|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 12 October 2005
doi: 10.1242/dev.02084
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 European Molecular Biology Laboratory (EMBL), Meyerhofstrasse 1, 69117
Heidelberg, Germany
2 Max-Planck Institute of Molecular Cell Biology and Genetics,
Pfotenhauerstrasse 108, 01307 Dresden, Germany
* Author for correspondence (e-mail: carl.neumann{at}embl-heidelberg.de)
Accepted 9 September 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Zebrafish, HSPG, Fgf10, Limb development, Ext, Heparan, Heparin
| Introduction |
|---|
|
|
|---|
The exostosin (ext) gene family has been shown to encode
glycosyltransferases that synthesise the polymerisation of HS side chains of
HSPGs (reviewed by Zak et al.,
2002
). Vertebrate exostosin genes include Ext1 and
Ext2, as well as the exostosin-like genes Extl1, Extl2, and
Extl3. In Drosophila, 3 exostosin genes have been
identified: ext1, ext2 and extl3
(Bornemann et al., 2004
;
Han et al., 2004
;
Takei et al., 2004
). All three
Drosophila exostosin genes participate in shaping the extracellular
morphogen gradients of Hh, Dpp/Bmp and Wg/Wnt, as well as regulating their
signalling activity (reviewed by Lin,
2004
). Interestingly, the effect of Exostosins on specific
signalling proteins is context dependent. For example, although all three
Drosophila exostosins are crucial for Dpp/Bmp signalling in the wing
imaginal disc, they have no effect on Dpp/Bmp signalling during embryogenesis
(The et al., 1999
;
Bornemann et al., 2004
;
Han et al., 2004
;
Takei et al., 2004
). Likewise,
neither Hh, nor Wg/Wnt signalling is defective in ext2 mutants during
embryogenesis (The et al.,
1999
), indicating that the control of developmental signalling by
HSPGs is both signal and context dependent.
Fibroblast growth factors (Fgfs) comprise a large family of signalling
molecules involved in regulating many cellular responses during development,
and often participate in reciprocal signalling across epithelial-mesenchymal
boundaries (reviewed by Ornitz,
2000
; Itoh and Ornitz,
2004
). A well-studied process in which Fgfs mediate
epithelial-mesenchymal interactions is during limb development (reviewed by
Johnson and Tabin, 1997
;
Martin, 1998
;
Tickle and Munsterberg, 2001
).
Fgf10 is expressed in the limb bud mesenchyme at very early stages in mouse
and chicken embryos, and is required for the activation of genes expressed in
the overlying apical ectodermal ridge (AER), including Fgf4 and Fgf8
(Ohuchi et al., 1997
;
Min et al., 1998
;
Sekine et al., 1999
). Fgf10
binds with highest affinity to the Fgfr2b splice variant of Fgf receptor 2,
which is expressed in epithelial cells, whereas Fgf4 and Fgf8 have highest
affinity for mesenchymally expressed Fgfr2c
(Orr-Urtreger et al., 1993
;
Ornitz et al., 1996
). This
scenario suggests a model in which Fgf10 signals to Fgfr2b in the overlying
ectoderm, leading to activation of Fgf4 and Fgf8, which then signal back to
the mesenchyme via Fgfr2c to maintain Fgf10 expression. Thus, a positive
feedback loop is formed, based on mutual dependence (reviewed by
Xu et al., 1999
). As in mouse
and chick, the zebrafish fgf10 gene is expressed in the mesenchyme of
the pectoral fin buds, which are homologous to tetrapod limb buds
(Ng et al., 2002
). Following
initiation of outgrowth, the limb field becomes patterned along three main
axes (Johnson and Tabin, 1997
;
Martin, 1998
;
Capdevila and Izpisua Belmonte,
2001
). Signals from the AER control limb outgrowth along the
proximodistal axis. The anteroposterior axis is patterned by Shh secreted from
the zone of polarising activity (ZPA). Finally, the limb bud is patterned
along its dorsoventral axis, leading to expression of Wnt7a and
Eng1 in dorsal and ventral ectoderm, respectively.
A number of biochemical studies have implicated HS in the regulation of Fgf
signalling (reviewed in Ornitz,
2000
). Structural studies have led to the proposal that either one
HS chain forms a ternary complex with one Fgf and one Fgfr molecule
(Schlessinger et al., 2000
),
or that one HS chain binds to two Fgf molecules to form a dimer bridging two
receptors (Pellegrini et al.,
2000
). Interestingly, as distinct Fgfs differ in the amino acid
sequence of their heparin-binding sites, they may have distinct requirements
for HS to exert their biological activities
(Bellosta et al., 2001
).
