|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 12 October 2005
doi: 10.1242/dev.02082
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Centro Andaluz de Biología del Desarrollo, Universidad Pablo de
Olavide-Consejo Superior de Investigaciones Científicas, Seville,
41013, Spain
2 Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto,
4150-180, Portugal
* Author for correspondence (e-mail: fcasfer{at}upo.es)
Accepted 5 September 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, Eye disc, Eye determination, Teashirt, Wingless, Decapentaplegic, Eyes absent, Homothorax, Atonal
| Introduction |
|---|
|
|
|---|
During L2, cell morphology in the two adjacent epithelial layers of the eye
disc becomes distinct. The eye derives from the columnar layer called the main
epithelium (ME), or disc proper. The overlaying squamous layer, the peripodial
epithelium (PE), contributes to the head capsule that surrounds the eye
(Haynie and Bryant, 1986
;
Jurgens and Hartenstein,
1993
). These cell morphological changes are paralleled by changes
in the expression of key genes. The expression of eyes absent
(eya) in the posterior of the ME during L2 is considered the first
hallmark of eye primordium specification. The initiation of eya
expression is immediately followed by that of sine ocullis
(so) and Dachshund (Dac). eya, so and
Dac are collectively known as `early retinal genes', as their
coexpression is necessary to lock-in the eye fate within the eye field,
possibly by acting together as a transcriptional complex
(Desplan, 1997
;
Kenyon et al., 2003
;
Kumar and Moses, 2001
;
Pichaud et al., 2001
). The
homologs of ey/toy and the early retinal genes also play crucial
roles during vertebrate eye development (reviewed by
Chow and Lang, 2001
).
The expression of hedgehog (hh) and hh-dependent
decapentaplegic (dpp) transcription at the posterior margin
of the disc is key for the definition of the eye primordium, as they activate
the expression of eya and so. The eye-inducing functions of
dpp also include the posterior repression of wingless
(wg), which would otherwise block eye development by promoting the
alternative head-capsule fate. Therefore, wg, which is expressed in
the anterior regions of the disc, and dpp, which is expressed first
along the posterior margin and later at the MF, antagonize each other as
eye-repressor and eye-activator, respectively (reviewed by
Dominguez and Casares, 2005
;
Pappu and Mardon, 2004
).
Early in L3, after the definition of the eye primordium within the eye
disc, retinal differentiation begins in the posterior region of the eye
primordium (Curtiss and Mlodzik,
2000
; Dominguez and Hafen,
1997
; Heberlein et al.,
1993
). Once initiated, retinal differentiation proceeds as a wave
in a posterior-to-anterior direction. The front of this differentiation wave
is marked by an indentation of the main epithelium called morphogenetic furrow
(MF). Thus, during wave progression, undifferentiated cells are anterior to
the MF, while differentiating cells are posterior to it (reviewed by
Treisman and Heberlein, 1998
).
The progression of the MF is driven by the joint action of dpp,
expressed within the furrow, and by hh, expressed in cells posterior
to the furrow. The induction of the proneural gene atonal
(ato) by hh is the first step towards the definition of the
R8 photoreceptor, the founder neuron of the mature eye units, or ommatidia.
(Dominguez, 1999
;
Dominguez and Hafen, 1997
).
The expression of the selector genes ey and toy, which is
initially widespread, is repressed in differentiating cells and thus their
expressions become restricted to the undifferentiated region of the eye disc,
anterior to the MF (Czerny et al.,
1999
).
