlodzik, 1997
;
Fu and Baker, 2003
;
Lum and Beachy, 2004
). Cells
in and anterior to the furrow respond to the hedgehog signal and
activate the expression of several target genes, including hairy,
decapentaplegic, patched and atonal
(Heberlein et al., 1993
;
Ma et al., 1993
;
Ma and Moses, 1995
;
Baker and Yu, 1997
;
Shyamala and Bhat, 2002
). In
addition to furrow progression, hedgehog signaling from outside the
eye field is required for furrow initiation (from the posterior disc margin)
(Domínguez and Hafen,
1997
; Borod and Heberlein,
1998
; Chen et al.,
1999
; Curtiss and Mlodzik,
2000
; Pappu et al.,
2003
). On the margins of the eye disc Wingless signals antagonize
hedgehog and limit the rate of furrow progression
(Ma and Moses, 1995
;
Treisman and Rubin, 1995
).
Decapentaplegic expressed in the furrow was first thought to act as a
second signal to relay the hedgehog signal forward
(Blackman et al., 1991
;
Heberlein and Moses, 1995
).
However, decapentaplegic pathway loss of function does not arrest the
furrow and the ectopic expression of decapentaplegic anterior to the
furrow does not produce an ectopic furrow that propagates away from this
source, but rather begins some distance away at the eye disc margin
(Burke and Basler, 1996
;
Wiersdorff et al., 1996
;
Chanut and Heberlein, 1997b
;
Pignoni and Zipursky, 1997
;
Fu and Baker, 2003
). Thus,
unlike hedgehog, decapentaplegic is neither necessary nor sufficient
for furrow progression at the center of the disc, but may be downstream of and
redundant to hedgehog (Greenwood
and Struhl, 1999
). decapentaplegic is also expressed at
the eye disc margin and may be more directly involved in furrow initiation and
progression there, together with members of the retinal determination gene
complex, such as dachshund
(Mardon et al., 1994
;
Wiersdorff et al., 1996
;
Chanut and Heberlein, 1997b
;
Chanut and Heberlein, 1997a
;
Pignoni and Zipursky,
1997
).
Thus, in the developing eye Hedgehog signaling drives a moving wave: the
morphogenetic furrow. Cells that once received a Hedgehog signal on the
anterior side will later express Hedgehog on the posterior side; essentially a
cyclic and progressive phenomenon. By contrast, in the embryonic cuticle and
imaginal discs, Hedgehog, Decapentaplegic and Wingless also interact,
producing stable (not moving) boundaries, to form segments and/or lines of
clonal restriction (Morata and Lawrence,
1977
; García-Bellido et
al., 1979
; Lawrence,
1981
; Akam, 1987
;
Ingham and Martinez-Arias,
1992
; Kornberg and Tabata,
1993
; DiNardo et al.,
1994
; Perrimon,
1994
; Hidalgo,
1996
). Unlike the eye, in these places a cell that receives
Hedgehog does not later send it and there is no progressive cyclical process
(Burke and Basler, 1997
).
We suggest that there may be a special mode of hedgehog regulation so that in the eye (and nowhere else) a cell that receives Hedgehog will later express it (after a delay). A mechanism for this may be a dually regulated, eye-specific transcriptional enhancer for the hedgehog gene. This enhancer would require two simultaneous inputs to become active: one that is eye specific and another that is downstream of hedgehog (directly or indirectly). To test this possibility, we took advantage of two alleles of hedgehog that stop the furrow, but that have little or no phenotypic effect outside the eye. Both of these mutations delete DNA from the same 1.9 kb region of the first intron. We therefore reasoned that the regulatory elements responsible for a unique mode of hedgehog expression in the eye may reside in this region.
Here, we show that a 1.9 kb region of the first intron of hedgehog
is necessary and sufficient to direct reporter lacZ expression
posterior to the furrow in the developing eye, but that it is inactive
(almost) everywhere else. We find that a minimal sequence of 203 bp confers
this regulation and contains three consensus Ets domain transcription factor
binding sites. We show that this enhancer drives expression in all the
ommatidial cells except the R8: the pattern of Egfr/Ras pathway signaling and
Pointed activation. We show that the three Ets sites in the minimal fragment
are bound by Pointed in vitro, and that the function of this enhancer
genetically requires pointed in vivo. Pointed is a major effector of
photoreceptor differentiation and is therefore downstream of the furrow and
indirectly downstream of hedgehog function. This fragment also
contains one of the two So sites recently shown to be required by others
(Pauli et al., 2005
). We
propose that So and Pointed confer eye-specific dual regulation on
hedgehog and may explain why the furrow moves, and is not a
stationary compartment boundary.
| Materials and methods |
|---|
|
|
|---|
hedgehog mutant stocks
w1118; hhbar3, w1118;
hhfse, w1118; hh8/TM6
Tb Hu and w1118; hhAC/TM3
Sb.
dpp reporter
dpp:lacZ cn; ry506 (BS3.0 from
Blackman et al., 1991
). For,
P-element transformation, ry506 were injected.
Genotype for the bar3:lacZ pointed null clones
y w ey:FLP; bar3:lacZ; P{neoFRT}82B
pntdelta88/P{neoFRT}82B P{Ubi-GFP(S65T)nls}3R.
SEM and facet counts
Scanning electron microscopy (SEM) was as described previously
(Tio and Moses, 1997
).
Statistical analyses of ommatidium numbers by calculating the mean (µ),
standard deviation (s.d.) and 95% confidence interval range (95%CI). For each
genotype, one right eye each from three females was counted.
hhfse/+: µ=736.0, s.d.=19.61, 95%CI 698-774;
hhbar3/+: µ=725.33, s.d.=5.31, 95%CI 715-736;
hh8/+: µ=717.67, s.d.=5.79, 95%CI 706-729; wild type:
µ=710.0, s.d.=8.98, 95%CI 692-728; hhAC/+: µ=640.67,
s.d.=39.38, 95%CI 563-718; hhfse/hh8:
µ=511.67, s.d.=9.74, 95%CI 493-531,
hhfse/hhfse: µ=498.33, s.d.=18.73,
95%CI 462-535; hhbar3/hh8:
µ=340.67, s.d.=15.8, 95%CI 310-372;
hhfse/hhbar3: µ=241.0, s.d.=2.94,
95%CI 235-247; hhbar3/hhbar3:
µ=232.0, s.d.=23.76, 95%CI 185-279;
hhfse/hhAC: µ=159.67, s.d.=8.58,
95%CI 143-176; hhbar3/hhAC:
µ=133.67, s.d.=5.44, 95%CI 123-144.