However, in contrast to the wealth of biochemical data, there is a scarcity of
in vivo studies addressing the role of HS in Fgf signalling. The first genetic
evidence for a role of HSPGs in Fgf signalling came from the observation that
Drosophila mutants in UDP-glucose dehydrogenase, an enzyme which
catalyses the formation of an essential building block of HS polysaccharides,
are defective for Fgf signalling (Lin et
al., 1999
). Recently, a mouse mutant disrupting the same gene was
shown to cause gastrulation defects owing to abrogation of Fgf8 signalling
(Garcia-Garcia and Anderson,
2003
).
Exostosins have so far not been directly linked to Fgf signalling in vivo.
Ext1 knockout mice die early, as a result of defective gastrulation
(Lin et al., 2000
). In these
mutants, Indian Hedgehog (Ihh) protein fails to associate with the surface of
target cells, suggesting a role for Ext1 in Hh signalling. This proposal is
further supported by the observation that Ext1 hypomorphic mutations result in
an increase in the range of Ihh signalling during bone development
(Koziel et al., 2004
).
Conditional inactivation of Ext1 in the mouse brain leads to a number of
defects, some of which may be caused by a reduction of Fgf8 signalling
(Inatani et al., 2003
). The
zebrafish mutants dackel and boxer disrupt ext2 and
extl3 respectively, and these genes are required for axon sorting in
the optic tract (Lee et al.,
2004
). Ext2 and Extl3 are broadly and uniformly expressed during
embryogenesis, and disruption of both genes causes a global reduction in HS
levels (Lee et al., 2004
).
Both dackel and boxer were originally isolated on the basis
of their defective pectoral fin development
(van Eeden et al., 1996
), and
dackel is known to be required for AER maintenance in the pectoral
fin bud (Grandel et al.,
2000
).
In this study, we investigate how ext2 and extl3 mutants affect Fgf signalling during limb development. We show that like ext2, extl3 is required for AER maintenance, although its phenotype is weaker and more variable than that of ext2. Both ext2 and extl3 show a very similar phenotype to daedalus, a novel zebrafish pectoral fin mutant. We find that daedalus disrupts fgf10, thus suggesting that Fgf10 signalling is affected by Ext2 and Extl3. Consistent with this hypothesis, we find that a partial reduction of fgf10 levels leads to a strong enhancement of the extl3 limb phenotype. Furthermore, application of Fgf10 protein rescues target gene expression in fgf10 mutants, but not in ext2 or extl3 mutants, suggesting that activity of these genes is necessary for Fgf10 signalling. Interestingly, application of Fgf4 protein can activate target genes in both ext2 and extl3 mutants, thus revealing an unexpected specificity for HSPGs in regulating signalling by distinct vertebrate Fgf ligands.
| Materials and methods |
|---|
|
|
|---|
Linkage analysis, genetic mapping, cloning and sequencing
For fine mapping of dae, SSLPs were generated by using a zebrafish
SSR search website
(http://danio.mgh.harvard.edu/markers/ssr.html)
in combination with the Sanger genome database. The closest SSLP marker to the
dae mutation uses the primer pair TCGTCTGTCAGCTCAACCCTA (forward) and
GGTACTAAGTGAAGCACTCTTACTCT (reverse), at a distance of 0.286 cM (2/698
meioses) upstream of the mutation. The PCR primers CAGACACGATCACTACGGACGCTTTAC
(forward) and AGCTTGACTAAATTCGGATGGTAGGAT (reverse) were designed to amplify a
1061 bp fragment of DNA that included the entire fgf10 open reading
frame. rtPCR was performed using cDNA from both sibling and mutant embryos,
followed by cloning of the fragment in the TOPO TA vector (Invitrogen) for
sequence analysis.
Microinjection of morpholino oligonucleotides
Fgf10 splice morpholino oligonucleotide (MO) was purchased from GeneTools.