Two other transcription factors are known to be expressed in late L2-early
L3 eye discs: teashirt (tsh), which encodes a transcription
factor harboring three widely spaced Zn-finger domains
(Fasano et al., 1991
); and
homothorax (hth), a Meis-family homeobox gene
(Pai et al., 1998
;
Rieckhof et al., 1997
). The
pattern of tsh expression in L3 eye discs is very similar to that of
ey/toy, its expression being activated anterior to the MF and
repressed posterior to it (Bessa et al.,
2002
; Fasano et al.,
1991
) (Fig. 1E). hth expression is repressed close to the MF via the action of
dpp produced at the MF (Bessa et
al., 2002
). Therefore, the tsh territory can be further
subdivided into two domains: a domain, far from the MF, in which hth
expression maintains cells in an undifferentiated state and represses retinal
selector gene expression (such as eya); and a domain abutting the MF,
in which hth is repressed, leading to eya upregulation
(Bessa et al., 2002
). The
latter is also known as the pre-proneural domain, as it precedes the onset of
retinal differentiation (Greenwood and
Struhl, 1999
). In addition, hth expression is maintained
in the peripodial epithelium and margin of the eye disc during its whole
development (Pai et al., 1998
;
Pichaud and Casares, 2000
). A
detailed description of the dynamics of ey and tsh
expressions is currently lacking.
Several lines of evidence suggest a role for tsh during eye
development, although precisely what its role(s) are have not been fully
clarified. tsh overexpression in the eye disc can induce ectopic eye
development or block its normal formation, depending on the Gal4-promoter used
(Manfroid et al., 2004
;
Pan and Rubin, 1998
;
Singh et al., 2004
;
Singh et al., 2002
).
Interestingly, the steps leading to the specification of the eye primordium within the eye disc occur in only one of the two epithelial layers that compose the disc the ME. This restriction is not explained by the model outlined above, as all L1 disc cells express the eye selector gene ey, and the signaling molecules wg and dpp, which are transcribed along the margins of the disc, should be able to reach both layers. Therefore, factors differentially expressed in the two disc layers must be responsible for making one of them either competent, or refractory, to eye-determining signals. Such factor(s) should be expressed specifically in one of the layers of the disc prior to the onset of eye-specific gene expression, and its expression might be able to alter the developmental potential of the other, if expressed ectopically.
Here, we show that tsh expression starts during L2 and is restricted to the ME. Ectopic expression of tsh in the peripodial cells transforms them into eye primordium-like cells, as judged by their cell morphology and gene expression; nevertheless, the final differentiation of these cells into retina occurs only if tsh expression is transient. Furthermore, our results indicate that tsh re-specification properties rely on its ability to make peripodial cells respond to wg and dpp by initiating the eye differentiation program. Thus, the asymmetric expression of tsh in one disc layer might allow eye primordium specification to occur in just that layer.
| Materials and methods |
|---|
|
|
|---|
For targeted mis-expression, we used the UAS/GAL4 system
(Brand and Perrimon, 1993
).
Lines used were UAS-tsh (Gallet
et al., 1998
), UAS-ey
(Halder et al., 1995
),
UAS-toy (Czerny et al.,
1999
), UAS-tkvQD
(Nellen et al., 1996
),
UAS-Axin A2 (Willert et al.,
1999
), dpp-GAL4
(Staehling-Hampton et al.,
1994
), tsh-GAL4 (Wu
and Cohen, 2000
), ey-GAL4
(Hazelett et al., 1998
),
Arm-GAL4 (Tolwinski and
Wieschaus, 2001
) and hs-GAL4
{P[w(+mC)=GAL4-Hsp70.PB]89-2-1; Flybase}. MS1096
(Milan et al., 1998
) and
MD705 (gift from G. Morata) express Gal4 specifically in the
PE/margin of the eye disc (see Results section), beginning in late L2.
tsh-ectopic expression clones were generated randomly in eye discs
by heat shocking L1 or L2 larvae [24-48 hours and 48-72 hours after egg laying
(AEL), respectively] for 30 minutes at 35.5°C from a yw hsFlp122;
tub>GFP, y+>GAL4 (Zecca and
Struhl, 2002
); UAS-tsh/SM6^TM6B stock, or from
the following crosses: yw hsFlp 122; tub>GFP, y+>GAL4;
UAS-tsh/SM6^TM6B females to UAS-Axin A2 or
UAS-tkvQD/Y; UAS-Axin A2 males; and yw
hs-Flp122; act>y+>GAL4, UAS-lacZ/CyO
(Ito et al., 1997
) females to
UAS-ey; UAS-toy; UAS-tkvQD/Y, +; or
UAS-Axin A2 males. Clones were marked negatively by the absence of
GFP, or positively by detection of ß-galactosidase (lacZ-marked)
or Tsh antigens.