Microscopy, antibodies and immunohistochemistry
Embryos and eye discs were as described previously
(Kumar and Moses, 2001
). Eye
discs were mounted in Vectashield (Vector Labs, H-1000), imaged by confocal
microscopy (Zeiss LSM510) or by DAB staining with Ni/Co, then DPX (Zeiss).
Primary antibodies used were rabbit anti-Hedgehog (1:625, a gift from I.
Guererro), mouse anti-Boss for R8 (1:1000, a gift from S. L. Zipursky)
(Cagan et al., 1992
), mouse
anti-ß-gal (1:1000, Promega 23783), rabbit anti-ß-gal (1:1,000
Cortex BioChem CA2196), rat monoclonal anti-Elav 7E8A10 (1:1000 from DSHB)
(Bier et al., 1988
), guinea
pig anti-Senseless, (1:1000, a gift from G. Mardon)
(Nolo et al., 2000
), mouse
anti-Futsch (1:100, also known as 22C10, a gift from S. L. Zipursky)
(Fujita et al., 1982
).
Secondary antibodies (Jackson ImmunoResearch): goat anti-mouse HRP (1:40,
115-035-003), goat anti-mouse minX FITC (1:200, 115-095-166), goat anti-rabbit
HRP (1:100,111-035-003), goat anti-guinea pig FITC (1:200, 106-095-003), goat
anti-rat Cy5 (1:200, 112-175-003) and goat anti-rabbit TRITC (1:250,
111-025-003).
Plasmids
Deletions in hhbar3 (6053-7938) and
hhfse (6456-7469) were determined by PCR and sequencing
from P{(w, ry)D}3 gl3 e (bases numbered from the site of
P30) (Lee et al., 1992
). Four
putative Ets protein binding sites
[5'-(C/G)(A/C/G)GGA(A/T)(A/G)-3'
(Xu et al., 2000
)] were found
at 6296, 6308, 6330 and 7034. The sequences of transgene constructs, all
inserted into NotI site of pDM30hslacZ
(Bowtell et al., 1989
), were
amplified by PCR from Canton-S DNA, with engineered NotI sites, to
yield pDM30(bar3)hslacZ, pDM30(fse)hslacZ, pDM30(bar3L)hslacZ,
pDM30(bar3R)hslacZ, pDM30(bar3L1)hslacZ and pDM30(bar3L2)hslacZ
(Fig. 1A). For Ets site
deletion construct, pDM30(bar3L2deltaETS)hslacZ, oligonucleotides with
substitutions in the three Ets sites (see
Fig. 6) were assembled into 203
bp Bar3L2deltaEts fragment (with engineered NotI sites). For
pDM30(6xETS)hslacZ, an oligo with six tandem consensus Ets binding sites was
synthesized. All constructs were confirmed by DNA sequencing. Positions of
constructs was: pDM30(bar3)hslacZ, 6053-7938; pDM30(fse)hslacZ, 6456-7468;
pDM30(bar3L)hslacZ, 6053-6455; pDM30(bar3R)hslacZ, 7469-7938;
pDM30(bar3L1)hslacZ, 6053-6252; pDM30(bar3L2)hslacZ and
pDM30(bar3L2deltaETS)hslacZ, 6253-6455. The oligonucleotide sequences used,
with the Not1 sites italicized and mutagenic base changes underlined, were as
follows. For pDM30(bar3)hslacZ, 6053AForward
(AAAAAAGCGGCCGCAGGGTGGGAAAAAGGCCCGC) and 7938AReverse
(AAAAAGCGGCCGCGGATCCGCGACACGAAGATCCTTTTC); for pDM30(fse)hslacZ, 6456Forward
(AAGAAAAAAGCGGCCGCTCTAGAAGCTTATATATAAAAAAAGGGGGTGACTCCCC) and
7469Reverse (AAGGAAAAAAGCGGCCGCGAATTCTGCGCTGGACGCGCAATGAAC); for
pDM30(bar3L)hslacZ, 6053BForward (CCGCGGCCGCAGGGTGGGAAAAAGGCCCG) and
6456Reverse (CCGCGGCCGCACATATATGTATGTATATATGC-AGC); for pDM30(bar3R)hslacZ,
7469Forward (CCGCGGCCGCTCGATTCGAATTCGAGCTCAATGCA) and 7938BReverse
(CCGCGGCGCCTTGCGACACGAAGATCCTTTTCTTC); for pDM30(bar3L1)-hslacZ, 6053BForward
(above) and 6253Reverse (CCGCGGCCGCCCCACCTAAACGATTCACACACACA); for
pDM30(bar3L2)-hslacZ, 6253Forward (CCGCGGCCGCTGACGTGATTTCTTCAGAGTTTCAACTCG)
and 6456Reverse (above); for pDM30(bar3L2deltaETS)hslacZ, 6258MutagenicForward
(TGATTTCTTCAGAGTTTCAACTCGTATTTTTTCGACTATCACGTGTGTCGCTGCGCAAGTTGTAAGTTTT),
6363MutagenicReverse
(CCTTTGATTCACGGCACTGATTGAGATCGCAGAGCATGCGAAAACTTACAACTTGCGCAGCGACA),
6294Reverse (AGTCGAAAAAATACGAGTTGAAACTCTGA), 6337Forward
(TGCGATCTCAATCAGTGCCGTGAATC), 6053BForward (above), 6253Forward (above) and
6456Reverse (above); for pDM30(6xETS)hslacZ, 6XForward
(GGCCCAGGAAGCCAGGAAGTCAGGAAGCCAGGAAGTCAGGAAGCCAGGA-AGT) and 6XReverse
(GGCCACTTCCTGGCTTCCTGACTTCCTGGCTTCCTGACTTCCTGGCTTCCTG).
Transformation
Embryo injections were as described previously
(Rubin and Spradling, 1982
)
with constructs, at 1:1 ratio (500 µg/ml each) with S129A enhanced
P-transposase plasmid (Beall et al.,
2002
). Numbers of independent transgenic lines for each construct
were as follows: pDM30(bar3)hslacZ, 13; pDM30(fse)hslacZ, 7;
pDM30(bar3L)hslacZ, 5; pDM30(bar3R)hslacZ, 4; pDM30(bar3L1)hslacZ, 2;
pDM30(bar3L2)hslacZ, 6; pDM30(bar3L2deltaETS)hslacZ, 5; pDM30(6xETS)hslacZ, 3.
Some lines have additional, ectopic patterns that we attribute to enhancer
trap effects, e.g. 2/13 of the pDM30(bar3)hslacZ lines. In all cases, we
studied multiple independent lines.