The MO, designed to target the exon2-intron2 splice junction, has the sequence
GAAAATGATGCTCACCGCCCCGTAG (e2i2 MO). A MO stock solution was formed by
dilution in water and was stored at 20°C prior to use. Embryos were
injected at the single cell stage with 0.125 mM MO, allowed to develop for 3
days and were then scored for pectoral fin phenotype. Embryos were snap frozen
in liquid nitrogen and RNA was subsequently extracted. To confirm splicing
defects following MO injection, rtPCR was carried out using the Superscriptase
II kit (Invitrogen) and the Fgf10F and Fgf10R primers described above.
Histochemical methods
In situ hybridisation was performed as previously described
(Macdonald et al., 1994
). The
following mRNA in situ probes were used: bmp2b
(Martinez-Barbera et al.,
1997
), dlx2a (Akimenko
et al., 1994
), dusp6
(Kawakami et al., 2003
),
eng1a (Ekker et al.,
1992
), erm1 (Roehl
and Nusslein-Volhard, 2001
), fgf4
(Grandel et al., 2000
),
fgf8 (Reifers et al.,
1998
), fgf10 (Ng et
al., 2002
), fgf24
(Fischer et al., 2003
),
pea3 (Roehl and Nusslein-Volhard,
2001
), shh (Krauss et
al., 1993
), sp8
(Kawakami et al., 2004
),
sp9 (Kawakami et al.,
2004
), wnt3l (Krauss
et al., 1992
) and wnt7a (see below). Alcian Blue staining
of cartilage was performed as described previously
(Grandel and Schulte-Merker,
1998
). Histological sections were obtained by staining
cryosections with Methylene Blue (Humphrey
and Pittman, 1974
).
Cloning of zebrafish wnt7a
A novel gene encoding a zebrafish wnt7a orthologue was identified
as lying between 21837919 and 21842385 bp on chromosome 11 using the zebrafish
genome server
(http://www.ensembl.org/danio_rerio).
rtPCR was performed using the Superscriptase II kit (Invitrogen) and the
following primers: GCCGCTGGATTTTTCACAT (wnt7aF); TGTGTACACTTCTGTCCGTTCACT
(wnt7aR). The amplified fragment was cloned in the TOPO TA vector (Invitrogen)
and was sequenced and analysed to confirm its identity (see Fig. S1 in the
supplementary material).
Bead implantation
Bead implantation was carried out as described previously
(Grandel et al., 2000
).
Recombinant human Fgf4 and Fgf10 protein (R&D systems) was dissolved at a
concentration of 1 µg/µl in phosphate-buffered saline with 0.1% bovine
serum albumin. All batches of beads loaded with Fgf10 were tested by
implantation into dae embryos, and assayed for gene rescue, before
using the same batch to implant beads into dak or box mutant
embryos.
| Results |
|---|
|
|
|---|
Molecular characterisation of daedalus
To define the molecular function of dae, we identified the gene
disrupted by the dae mutation
(Fig. 2). Initial bulk
segregant analysis of pools of 48 sibling and 48 mutant embryos placed the
dae locus on linkage group 21
(Fig. 2A). Fine mapping using
both previously available and novel simple sequence length polymorphisms
(SSLPs), placed dae within an interval that corresponds to 0.97 cM.
Of five genes located between the two closest SSLP markers, fgf10 was
the best candidate for the mutated gene
(Fig. 2A). We cloned and
sequenced the entire fgf10 open reading frame of both dae
alleles. daetbvbo was found to have a lysine (aaa) to stop
(taa) change at amino acid position 5, thus generating a protein null allele.
daet24030 encodes an amino acid substitution of methionine
(atg) to valine (gtg) at position 170 (Fig.
2B). To further confirm that disruption of fgf10 causes
the dae phenotype, we designed a morpholino (MO) to target the
exon2-intron2 splice junction of fgf10 (e2i2 MO;
Fig. 2B) and injected this into
wild-type embryos at the single cell stage. Injected embryos showed a striking
dae phenocopy (52% injected embryos;
Fig. 2D). We analysed splicing
defects following MO injection by extracting RNA from morphant embryos and
performing rtPCR. As expected, the morphant rtPCR reaction predominantly
generated a smaller band than the full-length transcript found in uninjected
siblings (Fig. 2E), confirming
that aberrant splicing had occurred (Draper
et al., 2001
). Taken together, these data indicate that
dae disrupts the zebrafish fgf10 gene.