Mad loss-of-function clones were induced in the
eye disc in larvae of the genotype ey-Flp; FRT 40A MadB1/FRT
40A arm-Z (Hazelett et al.,
1998
) and marked by the absence of ß-galactosidase.
To induce a pulse of tsh expression, larvae of the genotype hs-Gal4; UAS-tsh were heat shocked for 45 minutes at 35°C during L2, after which they were returned to 25°C for the rest of their development. Discs were dissected from late L3 larvae.
tsh-knock-down was achieved by expressing a UAS-tshRNAi transgene [flies kindly provided by Georg Dietzl and Barry Dickson (IMBA, Vienna)], which carries an inverted repeat targeting the sequence GGCGGTGCTGCTGGTAGTGGCGCAGTGACCAAAGCGAGGCATAACATTTGGCAATCGCACTGGCAAAACAAGGGTGTGGCCAGTTCGGTGTTCAGATGTGTGTGGTGCAAGCAGAGTTTCCCTACCCTGGAAGCCCTGACCACCCACATGAAGGACAGCAAGCATTGCGGCGTGAATGTACCACCTTTTGGTAATCTGCCAAGCAACAATCCTCAGCCGCAGCACCACCATCCAACTCCACCTCCACCGC in the tsh cDNA. UAS-tshRNAi was induced in two ways: (1) in clones, induced at 28-72 hours AEL in larvae of the genotype yw hs-Flp122; act>y+>GAL4, UAS-lacZ; UAS-tshRNAi; or (2) uniformly in the developing eye disc of larvae of the genotype ey-GAL4; arm-GAL4/UAS-tshRNAi. Larvae containing only one of these two GAL4 drivers plus the UAS-tshRNAi transgene gave rise to normal flies.
Immunostaining
Antibodies used were rabbit anti-ß-galactosidase (Cappel), mouse
anti-ß-galactosidase (Sigma), guinea pig anti-Hth
(Casares and Mann, 1998
),
rabbit anti-Tsh (Wu and Cohen,
2000
), rabbit and rat anti-Ey (gifts from P. Callaerts), and
rabbit anti-Ato (Jarman et al.,
1993
). The monoclonal antibodies against Armadillo
(Riggleman et al., 1990
), Dac
(Mardon et al., 1994
), Eya
(Bonini et al., 1993
), Elav
(7E8A10; (O'Neill et al.,
1994
) and mouse 22C10 (Fujita
et al., 1982
) were obtained from the DSHB, University of Iowa.
Anti-mouse, anti-rabbit and anti-guinea pig secondary antibodies, conjugated
with Alexa 488, 568 or 647 are from Molecular Probes, and anti-rat secondary
antibodies conjugated with FITC, Cy3 or Cy5 are from Jackson Laboratories. GFP
signal was directly detected. Images were obtained with a SP2-AOBS Leica
confocal system and processed with Adobe-Photoshop.
X-Gal histochemical staining
Late MS1096-Gal4/UAS-lacZ pupae were dissected and processed as
described previously (Casares and Mann,
2000
).
| Results |
|---|
|
|
|---|
|
|
tsh, but neither ey nor toy, induces eya expression in peripodial cells
In order to test if tsh is sufficient to induce eye primordium
identity in PE cells, we analyzed the expression of the eye selector gene
ey, as well as that of the early retinal genes eya and
Dac in tsh-expressing clones. tsh-positive cells
show increased Ey expression (Fig.
2A). In addition, PE tsh-expressing clones that lie close
to the posterior margin activate eya (see
Fig. 2B) and the eya
target Dac (data not shown), indicating that these cells adopt an eye
primordium-like fate. PE clones overexpressing ey are not able to
induce eya (Fig. 2C),
neither are similar toy-expressing clones, in which ey
expression is upregulated (Fig.