EMSA (gel shift)
GST-PntP2 protein, expressed in E. coli, purified as described by
(Kauffmann et al., 1996
). The
DNA probe was from positions 6234 to 6347, and was end labeled
(gamma-32P-ATP, T4 Polynucleotide Kinase, New England
Biolabs). The 203 bp wild-type and delta-Ets competitor DNAs were synthesized
by PCR from pDM30(bar3L2)hslacZ, pDM30(bar3L2deltaETS)hslacZ. The oligo
competitors were the unlabelled annealed sequences given below. The protocol
was as described previously (Buratowski
and Chodosh, 2002
), modified as follows: the binding reactions
were in 18 µl total volume in `binding buffer'
(Xu et al., 2000
) comprising
13 mM HEPES (pH 7.9), 40 mM KCl, 44 mM NaCl, 4.4 mM Tris (pH 7.5), 0.7 mM
EDTA, 0.3 mM DTT and 9% glycerol. Poly dI-dC (1 µg), 5 µg of BSA and
double-stranded labeled probe (6 fmol, 8000 CPM) were added to each reaction
with unlabeled DNA competitors, as indicated. GST-PntP2 (200 fmol) was added
last. Incubations were for 30 minutes at room temperature. Samples analyzed by
4% non-denaturing, poly-acrylamide gel and dried for autoradiography. The
oligonucleotide used for wild type was
TTTTTCGACTATATCCTGTGTCGCTTCCTCAGTTTAAGTTTTCGCTTCCTCTGCGATCCAA. The
oligonucleotide used the Ets sites mutant was
TTTTT-CGACTATCACGTGTGTCGCTGCGCAAGTTGTAAGTTTTCGCAGCTCTGCGATCTCAA.
| Results |
|---|
|
|
|---|
To determine if either of these two eye-specific alleles are null for
hedgehog function in the eye, we derived all viable pair-wise
combinations of these alleles, wild-type and two zygotic lethal alleles
(hhAC and hh8).
hhAC is a single gene deletion that removes both the start
sites for transcription and translation
(Fig. 1A) (Lee et al., 1992
).
hh8 (also known as hh13C) is a
chain-terminating mutation in the coding sequence
(Fig. 1A)
(Lee et al., 1994
). Both
alleles are zygotic lethal with strong cuticle phenotypes.
hhAC is thought to be a null because of the strength of
its phenotype and the nature of its lesion
(Lee et al., 1994
). On
phenotypic grounds and comparison with other alleles, five groups have also
reported hh8 to be functionally amorphic
(Mohler, 1988
;
Lee et al., 1992
;
Heemskerk and DiNardo, 1994
;
Hooper, 1994
;
Park et al., 1996
).
We find that these alleles form a series for adult eye phenotype (Fig. 1B-I). We quantified this by counting eye facets in adult females (Fig. 1J) and find that hhfse, hhbar3 and hh8 heterozygotes are not significantly different from wild type. However, hhAC is slightly dominant, with an eye that is about 10% smaller than wild type (although this difference is not statistically significant, see 95% confidence limits in the Materials and methods, and in Fig. 1J).
By facet number, hhbar3 is a strong, eye-specific
hypomorph. It is fully recessive in trans to wild type, has a severely reduced
eye when homozygous (68% smaller than
hhbar3/hh+) and in trans to the null
hhAC it is smaller still (82% smaller than
hhbar3/hh+). This suggests that
hhbar3 is not an amorph for eye size by Muller's test: the
phenotype becomes stronger in trans to the null
(Muller, 1932
).
hhfse is similar to but weaker than
hhbar3: the hhfse homozygous eye is
only 32% smaller than hhfse/hh+ and in
trans the null (hhAC), it is further reduced to 78%. Thus,
by both measures (phenotype as a homozygote and in trans to a null),
hhbar3 is a strong hypomorphic allele and
hhfse is a weaker hypomorph. From the 95% confidence
limits, all these results are statistically significant.
Another way to view these eye specific mutations is by the number of columns of ommatidia produced, a more direct measure of how far the furrow progresses in the larval disc. Wild-type eyes have about 28 to 30 columns, hhfse homozygotes have about 20, hhbar3 homozygotes have about 10 and the strongest mutant genotype we have studied (hhbar3/hhAC) has about six. The furrow may stop early in hhfse, but it stops much earlier in hhbar3.
More interesting are the anomalous phenotypes of both eye-specific alleles
when placed in trans to the second purported null (hh8):
hhfse/hh8 has significantly larger
eyes (512 mean facets, or 30% fewer than
hhfse/hh+) than
hhfse/hhAC (160 mean facets or 78%
fewer than hhfse/hh+), and
hhbar3/hh8 has significantly larger
eyes (341 mean facets, or 53% fewer than
hhbar3/hh+) than
hhbar3/hhAC (134 mean facets or 82%
fewer than hhbar3/hh+). Thus, although
hh8 may be functionally amorphic for non-eye phenotypes it
appears to be much weaker than hhAC in this assay. This
may be due to transvection (Lewis,
1954
; Duncan,
2002
). It could be that hhAC deletes
cis-regulatory elements (in addition to the coding sequence), which are also
deleted from hhbar3 and hhfse, while
hh8 leaves these putative regulatory elements intact.
Thus, hh8 may supply some degree of essential regulation
in trans when heterozygous to hhbar3 or
hhfse, both of which have their coding sequences
intact.
Two mechanisms suggest themselves for the apparent eye-specificity of hhbar3 and hhfse.
(1) It is possible that the requirement for hedgehog function is higher in the eye than in the rest of the animal, so that weak mutations which reduce the quantity of hedgehog function uniformly, may affect only the eye. If so, then hhbar3 may simply have less function than hhfse.
|
|
These two possibilities need not be exclusive. Probably,
hhbar3 and hhfse affect a
transcriptional enhancer and not the protein itself or the gene promoter,
because neither lesion directly affects the coding sequence. In sequencing 23
cDNAs from eye-imaginal discs, we found no alternative first exon or start
site in the region of the two mutations
(Ma et al., 1996
).
Hedgehog protein expression and function in the eye are affected by hhbar3 and hhfse
We used an antibody to detect Hedgehog antigen in the developing third
larval eye-antennal imaginal disc (Fig.
2). We find that Hedgehog antigen is detectable in three
territories: posterior to the morphogenetic furrow (white arrow in
Fig. 2A), and outside the eye
field in the presumptive ocellar domain (`oc' in
Fig. 2A) and the anterior
compartment of the antenna (`an' in Fig.