|
|
|
Targets of Fgf signalling are down regulated in fgf10/dae mutants
We next analysed the expression of several genes known to be targets of Fgf
signalling during limb development. shh, which is expressed in the
zone of polarising activity (ZPA), depends on Fgf4 and Fgf8 signalling from
the AER (Sun et al., 2002
). At
28 hpf, we detected normal expression of shh in fgf10/dae
fin buds (Fig. 4A,B), but we
observed a strong reduction of shh expression by 38 hpf
(Fig. 4C,D). Similarly, the
expression of direct Fgf target genes such as pea3, erm1
(Roehl and Nusslein-Volhard,
2001
) and dusp6 (formerly mkp3)
(Kawakami et al., 2003
) was
present at 28 hpf, but absent by 38 hpf of development
(Fig. 4E-O), although
expression of pea3 and dusp6 is already weakly reduced in
fgf10/dae at 28 hpf (Fig.
4E,F,L,M). We then analysed markers of the dorsoventral (DV) axis
expressed in the ectoderm, which might depend on Fgf10 signalling from the
underlying mesenchyme. The expression of eng1a in the ventral
ectoderm is weakly reduced at 28 hpf (Fig.
5A,B), but virtually absent by 38 hpf
(Fig. 5C,D). We also examined
the expression of zebrafish wnt7a, which is expressed in the dorsal
ectoderm, as observed in other vertebrate species
(Capdevila and Izpisua Belmonte,
2001
). We find that, similar to eng1a, wnt7a expression
is present in fgf10/dae mutants at 28 hpf
(Fig. 5E,F), but is absent at
38 hpf (Fig. 5G,H). Together,
these results indicate that Fgf-dependent marker gene expression is initially
established in zebrafish fgf10 mutants, but is lost by around 36 hpf
of development. Similarly, expression of eng1a in the ventral
ectoderm, and wnt7a in the dorsal ectoderm is initiated normally in
the absence of Fgf10, but is subsequently downregulated.
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
As AER expression of sp8 and bmp2b is already reduced in fgf10 mutants at early stages, our results suggest that fgf10 contributes to initial AER induction, and is then uniquely required for AER maintenance. In agreement with this, the majority of AER expressed genes we examined (including sp9, dlx2a and wnt3l) were strongly reduced by 28 hpf. The early expression of shh and Fgf target genes in the zebrafish may thus be independent of the AER, and might instead be directed by Fgf24 in the mesenchyme. This would be in contrast to the situation in tetrapods, where shh activation depends on the AER from the very beginning.
|
|
Intriguingly, no fgf24 orthologue is present in tetrapod genomes,
although it can be found in sharks (Draper
et al., 2003
). As sharks diverged from the ancestors of teleosts
before tetrapods, this suggests that fgf24 was initially present, but
then lost during the evolution of land vertebrates. To allow for this loss,
other Fgf genes must have taken over the function of fgf24 in
tetrapods. These Fgf genes include fgf8 during posterior mesoderm
development (Draper et al.,
2003
), and fgf10 during early limb development
(Fischer et al., 2003
) (this
study).
Fgf4 directs wnt7a and eng1a expression in the ectoderm
Our data demonstrate that expression of eng1a and wnt7a,
respective markers of the ventral and dorsal limb ectoderm, depend on Fgf10
signalling as they are lost in fgf10/dae mutants. However, as AER
signalling is also abrogated in these mutants, it is not clear how direct this
effect is. Our gain-of-function experiments show that Fgf4, which is expressed
in the AER, can rescue both eng1a and wnt7a expression in
the absence of fgf10/dae activity. Although we cannot exclude the
possibility that Fgf10 also activates these genes directly, our results show
that failure of Fgf4 signalling from the AER is sufficient to explain why
eng1a and wnt7a are lost in fgf10 mutants. This
implies that the effect of Fgf10 signalling on eng1a and
wnt7a expression is mediated by activation of fgf4
expression in the AER, which in turn signals to dorsal and ventral ectoderm.
Fgf4 protein is unable to rescue fgf8 expression in the AER of
fgf10/dae mutants, consistent with the proposal that mesenchymal
Fgf10 signals to the overlying AER through Fgfr2b, whereas Fgf4 signals
through Fgfr2c. Thus, our results confirm that Fgf4 is unable to replace Fgf10
signalling to the AER, and indicate that this response can only be triggered
via Fgf10. It remains to be determined through which receptor Fgf4 activates
wnt7a and eng1a expression in the ectoderm.