2D). In these PE clones, tsh expression is not induced
(Fig. 2E). Therefore, we
conclude that neither ey upregulation nor the joint overexpression of
toy and ey are able to re-specify the peripodial epithelium.
In addition, overexpression of eya in PE clones do not turn
Dac on either (data not shown), which reinforces the idea that PE
re-specification as eye primordium occurs only if tsh is
expressed.
The expression of tsh in PE makes cells respond to Dpp and Wg signals in an eye-specific manner
Expression of tsh activates eya expression mostly in the
center and posterior half of the PE, but not in the anterior half
(Fig. 3B). Clones in this
anterior region retain the expression of hth
(Fig. 3G), which is normally
expressed in all PE cells (Pai et al.,
1998
; Pichaud and Casares,
2000
). As dpp and wg are expressed in the
domains of the posterior and anterior discs, respectively, we reasoned that
these differences in the response of tsh-expressing cells could be
the result of these signaling pathways acting differently in anterior and
posterior domains of the PE.
To test this hypothesis, we first checked the response of normal PE cells
to variations in both wg and dpp pathways. Clones where the
dpp pathway was hyperactivated through the expression of a
constitutively active dpp-receptor, thick veins
(tkvQD; Fig. 3A; see
Fig. 3D for comparison of the
effects in the ME), or blocked by removing the signal transducer Mothers
against dpp (Mad; not shown), showed no induction of
eya expression or cell morphology changes. Neither did anterior
clones expressing Axin, a negative regulator of the wg
pathway (Fig. 3F) or
overexpressing wg (not shown). Nevertheless, when alterations in the
dpp and wg pathways were performed in the presence of
ectopic tsh, PE cells showed gene expression responses characteristic
of the ME. Thus, whereas posterior tsh-expressing PE cells induce
eya expression (Fig.
2B, Fig. 3B),
tsh-expressing cells in which the dpp pathway has been
blocked by removing Mad no longer express eya
(Fig. 3C). Again, this is the
behavior exhibited by tsh+ ME cells deprived of dpp
signaling (Fig. 3E)
(Curtiss and Mlodzik, 2000
).
Similarly, while anterior tsh-expressing PE cells retain hth
expression (Fig. 3G), most
clones expressing both tsh and Axin lose hth
expression (Fig. 3H), as they
do if Axin is expressed in the ME within the tsh domain
(Fig. 3I). PE tsh+ tkv+ clones
still fail to activate eya in anterior dorsal and anterior ventral regions
(not shown), suggesting that even in these clones wg signaling can
prevent PE re-specification. Clones of PE cells expressing tsh, tkvQD
and Axin now activate eya anywhere in the disc
(Fig. 3J), indicating that, in
the presence of tsh, wg and dpp antagonize each other to
regulate eya expression. We note, however, that the squamous to
columnar cell shape change induced by tsh is independent of the
activity of the wg and dpp pathways
(Fig. 3; not shown).
|
tsh overexpression induces ato, a retinal proneural gene
Retinal differentiation starts at the posterior of the eye primordium, and
depends on the expression of hh in the adjacent posterior margin
cells. A key step in the retinal `triggering' is the induction of ato
by hh (Dominguez and Hafen,
1997
). ato is expressed in a stripe of cells just
abutting the MF (Fig. 4A). In
the MF, ato expression becomes restricted first to evenly spaced
proneural clusters and then to individual R8 photoreceptor
(Jarman et al., 1994
).
Although the two available antisera to detect Ato and Tsh are both made in the
same species, precluding a direct co-expression analysis, two lines of
evidence indicate that tsh and ato expressions overlap at
the MF. First, tsh and ey expression strictly coincide, and
ey and ato overlap at the MF (data not shown); therefore, by
correlation, tsh and ato overlap. Second, a
tsh-GAL4 reporter also overlaps ato at the MF
(Fig. 4A). To test whether
tsh was also able to convey an eye-specific proneural competence, we
analyzed the expression of ato in tsh-expressing eye disc
cells. Some tsh-expressing clones show autonomous ato
expression in a salt-and-pepper pattern
(Fig. 4D). Surprisingly, this
ato induction is not disc specific
(Fig. 4B,E,C,F). This might be
explained if tsh endows cells with a proneural potential.