2A). The expression in the ocellar domain is consistent with
reported hedgehog function in the head vertex
(Royet and Finkelstein, 1996
;
Royet and Finkelstein, 1997
;
Amin et al., 1999
). The
expression in the anterior compartment of the antennal disc appears anomalous,
as hedgehog functions in the posterior compartments of most imaginal
discs, and may be explained by the inversion of the antenna
(Struhl, 1981
).
In the region of the morphogenetic furrow, Hedgehog antigen first appears
in two cells (white arrowheads in Fig.
2B). These cells appear to be the R2 and R5, and later antigen is
also expressed in R3 and R4. The central cell of the precluster (R8) appears
not to express Hedgehog antigen. Similar differences have been observed
between the R8 and the other cells, such as later expression of Elav, and
independence of the Egfr/Ras pathway
(Kumar et al., 1998
). To
confirm this, we doubly stained eye discs for Hedgehog and the R8-specific
antigen Boss (Fig. 2C). We
first observe Boss antigen slightly later than Hedgehog. In the early clusters
there is a gap in the Hedgehog stain (resembling a keyhole), and in the next
few columns this gap is filled by Boss (white arrows in
Fig. 2C). Soon after this,
Hedgehog expression fades. Thus, we suggest that Hedgehog is not expressed in
the R8: at least we cannot detect it to the limits of our resolution. It may
be that the furrow is driven forwards by expression from all cells except the
R8.
In late third instar, hhbar3 homozygous eye discs no Hedgehog antigen is detectable posterior to the morphogenetic furrow, while it remains unaffected in the ocellar region and in the antenna (Fig. 2D). We have also stained other hhbar3 homozygous imaginal discs (wings and legs) and find the Hedgehog antigen pattern is not detectably different from wild type (data not shown). Thus, hhbar3 does specifically affect Hedgehog expression in the eye, which suggests that it is indeed an eye-specific regulatory allele. This argues strongly that the eye specific phenotype of hhbar3 is not only due to a higher requirement for Hedgehog in the eye. We also stained hhfse eye discs and find a reduced but detectable level of Hedgehog antigen in the eye (data not shown).
We deliberately overstained discs and find that the weaker and earlier
domain of Hedgehog expression in the posterior margin, previously described by
others in wild type, is not abolished in hhbar3 (see white
arrows in Fig. 2E,F)
(Domínguez and Hafen,
1997
; Borod and Heberlein,
1998
). After furrow initiation in hhbar3
homozygous eye discs, we detect no Hedgehog antigen in the first 12 ommatidial
columns of photoreceptor cells. Thus, we suggest that in
hhbar3 homozygotes the furrow initiates normally under the
influence of marginal Hedgehog, and moves for the first 12 columns or so under
this or other influences. Then the furrow fails as it has not begun to express
Hedgehog locally.
We also tested the function of hedgehog signaling in the
developing eye through the activity of a target gene. The BS3.0 element from
the decapentaplegic gene (dpp:lacZ) drives strong reporter
expression in the furrow, in the eye disc margins and in the compartment
boundaries of other discs (Fig.
2G) (Blackman et al.,
1991
). We find that hhfse greatly reduces, but
does not eliminate, dpp:lacZ expression in the furrow but not the
compartment boundaries of other discs (see furrow and antenna in
Fig. 2H). However, as
previously reported, hhbar3 has a stronger effect
(Fig. 2I)
(Heberlein et al., 1993
), as
does the conditional allele hhts2
(Ma et al., 1993
).
Taken together, these data suggest that hhbar3 is a null for Hedgehog protein expression in the eye field, while hhfse is a weaker allele: we can detect no Hedgehog expression or function (to drive dpp:lacZ) in hhbar3.
How then do hhbar3 homozygotes manage to make 12 columns of ommatidia before the furrow arrests, and how can hhbar3 be enhanced when placed in trans to the null? It is possible that there is a very low level of Hedgehog antigen present in hhbar3. However, we have grossly over stained hhbar3 discs and have never seen any. Alternatively, it could have been that Hedgehog antigen is expressed in hhbar3 for the first 12 columns and then ceases to do so. However, when we stained younger eye discs we saw no such early expression. Thus, we propose that the furrow may be induced and produce the initial columns of ommatidia through a signal from elsewhere. This is likely to involve Decapentaplegic expressed on the posterior margin, perhaps with a contribution from Hedgehog (less affected by hhbar3) and this is why the facet count in hhbar3/hhAC is less than that in hhbar3 homozygotes. We suggest that later, as the furrow moves away from the margin, it becomes an automobile organizer, supplying on its own inducer (Hedgehog) as it moves, and at this point the hhbar3 homozygous furrow arrests, having failed to make any Hedgehog.
The hhbar3 deletion removes an eye-specific transcriptional enhancer
We placed the DNA contained within the hhbar3 deletion
before a truncated hsp70 promoter driving lacZ and derived
transgenic flies (`bar3:lacZ', see
Fig. 1A). We recovered 13 lines
and all show strong reporter expression posterior to the furrow, but not in
the ocellar domain and the antenna (Fig.
3A). This is strikingly reciprocal to the effect on Hedgehog
antigen expression of hhbar3 itself (compare
Fig. 2C with
Fig. 3A), and demonstrates that
this DNA contains elements that are sufficient for this eye-specific
regulation. We also stained other imaginal discs and whole embryos (0-24 hour
collection) and found only one other consistent expression pattern: three
regions of the embryonic gut, of unknown significance (data not shown).
We did a similar experiment using the hhfse deleted DNA
(Fig. 1A). We recovered seven
lines and only two had barely detectable lacZ expression, and this is
in the disc margin (not posterior to the furrow,
Fig. 3B). Thus, the
hhfse deletion contains elements that contribute to the
eye-specific expression pattern, but are not sufficient for it. To further
delimit this hedgehog gene eye specific enhancer we constructed a
series of smaller fragment transgenes (Fig.
1A, Fig. 3C-F). We
find that the minimal sufficient element to function as the hedgehog
eye enhancer is a 203 bp fragment (bar3L2:lacZ), which lies to the
left of the hhfse deletion and within the
hhbar3 deletion (Fig.
3F, bases 6253 to 6455 using previous numbering)
(Lee et al., 1992
). Very
recently another group has shown that the hhbar3 deletion
has this eye specific function (Pauli et
al., 2005
). For other reasons (see below), they deleted a longer
left region of a very similar fragment and showed that it is required,
although they have not shown that it is sufficient
(Pauli et al., 2005
). Their
data are entirely consistent with ours.
|
The ß-gal reporter expression pattern driven by the hedgehog
eye enhancer (all the photoreceptors except the R8) is the same as the genetic
requirement for Egfr signaling
(Kumar et al., 1998
), and of
the expression of the pointed enhancer trap
pnt1277 (data not shown)
(Brunner et al., 1994
). This
suggests that the Egfr pathway Ets-domain transcription factor Pointed may be
a direct regulator of the hedgehog eye enhancer.