HSPG synthesis by Ext2 and Extl3 is required for Fgf10 signalling during limb development
We have shown here that the failure of AER maintenance in
fgf10/dae mutants is very similar to that previously described in
ext2/dak mutants (Grandel et al.,
2000
). In addition, we have shown that extl3/box mutants
have similar defects in AER maintenance, although their phenotype is weaker
than that of the other two mutants. These results suggest that these three
genes act in the same pathway required for AER maintenance. This proposal is
further supported by the observation that genetic removal of one copy of
fgf10/dae dramatically enhances the severity of the
extl3/box phenotype. The weaker phenotype of extl3/box
mutants correlates well with the observation that extl3/box mutants
have a weaker reduction of HS levels than ext2/dak mutants
(Lee et al., 2004
). As Ext2
and Extl3 are required for the polymerisation of HS side chains on HSPGs,
these results suggest that HSPG synthesised by Ext2 and Extl3 is required for
Fgf10 function. Our gain-of-function data provide direct evidence for this
possibility, as application of Fgf10 protein is able to rescue target gene
expression in fgf10/dae mutants, but not in ext2/dak or
extl3/box mutants. Furthermore, transplantation of wild-type cells
into the epidermis of ext2/dak fin buds has been shown to enable a
local rescue of AER development (Grandel
et al., 2000
). Taken together, these results suggest that HSPG
synthesis by Ext2 and Extl3 in the fin bud ectoderm is required for ectodermal
cells to respond to Fgf10 protein secreted by the underlying mesenchyme.
Specificity of HSPGs in modulating signalling by distinct signalling factors
The pectoral fin phenotype of ext2/dak and extl3/box
mutants strongly resembles that of fgf10/dae mutants, but not that of
fgf24 mutants. Therefore, HSPGs appear to be differentially required
for Fgf10 signalling during limb development. In direct support of this
proposal, we find that both ext2/dak and extl3/box mutants
are able to respond to application of Fgf4 protein, but are unable to respond
to Fgf10 protein. This agrees well with the observation that distinct Fgfs
differ in the amino acid composition of their heparin-binding residues
(Bellosta et al., 2001
). Taken
together, these results indicate that distinct Fgfs have different
requirements for HS in vivo.
Interestingly, both Fgf4 and Fgf24 belong to the subgroup of Fgf ligands
with preference for Fgfr2c, whereas Fgf10 belongs to the subgroup with
preference for Fgfr2b (Orr-Urtreger et
al., 1993
; Ornitz et al.,
1996
; Fischer et al.,
2003
), raising the possibility that these classes of Fgfs may have
differential requirements for HS in vivo. Alternatively, the different
receptor subtypes might determine the role played by HS during receptor
binding and activation. Arguing against this hypothesis is the observation
that conditional removal of Ext1 activity from the mouse CNS results in
several phenotypes that may be caused by abrogated Fgf8 signalling
(Inatani et al., 2003
), as
Fgf8 also signals preferentially through Fgfr2c. Another possibility could be
that Fgf signalling to the mesenchyme might be much less HSPG dependent than
signalling to the ectoderm. This is unlikely, however, given that Fgf4 can
activate ectodermal eng1a and wnt7a expression in
ext2/dak mutants.
The Drosophila Exostosin genes have been shown to be crucial for
Hh distribution and signalling during imaginal disc development (reviewed by
Nybakken and Perrimon, 2002
;
Lin, 2004
). Similarly, mouse
mutations in Ext1 affect Ihh distribution and signalling
(Lin et al., 2000
;
Koziel et al., 2004
). It is
therefore surprising that none of the phenotypes of ext2/dak and
extl3/box can be linked to Hh signalling. During limb development,
signalling by Shh is clearly not affected in these mutants, as rescue of Shh
expression in ext2/dak mutant fin buds, by application of Fgf4 beads,
leads to normal activation of the Hh dependent target genes hoxd11
and hoxd13 (Grandel et al.,
2000
).
Although it is possible that some signalling factors do not require the
presence of any HSPGs for their function, at least in some cellular contexts,
an alternative possibility is that different factors require different levels
of HSPGs in different contexts. As overall HS levels are strongly reduced, but
not absent, in ext2/dak and extl3/box mutants
(Lee et al., 2004
), this might
be an indication that signalling by Fgf10 requires much higher levels of HS
than other signalling events during limb development.
Taken together, these results indicate that the effect of HSPGs on
cell-cell signalling is both signal and context dependent. This provides an
explanation of why the phenotypes of ext2/dak and extl3/box
mutants are so discrete and specific, even though both genes are broadly
expressed (Lee et al., 2004
),
and their disruption causes a global reduction of HS levels. Because of this
specificity in the control of developmental signalling by HSPGs, it will be
critical to identify the exact signalling factors modulated by HSPGs in
different organs and cell types in vivo, in order to better understand the
biological relevance of this mechanism of signal regulation.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/22/4963/DC1
| REFERENCES |
|---|
|
|
|---|
Akimenko, M. A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994). Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J. Neurosci. 14,3475 -3486.[Abstract]
Bellosta, P., Iwahori, A., Plotnikov, A. N., Eliseenkova, A. V.,
Basilico, C. and Mohammadi, M. (2001). Identification of
receptor and heparin binding sites in fibroblast growth factor 4 by
structure-based mutagenesis. Mol. Cell. Biol.
21,5946
-5957.
Bornemann, D. J., Duncan, J. E., Staatz, W., Selleck, S. and
Warrior, R. (2004). Abrogation of heparan sulfate synthesis
in Drosophila disrupts the Wingless, Hedgehog and Decapentaplegic signaling
pathways. Development
131,1927
-1938.
Capdevila, J. and Izpisua Belmonte, J. C. (2001). Patterning mechanisms controlling vertebrate limb development. Annu. Rev. Cell Dev. Biol. 17, 87-132.[CrossRef][Medline]
Castresana, J. (2000). Selection of conserved
blocks from multiple alignments for their use in phylogenetic analysis.
Mol. Biol. Evol. 17,540
-552.
Draper, B. W., Morcos, P. A. and Kimmel, C. B. (2001). Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: a quantifiable method for gene knockdown. Genesis 30,154 -156.[CrossRef][Medline]
Draper, B. W., Stock, D. W. and Kimmel, C. B.
(2003). Zebrafish fgf24 functions with fgf8 to promote posterior
mesodermal development. Development
130,4639
-4654.
Ekker, M., Wegner, J., Akimenko, M. A. and Westerfield, M. (1992). Coordinate embryonic expression of three zebrafish engrailed genes. Development 116,1001 -1010.[Abstract]
Esko, J. D. and Selleck, S. B. (2002). Order out of chaos: assembly of ligand binding sites in heparan sulfate. Annu. Rev. Biochem. 71,435 -471.[CrossRef][Medline]
Fischer, S., Draper, B. W. and Neumann, C. J.
(2003). The zebrafish fgf24 mutant identifies an additional level
of Fgf signaling involved in vertebrate forelimb initiation.
Development 130,3515
-3524.
Garcia-Garcia, M. J. and Anderson, K. V. (2003). Essential role of glycosaminoglycans in Fgf signaling during mouse gastrulation. Cell 114,727 -737.[CrossRef][Medline]
Grandel, H. and Schulte-Merker, S. (1998). The development of the paired fins in the zebrafish (Danio rerio). Mech. Dev. 79,99 -120.[CrossRef][Medline]
Grandel, H., Draper, B. W. and Schulte-Merker, S. (2000). dackel acts in the ectoderm of the zebrafish pectoral fin bud to maintain AER signaling. Development 127,4169 -4178.[Abstract]
Habeck, H., Odenthal, J., Walderich, B., Maischein, H. and Schulte-Merker, S. (2002). Analysis of a zebrafish VEGF receptor mutant reveals specific disruption of angiogenesis. Curr. Biol. 12,1405 -1412.[CrossRef][Medline]
Han, C., Belenkaya, T. Y., Khodoun, M., Tauchi, M. and Lin,
X. (2004). Distinct and collaborative roles of Drosophila EXT
family proteins in morphogen signalling and gradient formation.
Development 131,1563
-1575.
Humphrey, C. D. and Pittman, F. E. (1974). A simple methylene blue-azure II-basic fuchsin stain for epoxy-embedded tissue sections. Stain Technol. 49, 9-14.[Medline]
Inatani, M., Irie, F., Plump, A. S., Tessier-Lavigne, M. and
Yamaguchi, Y. (2003). Mammalian brain morphogenesis and
midline axon guidance require heparan sulfate. Science
302,1044
-1046.