The hedgehog eye enhancer is activated by the Egfr pathway transcription factor Pointed
If Pointed directly regulates the hedgehog eye enhancer, then we
might expect to find Pointed-binding sites there. We used a published Ets
domain binding site consensus (Xu et al.,
2000
), and found four such sites (white arrowheads in
Fig. 1A), three of which lie in
the minimal 203 bp element, and one of which is outside it but in the
hhfse deletion. To test the cis-acting requirement for
these sites in vivo, we modified the minimal 203 bp hedgehog eye
enhancer by introducing mutations into the three Ets sites
[bar3L2(deltaEts):lacZ, see Materials and methods]. We derived
transgenic flies and found that these do not express the lacZ
reporter in the developing eye (compare
Fig. 3G with 3A,C,F). Thus,
these are the only three Ets sites in the 203 bp fragment that are required
for function in vivo.
To test the function of Pointed-binding sites alone in vivo, we derived a
hexamer concatenated construct and tested it in flies (6xEts:lacZ,
see Materials and methods). This construct does drive lacZ expression
in the embryonic nervous system, as described for the expression of
pointed itself (data not shown)
(Klämbt, 1993
). However,
it does not drive expression in the developing eye
(Fig. 3H). Thus, the cis-acting
Ets binding sites appear to be necessary, but not sufficient for the activity
of the hedgehog eye enhancer.
To test if pointed is necessary in trans for the hedgehog
eye enhancer, we derived retinal mosaic clones for the null allele
pntdelta88 (Scholz et
al., 1993
) and stained for a neural marker and for
bar3:lacZ expression (Fig.
5). Interestingly, as previously reported
(Baonza et al., 2002
;
Yang and Baker, 2003
), we find
that pointed is not required for the neural differentiation or
maintenance of the R8 cells (black arrows in
Fig. 5B,D), suggesting that the
late requirement for Egfr in R8 maintenance
(Kumar et al., 1998
) does not
require the Pointed transcription factor. These clones do show, also as
previously reported (Baonza et al.,
2002
; Yang and Baker,
2003
), that pointed function is absolutely required for
the differentiation of the other photoreceptor cells. We find that
bar3:lacZ expression is undetectable in the clones
(Fig. 5B,D). This is consistent
with direct regulation of the hedgehog eye enhancer by Pointed.
|
|
|
| Discussion |
|---|
|
|
|---|
We propose that hhbar3 is indeed null for
hedgehog expression in the developing eye, consistent with the loss
of detectable antigen. This appears to contradict our facet count data, which
show that hhbar3 is not null for eye size. We suggest that
hedgehog functions elsewhere (probably in the eye disc margin),
expressed at some lower level, and acts redundantly with Decapentaplegic to
drive the early phases of furrow progression. This is consistent with data
from others for an early role for hedgehog in the eye margin for
furrow initiation (Domínguez and
Hafen, 1997
; Borod and
Heberlein, 1998
), and with a proposed redundancy between
hedgehog and dpp in the furrow
(Greenwood and Struhl, 1999
).
The enhancement of the hhbar3 phenotype when it is placed
in trans to a null (hhAC) suggests that
hhbar3 may reduce, but not eliminate this early
function.
Several examples of eye-specific transcriptional enhancers have been
characterized. A number of these are in genes that act early in retinal
determination (eyes absent, dachshund and sine oculis), and
are not directly involved in the morphogenetic furrow
(Bui et al., 2000
;
Punzo et al., 2002
;
Pauli et al., 2005
). Some
enhancers that function in and posterior to the morphogenetic furrow have also
been studied. One example is the atonal gene, which has been shown to
have two regulatory enhancers with specific and different activities in the
furrow (Sun et al., 1998
).
Interestingly the atonal enhancers produce almost the reciprocal
expression pattern of the hedgehog eye enhancer we describe here:
hedgehog is expressed in all cells except the R8 and atonal
expression is in only the R8, posterior to the furrow. Furthermore,
atonal mutations can affect hedgehog signaling, although
this may be indirect (White and Jarman,
2000
), and indeed, hedgehog is also known to regulate
atonal (Dominguez,
1999
). Other enhancers that act posterior to the furrow have been
characterized in the rough, sevenless and prospero genes,
but none of these appears to show the particular type of regulation which we
describe here (Basler et al.,
1989
; Bowtell et al.,
1989
; Heberlein and Rubin,
1990
; Bowtell et al.,
1991
; Xu et al.,
2000
).
Very recently, others have also reported that a similar DNA fragment from
the hhbar3 region confers post-furrow, eye-specific
expression on a lacZ reporter
(Pauli et al., 2005
). The
authors characterize the consensus binding site for another transcription
factor: the retinal determination protein Sine oculis (So). They find two
So-binding sites in the hhbar3 region (black arrowheads in
Fig. 1A), and, as we did for
the Pointed sites, they show that these are necessary for the normal function
of the hedgehog eye enhancer. They show that a So site tetramer is
sufficient to drive reporter expression in the entire presumptive eye field in
the third instar disc, but that one is not. One of their two So sites lies
within our 203 bp minimal element.
Taken together, our data and theirs suggest that Pointed and So activation
at the minimal element are each necessary, but that neither is sufficient for
the specific activation of the hedgehog eye enhancer posterior to the
furrow. We propose that they act together to confer this dual regulation. This
is consistent with the model we discussed previously (see Introduction): that
special dual regulation of hedgehog is the mechanism which makes the
morphogenetic furrow move, unlike the stable compartment boundaries. We
suggest that this dual regulation depends on one `selector' signal that is eye
specific (So), to differentiate the furrow from boundaries in other organs.
The second component must act to close a loop such that cells which receives
the furrow inducing signal will later send it after a delay, to make the
boundary move forward. This `signal' component is Pointed, acting downstream
of Egfr/Ras signaling in the assembling ommatidia. This may be a case of
`selector' and `signal' transcriptional integration
(Affolter and Mann, 2001
;
Mann and Carroll, 2002
).
Indeed, pointed itself has been shown to integrate `selector' factors
in muscle development (Halfon et al.,
2000
). We propose that by this dual regulatory mechanism, a system
that first evolved to divide the bauplan into metameric parasegments has been
co-opted to drive a moving wave of differentiation in the developing eye.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Department of Biology, Haverford College, Haverford PA
19041, USA ![]()
Present address: Howard Hughes Medical Institute, Janelia Farm Research
Campus, Ashburn VA 20147, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Affolter, M. and Mann, R. (2001). Development.