Itoh, N. and Ornitz, D. M. (2004). Evolution of the Fgf and Fgfr gene families. Trends Genet. 20,563 -569.[CrossRef][Medline]
Johnson, R. L. and Tabin, C. J. (1997). Molecular models for vertebrate limb development. Cell 90,979 -990.[CrossRef][Medline]
Kawakami, Y., Rodriguez-Leon, J., Koth, C. M., Buscher, D., Itoh, T., Raya, A., Ng, J. K., Esteban, C. R., Takahashi, S., Henrique, D. et al. (2003). MKP3 mediates the cellular response to FGF8 signalling in the vertebrate limb. Nat. Cell Biol. 5, 513-519.[CrossRef][Medline]
Kawakami, Y., Esteban, C. R., Matsui, T., Rodriguez-Leon, J.,
Kato, S. and Belmonte, J. C. (2004). Sp8 and Sp9, two closely
related buttonhead-like transcription factors, regulate Fgf8 expression and
limb outgrowth in vertebrate embryos. Development
131,4763
-4774.
Koziel, L., Kunath, M., Kelly, O. G. and Vortkamp, A. (2004). Ext1-dependent heparan sulfate regulates the, range, of, Ihh signaling during endochondral ossification. Dev. Cell 6,801 -813.[CrossRef][Medline]
Krauss, S., Korzh, V., Fjose, A. and Johansen, T. (1992). Expression of four zebrafish wnt-related genes during embryogenesis. Development 116,249 -259.[Abstract]
Krauss, S., Concordet, J. P. and Ingham, P. W. (1993). A functionally conserved homolog of the Drosophila segment polarity gene hh is expressed in tissues with polarizing activity in zebrafish embryos. Cell 75,1431 -1444.[CrossRef][Medline]
Lee, J. S., von der Hardt, S., Rusch, M. A., Stringer, S. E., Stickney, H. L., Talbot, W. S., Geisler, R., Nusslein-Volhard, C., Selleck, S. B., Chien, C. B. et al. (2004). Axon sorting in the optic tract requires HSPG synthesis by ext2 (dackel) and extl3 (boxer). Neuron 44,947 -960.[CrossRef][Medline]
Lin, X. (2004). Functions of heparan sulfate
proteoglycans in cell signaling during development.
Development 131,6009
-6021.
Lin, X., Buff, E. M., Perrimon, N. and Michelson, A. M. (1999). Heparan sulfate proteoglycans are essential for FGF receptor signaling during Drosophila embryonic development. Development 126,3715 -3723.[Abstract]
Lin, X., Wei, G., Shi, Z., Dryer, L., Esko, J. D., Wells, D. E. and Matzuk, M. M. (2000). Disruption of gastrulation and heparan sulfate biosynthesis in EXT1-deficient mice. Dev. Biol. 224,299 -311.[CrossRef][Medline]
Macdonald, R., Xu, Q., Barth, K. A., Mikkola, I., Holder, N., Fjose, A., Krauss, S. and Wilson, S. W. (1994). Regulatory gene expression boundaries demarcate sites of neuronal differentiation in the embryonic zebrafish forebrain. Neuron 13,1039 -1053.[CrossRef][Medline]
Martin, G. R. (1998). The roles of FGFs in the
early development of vertebrate limbs. Genes Dev
12,1571
-86.
Martinez-Barbera, J. P., Toresson, H., Da Rocha, S. and Krauss, S. (1997). Cloning and expression of three members of the zebrafish Bmp family: Bmp2a, Bmp2b and Bmp4. Gene 198, 53-59.[CrossRef][Medline]
Min, H., Danilenko, D. M., Scully, S. A., Bolon, B., Ring, B.
D., Tarpley, J. E., DeRose, M. and Simonet, W. S.
(1998). Fgf-10 is required for both limb and lung development and
exhibits striking functional similarity to Drosophila branchless.
Genes Dev. 12,3156
-3161.
Ng, J. K., Kawakami, Y., Buscher, D., Raya, A., Itoh, T., Koth, C. M., Rodriguez Esteban, C., Rodriguez-Leon, J., Garrity, D. M., Fishman, M. C. et al. (2002). The limb identity gene Tbx5 promotes limb initiation by interacting with Wnt2b and Fgf10. Development 129,5161 -5170.
Nybakken, K. and Perrimon, N. (2002). Heparan sulfate proteoglycan modulation of developmental signaling in Drosophila. Biochim. Biophys. Acta 1573,280 -291.[Medline]
Ohuchi, H., Nakagawa, T., Yamamoto, A., Araga, A., Ohata, T., Ishimaru, Y., Yoshioka, H., Kuwana, T., Nohno, T., Yamasaki, M. et al. (1997). The mesenchymal factor, FGF10, initiates and maintains the outgrowth of the chick limb bud through interaction with FGF8, an apical ectodermal factor. Development 124,2235 -2244.[Abstract]
Ornitz, D. M. (2000). FGFs, heparan sulfate and FGFRs: complex interactions essential for development. BioEssays 22,108 -112.[CrossRef][Medline]
Ornitz, D. M., Xu, J., Colvin, J. S., McEwen, D. G., MacArthur,
C. A., Coulier, F., Gao, G. and Goldfarb, M. (1996).
Receptor specificity of the fibroblast growth factor family. J.
Biol. Chem. 271,15292
-15297.
Orr-Urtreger, A., Bedford, M. T., Burakova, T., Arman, E., Zimmer, Y., Yayon, A., Givol, D. and Lonai, P. (1993). Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Dev. Biol. 158,475 -486.[CrossRef][Medline]
Pellegrini, L., Burke, D. F., von Delft, F., Mulloy, B. and Blundell, T. L. (2000). Crystal structure of fibroblast growth factor receptor ectodomain bound to ligand and heparin. Nature 407,1029 -1034.[CrossRef][Medline]
Reifers, F., Bohli, H., Walsh, E. C., Crossley, P. H., Stainier, D. Y. and Brand, M. (1998). Fgf8 is mutated in zebrafish acerebellar (ace) mutants and is required for maintenance of midbrain-hindbrain boundary development and somitogenesis. Development 125,2381 -2395.[Abstract]
Roehl, H. and Nusslein-Volhard, C. (2001). Zebrafish pea3 and erm are general targets of FGF8 signaling. Curr. Biol. 11,503 -507.[CrossRef][Medline]
Schlessinger, J., Plotnikov, A. N., Ibrahimi, O. A., Eliseenkova, A. V., Yeh, B. K., Yayon, A., Linhardt, R. J. and Mohammadi, M. (2000). Crystal structure of a ternary FGF-FGFR-heparin complex reveals a dual role for heparin in FGFR binding and dimerization. Mol. Cell 6, 743-750.[CrossRef][Medline]
Sekine, K., Ohuchi, H., Fujiwara, M., Yamasaki, M., Yoshizawa, T., Sato, T., Yagishita, N., Matsui, D., Koga, Y., Itoh, N. et al. (1999). Fgf10 is essential for limb and lung formation. Nat. Genet. 21,138 -141.[CrossRef][Medline]
Sun, X., Mariani, F. V. and Martin, G. R. (2002). Functions of FGF signalling from the apical ectodermal ridge in limb development. Nature 418,501 -508.[CrossRef][Medline]
Takei, Y., Ozawa, Y., Sato, M., Watanabe, A. and Tabata, T.
(2004). Three Drosophila EXT genes shape morphogen gradients
through synthesis of heparan sulfate proteoglycans.
Development 131,73
-82.
The, I., Bellaiche, Y. and Perrimon, N. (1999). Hedgehog movement is regulated through tout velu-dependent synthesis of a heparan sulfate proteoglycan. Mol. Cell 4, 633-639.[CrossRef][Medline]
Tickle, C. and Munsterberg, A. (2001). Vertebrate limb developmentthe early stages in chick and mouse. Curr. Opin. Genet. Dev. 11,476 -481.[CrossRef][Medline]
van Eeden, F. J., Granato, M., Schach, U., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J., Kane, D. A. et al. (1996). Genetic analysis of fin formation in the zebrafish, Danio rerio. Development 123,255 -262.[Abstract]
Westerfield, M. (1995). The zebrafish book.A guide for the laboratory use of zebrafish (Danio rerio) . 4th edn., Eugene, Oregon: University of Oregon Press.
Xu, X. L., Weinstein, M., Li, C. L. and Deng, C. X. (1999). Fibroblast growth factor receptors (FGFRs) and their roles in limb. Cell Tissue Res. 296, 33-43.[CrossRef][Medline]
Zak, B. M., Crawford, B. E. and Esko, J. D. (20