Legs, eyes, or wings selectors and signals make the difference.
Science 292,1080
-1081.
Akam, M. (1987). The molecular basis for metameric pattern in the Drosophila embryo. Development 101,1 -22.[Abstract]
Amin, A., Li, Y. and Finkelstein, R. (1999). Hedgehog activates the EGF receptor pathway during Drosophila head development. Development 126,2623 -2630.[Abstract]
Baker, N. E. and Yu, S. (1997). Proneural function of neurogenic genes in the developing Drosophila eye. Curr. Biol. 7,122 -132.[CrossRef][Medline]
Baker, N. E., Yu, S. and Han, D. (1996). Evolution of proneural atonal expression during distinct regulatory phases in the developing Drosophila eye. Curr. Biol. 6,1290 -1301.[CrossRef][Medline]
Baonza, A., Casci, T. and Freeman, M. (2001). A primary role for the epidermal growth factor receptor in ommatidial spacing in the Drosophila eye. Curr. Biol. 11,396 -404.[CrossRef][Medline]
Baonza, A., Murawsky, C. M., Travers, A. A. and Freeman, M. (2002). Pointed and Tramtrack69 establish an EGFR-dependent transcriptional switch to regulate mitosis. Nat. Cell Biol. 4,976 -980.[CrossRef][Medline]
Basler, K. and Hafen, E. (1989). Dynamics of
Drosophila eye development and temporal requirements of
sevenless expression. Development
107,723
-731.
Basler, K., Siegrist, P. and Hafen, E. (1989). The spatial and temporal expression pattern of sevenless is exclusively controlled by gene-internal elements. EMBO J. 8,2381 -2386.[Medline]
Beall, E. L., Mahoney, M. B. and Rio, D. C.
(2002). Identification and analysis of a hyperactive mutant form
of Drosophila P-element transposase. Genetics
162,217
-227.
Bier, E., Ackerman, L., Barbel, S., Jan, L. and Jan, Y. N.
(1988). Identification and characterization of a neuron-specific
nuclear antigen in Drosophila. Science
240,913
-916.
Blackman, R. K., Sanicola, M., Raftery, L. A., Gillevet, T. and Gelbart, W. M. (1991). An extensive 3' cis-regulatory region directs the imaginal disk expression of decapentaplegic, a member of the TGF-ß family in Drosophila.Development 111,657 -665.[Abstract]
Borod, E. R. and Heberlein, U. (1998). Mutual regulation of decapentaplegic and hedgehog during the initiation of differentiation in the Drosophila retina. Dev. Biol. 197,187 -197.[CrossRef][Medline]
Bowtell, D. D. L., Kimmel, B. E., Simon, M. A. and Rubin, G.
M. (1989). Regulation of the complex pattern of sevenless
expression in the developing Drosophila eye. Proc. Natl.
Acad. Sci. USA 86,6245
-6249.
Bowtell, D. D. L., Lila, T., Michael, W. M., Hackett, D. and
Rubin, G. M. (1991). Analysis of the enhancer element that
controls expression of sevenless in the developing Drosophila eye.
Proc. Natl. Acad. Sci. USA
88,6853
-6857.
Brunner, D., Ducker, K., Oellers, N., Hafen, E., Scholz, H. and Klambt, C. (1994). The ETS domain protein pointed-P2 is a target of MAP kinase in the sevenless signal transduction pathway. Nature 370,386 -389.[CrossRef][Medline]
Bui, Q. T., Zimmerman, J. E., Liu, H., Gray-Board, G. L. and Bonini, N. M. (2000). Functional analysis of an eye enhancer of the Drosophila eyes absent gene: differential regulation by eye specification genes. Dev. Biol. 221,355 -364.[CrossRef][Medline]
Buratowski, S. and Chodosh, L. A. (2002). The mobility shift DNA binding assay using gel electrophoresis. In Current Protocols in Molecular Biology, Vol.2 (ed. F. M. Ausubel), pp.12.2.1 -12.2.11. New York: J. Wiley and Sons.
Burke, R. and Basler, K. (1996). Hedgehog-dependent patterning in the Drosophila eye can occur in the absence of Dpp signaling. Dev. Biol. 179,360 -368.[CrossRef][Medline]
Burke, R. and Basler, K. (1997). Hedgehog signaling in Drosophila eye and limb development conserved machinery, divergent roles? Curr. Opin. Neurobiol. 7, 55-61.[CrossRef][Medline]
Cagan, R. L. and Ready, D. F. (1989).
Notch is required for successive cell decisions in the developing
Drosophila retina. Genes Dev.
3,1099
-1112.
Cagan, R. L., Krämer, H., Hart, A. C. and Zipursky, S. L. (1992). The Bride of Sevenless and Sevenless interaction: internalization of a transmembrane ligand. Cell 69,393 -399.[CrossRef][Medline]
Chanut, F. and Heberlein, U. (1997a). Retinal morphogenesis in Drosophila: hints from an eye-specific decapentaplegic allele. Dev. Genet. 20,197 -207.[CrossRef][Medline]
Chanut, F. and Heberlein, U. (1997b). Role of decapentaplegic in initiation and progression of the morphogenetic furrow in the developing Drosophila retina. Development 124,559 -567.[Abstract]
Chen, R., Halder, G., Zhang, Z. and Mardon, G. (1999). Signaling by the TGF-ß homolog decapentaplegic functions reiteratively within the network of genes controlling retinal cell fate determination in Drosophila.Development 126,935 -943.[Abstract]
Curtiss, J. and Mlodzik, M. (2000). Morphogenetic furrow initiation and progression during eye development in Drosophila: the roles of decapentaplegic, hedgehog and eyes absent. Development 127,1325 -1336.[Abstract]
Dickson, B. (1995). Nuclear factors in Sevenless signaling. Trends Genet. 11,106 -111.[CrossRef][Medline]
DiNardo, S., Heemskerk, J., Dougan, S. and O'Farrell, P. H. (1994). The making of a maggot: patterning the Drosophila embryonic epidermis. Curr. Opin. Genet. Dev. 4, 529-534.[CrossRef][Medline]
Dominguez, M. (1999). Dual role for Hedgehog in the regulation of the proneural gene atonal during ommatidia development. Development 126,2345 -2553.[Abstract]
Domínguez, M. and Hafen, E. (1997).
Hedgehog directly controls initiation and propagation of retinal
differentiation in the Drosophila eye. Genes
Dev. 11,3254
-3264.
Duncan, I. W. (2002). Transvection effects in Drosophila. Annu. Rev. Genet. 36,521 -556.[CrossRef][Medline]
Frankfort, B. J., Nolo, R., Zhang, Z., Bellen, H. and Mardon, G. (2001). senseless repression of rough is required for R8 photoreceptor differentiation in the developing Drosophila eye. Neuron 32,403 -414.[CrossRef][Medline]
Fu, W. and Baker, N. E. (2003). Deciphering
synergistic and redundant roles of Hedgehog, Decapentaplegic and Delta that
drive the wave of differentiation in Drosophila eye development.
Development 130,5229
-5239.
Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrús, A.
and Shotwell, S. L. (1982). Monoclonal antibodies against the
Drosophila nervous system. Proc. Natl. Acad. Sci.
USA 79,7929
-7933.
García-Bellido, A., Lawrence, P. A. and Morata, G. (1979). Compartments in animal development. Sci. Am. 241,102 -110.
Greenwood, S. and Struhl, G. (1999). Progression of the morphogenetic furrow in the Drosophila eye: the roles of Hedgehog, Decapentaplegic and the Raf pathway. Development 126,5795 -5808.[Abstract]
Halfon, M. S., Carmena, A., Gisselbrecht, S., Sackerson, C. M., Jimenez, F., Baylies, M. K. and Michelson, A. M. (2000). Ras pathway specificity is determined by the integration of multiple signal-activated and tissue-restricted transcription factors. Cell 103,63 -74.[CrossRef][Medline]
Heberlein, U. and Rubin, G. M. (1990).
Structural and functional comparisons of the Drosophila virilis and
Drosophila melanogaster rough genes. Proc. Natl. Acad.
Sci. USA 87,5916
-5920.
Heberlein, U. and Moses, K. (1995). Mechanisms of Drosophila retinal morphogenesis: the virtues of being progressive. Cell 81,987 -990.[CrossRef][Medline]
Heberlein, U., Wolff, T. and Rubin, G. M. (1993). The TGFß homolog dpp and the segment polarity gene hedgehog are required for propagation of a morphogenetic wave in the Drosophila retina. Cell 75,913 -926.[CrossRef][Medline]
Heberlein, U., Singh, C. M., Luk, A. Y. and Donohoe, T. J. (1995). Growth and differentiation in the Drosophila eye coordinated by hedgehog. Nature 373,709 -711.[CrossRef][Medline]
Heemskerk, J. and DiNardo, S. (1994). Drosophila hedgehog acts as a morphogen in cellular patterning. Cell 76,449 -460.[CrossRef][Medline]
Hidalgo, A. (1996). The roles of engrailed.Trends Genet. 12,1 -4.[CrossRef][Medline]
Hooper, J. E. (1994). Distinct pathways for autocrine and paracrine Wingless signalling in Drosophila embryos. Nature 372,461 -464.[CrossRef][Medline]
Ingham, P. W. and Martinez-Arias, A. (1992). Boundaries and fields in early embryos. Cell 68,221 -235.[CrossRef][Medline]
Ives, P. (1950). New mutants report: bar-3. Dros. Inf. Serv. 24,58 .
Kauffmann, R. C., Li, S., Gallagher, P. A., Zhang, J. and
Carthew, R. W. (1996). Ras1 signaling and transcriptional
competence in the R7 cell of Drosophila. Genes Dev.
10,2167
-2178.
Klämbt, C. (1993). The Drosophila
gene pointed encodes two ETS-like proteins which are involved in the
development of the midline glial cells. Development
117,163
-176.
Kornberg, T. B. and Tabata, T. (1993). Segmentation of the Drosophila embryo. Curr. Opin. Genet. Dev. 3,585 -594.[CrossRef][Medline]
Kumar, J. P. and Moses, K. (2001). Expression of evolutionarily conserved eye specification genes during Drosophila embryogenesis. Genes Dev. Evol. 211,406 -414.
Kumar, J. P., Tio, M., Hsiung, F., Akopyan, S., Gabay, L., Seger, R., Shilo, B.-Z. and Moses, K. (1998). Dissecting the roles of the Drosophila EGF receptor in eye development and MAP kinase activation. Development 125,3875 -3885.[Abstract]
Lawrence, P. A. (1981). The cellular basis of segmentation in insects. Cell 26, 3-10.[CrossRef][Medline]
Lee, J. J., von Kessler, D. P., Parks, S. and Beachy, P. A. (1992). Secretion and localized transcription suggest a role in positional signaling for products of the segmentation gene hedgehog.Cell 71,33 -50.[CrossRef][Medline]
Lee, J. J., Ekker, S. C., von Kessler, D. P., Porter, J. A.,
Sun, B. I. and Beachy, P. A. (1994). Autoproteolysis
in Hedgehog protein biogenesis. Science
266,1528
-1537.
Lewis, E. B. (1954). The theory and application of a new method of detecting chromosomal rearrangements in Drosophila.Am. Nat. 88,225 -239.[CrossRef]
Li, W., Ohlmeyer, J. T., Lane, M. E. and Kalderon, D. (1995). Function of protein kinase A in Hedgehog signal transduction and Drosophila imaginal disc development. Cell 80,553 -562.[CrossRef][Medline]
Lum, L. and Beachy, P. A. (2004). The Hedgehog
response network: sensors, switches, and routers.
Science 304,1755
-1759.
Ma, C. and Moses, K. (1995). wingless and patched are negative regulators of the morphogenetic furrow and can affect tissue polarity in the developing Drosophila compound eye. Development 121,2279 -2289.[Abstract]
Ma, C., Zhou, Y., Beachy, P. A. and Moses, K. (1993). The segment polarity gene hedgehog is required for progression of the morphogenetic furrow in the developing Drosophila eye. Cell 75,927 -938.[CrossRef][Medline]
Ma, C., Liu, H., Zhou, Y. and Moses, K. (1996). Identification and characterization of autosomal genes that interact with glass in the developing Drosophila eye. Genetics 142,1199 -1213.[Abstract]
Mann, R. S. and Carroll, S. B. (2002). Molecular mechanisms of selector gene function and evolution. Curr. Opin. Genet. Dev. 12,592 -600.[CrossRef][Medline]
Mardon, G., Solomon, N. M. and Rubin, G. M. (1994). dachshund encodes a nuclear protein required for normal eye and leg development in Drosophila.Development 120,3473 -3486.[Abstract]
Mohler, J. (1988). Requirements for
hedgehog, a segmental polarity gene, in patterning larval and adult
cuticle of Drosophila. Genetics
120,1061
-1072.
Morata, G. and Lawrence, P. A. (1977). Homoeotic genes, compartments and cell determination in Drosophila.Nature 265,211 -216.[CrossRef][Medline]
Muller, H. J. (1932). Further studies on the nature and causes of gene mutations. In Intern. Congress Genet., vol. 1 (ed. D. F. Jones), pp.213 -255. Brooklyn, NY: Brooklyn Botanic Garden.
Nolo, R., Abbott, L. A. and Bellen, H. J. (2000). Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila.Cell 102,349 -362.[CrossRef][Medline]
O'Neill, E. M., Rebay, I., Tjian, R. and Rubin, G. M. (1994). The activities of two Ets-related transcription factors required for Drosophila eye development are modulated by the Ras/MAPK pathway. Cell 78,137 -147.[CrossRef][Medline]
Pappu, K. S., Chen, R., Middlebrooks, B. W., Woo, C., Heberlein,
U. and Mardon, G. (2003). Mechanism of
hedgehog signaling during Drosophila eye development.
Development 130,3053
-3062.
Park, M., Wu, X., Golden, K., Axelrod, J. D. and Bodmer, R. (1996). The wingless signaling pathway is directly involved in Drosophila heart development. Dev. Biol. 177,104 -116.[CrossRef][Medline]
Pauli, T., Seimiya, M., Blanco, J. and Gehring, W. J.
(2005). Identification of functional sine oculis motifs
in the autoregulatory element of its own gene, in the eyeless enhancer and in
the signalling gene hedgehog. Development
132,2771
-2782.
Perrimon, N. (1994). The genetic basis of patterned baldness in Drosophila. Cell 76,781 -784.[CrossRef][Medline]
Pignoni, F. and Zipursky, S. L. (1997). Induction of Drosophila eye development by Decapentaplegic. Development 124,271 -278.[Abstract]
Punzo, C., Seimiya, M., Flister, S., Gehring, W. J. and Plaza,
S. (2002). Differential interactions of eyeless and
twin of eyeless with the sine oculis enhancer.
Development 129,625
-634.
Ready, D. F., Hanson, T. E. and Benzer, S. (1976). Development of the Drosophila retina, a neurocrystalline lattice. Dev. Biol. 53,217 -240.[CrossRef][Medline]
Royet, J. and Finkelstein, R. (1996). hedgehog, wingless and orthodenticle specify adult head development in Drosophila. Development 122,1849 -1858.[Abstract]
Royet, J. and Finkelstein, R. (1997). Establishing primordia in the Drosophila eye-antennal imaginal disc: the roles of decapentaplegic, wingless and hedgehog.Development 124,4793 -4800.[Abstract]
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element
vectors. Science 218,348
-353.
Rubin, G. M., Chang, H. C., Karim, F., Laverty, T., Michaud, N.
R., Morrison, D. K., Rebay, I., Tang, A., Therrien, M. and Wassarman,
D. A. (1997). Signal transduction downstream from Ras in
Drosophila. Cold Spring Harb. Symp. Quant. Biol.
62,347
-352.
Scholz, H., Deatrick, J., Klaes, A. and Klambt, C. (1993). Genetic dissection of pointed, a Drosophila gene encoding two ETS-related proteins. Genetics 135,455 -468.[Abstract]
Shyamala, B. V. and Bhat, K. M. (2002). A positive role for patched-smoothened signaling in promoting cell proliferation during normal head development in Drosophila.Development 129,1839 -1847.
Struhl, G. (1981). A blastoderm fate map of compartments and segments of the Drosophila head. Dev. Biol. 84,386 -396.[CrossRef]
Strutt, D. I. and Mlodzik, M. (1996). The regulation of hedgehog and decapentaplegic during Drosophila eye imaginal disc development. Mech. Dev. 58,39 -50.[CrossRef][Medline]
Strutt, D. I. and Mlodzik, M. (1997). Hedgehog is an indirect regulator of morphogenetic furrow progression in the Drosophila eye disc. Development 124,3233 -3240.[Abstract]
Strutt, D. I., Wiersdorff, V. and Mlodzik, M. (1995). Regulation of furrow progression in the Drosophila eye by cAMP-dependent protein kinase A. Nature 373,705 -709.[CrossRef][Medline]
Sun, Y., Jan, L. Y. and Jan, Y. N. (1998). Transcriptional regulation of atonal during development of the Drosophila peripheral nervous system. Development 125,3731 -3740.[Abstract]
Tio, M. and Moses, K. (1997). The
Drosophila TGF
homolog Spitz acts in photoreceptor recruitment
in the developing retina. Development
124,343
-351.[Abstract]
Tomlinson, A. (1985). The cellular dynamics of pattern formation in the eye of Drosophila. J. Embryol. Exp. Morph. 89,313 -331.[Medline]
Tomlinson, A. (1988). Cellular interactions in the developing Drosophila eye. Development 104,183 -193.[Medline]
Tomlinson, A. and Ready, D. F. (1987). Neuronal differentiation in the Drosophila ommatidium. Dev. Biol. 120,366 -376.[CrossRef][Medline]
Treisman, J. E. and Rubin, G. M. (1995). wingless inhibits morphogenetic furrow movement in the Drosophila eye disc. Development 121,3519 -3527.[Abstract]
Voas, M. G. and Rebay, I. (2004). Signal integration during development: Insights from the Drosophila eye. Dev. Dyn. 229,162 -175.[CrossRef][Medline]
White, N. M. and Jarman, A. P. (2000). Drosophila atonal controls photoreceptor R8-specific properties and modulates both Receptor Tyrosine Kinase and Hedgehog signalling. Development 127,1681 -1689.[Abstract]
Wiersdorff, V., Lecuit, T., Cohen, S. M. and Mlodzik, M. (1996). Mad acts downstream of Dpp receptors, revealing a differential requirement for dpp signaling in initiation and propagation of morphogenesis in the Drosophila eye. Development 122,2153 -2162.[Abstract]
Wolff, T. and Ready, D. F. (1993). Chapter 22, Pattern formation in the Drosophila retina. In The development of Drosophila melanogaster, vol.2 (ed. M. Bate and A. Martinez-Arias), pp.1277 -1325, New York: Cold Spring Harbor Laboratory Press.
Xu, C., Kauffmann, R. C., Zhang, J., Kladny, S. and Carthew, R. W. (2000). Overlapping activators and repressors delimit transcriptional response to receptor tyrosine kinase signals in the Drosophila eye. Cell 103, 87-97.[CrossRef][Medline]
Yang, L. and Baker, N. E. (2001). Role of the EGFR/Ras/Raf pathway in specification of photoreceptor cells in the Drosophila retina. Development 128,1183 -1191.[Abstract]
Yang, L. and Baker, N. E. (2003). Cell cycle withdrawal, progression, and cell survival regulation by Egfr and its effectors in the differentiating Drosophila eye. Dev. Cell 4,359 -369.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||