|
In addition, using the MS1096 and MD705 GAL4 promoters, both expressed in the margin and PE of the L3 eye discs (Fig. 5C,E), ectopic eyes are induced (Fig. 5D,F,G; see Fig. 5I for a description of the adult derivatives of the MS1096-expressing cells). Accordingly, in these discs, the clusters of 22C10-positive photoreceptors develop in regions in which the expression of the GAL4 source has been turned-off as the result of fate re-specification, and therefore where tsh (and hth) is no longer expressed (Fig. 5F, insets; not shown). Similarly driven ey expression in the PE, as expected, does not result in ectopic eye development (Fig. 5H), even if it is very efficient in eye-induction in other body places (see Fig. 5J). Therefore, these results indicate that tsh expression can induce eye primordium identity, but terminal differentiation proceeds only if tsh expression is subsequently turned off.
Knocking-down tsh function results in reduced eyes
To analyze an early role of tsh during eye development, we reduced
tsh function by expressing an UAS-tshRNAi transgene in early discs.
To drive this tshRNAi construct, we used a combination of GAL4 drivers:
ey-GAL4, which is expressed in eye discs from L1, and the ubiquitous
arm-GAL4, to globally increase the levels of expression of the RNAi
construct (see Materials and methods). ey-GAL4;
arm-GAL4/UAS-tshRNAi flies show a variable degree of eye reduction
(up to 75%; Fig. 6A,B). To
check for the efficiency of the UAS-tshRNAi, we drove its expression in
clones, which allow the comparison of Tsh levels between RNAi-expressing cells
and wild-type surrounding ones. In these clones, we detect a consistent, but
variable, reduction of Tsh immunoreactivity
(Fig. 6C,D), ranging from
strongly reduced to almost normal levels
(Fig. 6E,F). Therefore, the
overexpression of the tshRNAi is causing a hypomorphic condition for
tsh. Flies containing tshRNAi-clones, which were unmarked in the
eyes, often showed reduced eyes with abnormal morphology (not shown). These
data indicate that tsh is required for normal eye development, as the
early reduction of its function seriously compromises eye development, in
agreement with previous results (Singh et
al., 2002
).
|
| Discussion |
|---|
|
|
|---|
Asymmetric expression of tsh underlies the specification of one epithelial layer of the eye disc as eye primordium, which alters the response of eye disc cells to Wg and Dpp
During the development of the eye disc, only cells of the ME will be
specified as eye primordium. Although Wg and Dpp signals play essential roles
during eye development (reviewed by
Treisman and Heberlein, 1998
),
PE cells are relatively insensitive to these signaling pathways, as measured
by cell survival, morphology, proliferation or gene expression changes (this
work) (Baena-Lopez et al.,
2003
). Here, we show that tsh starts being expressed in
the ME around the time when the eye primordium is specified, and that
tsh has the potential to redirect eye disc PE cells towards eye
development, an ability the eye selector genes toy and ey do
not have on their own. Our results indicate that the PE can be re-specified by
tsh throughout most of the life of the larva. Thus,
tsh-expressing clones induced during L1 and L2 induce eya
and Dac expression (Fig.
2; data not shown). The transient expression of tsh
during L2 (Fig. 5; data not
shown), or its induction by Gal4 drivers active during late-L2/L3, results in
ectopic PE eyes.
We propose that one way in which tsh might be involved in eye fate
specification is by altering the response of eye disc cells to Dpp and Wg
signals. The molecular mechanisms by which tsh might achieve this
during eye development remain to be further investigated, but they might be
similar to those already described during embryogenesis, where Tsh modulates
wg and dpp pathways directly interacting with Armadillo, the
wg signaling transducer, and with Brinker, a transcriptional
repressor of the dpp pathway
(Gallet et al., 1999
;
Gallet et al., 1998
;
Jazwinska et al., 1999
;
Rushlow et al., 2001
;
Saller et al., 2002
).
|
We have also observed that ato expression is induced in some of
the tsh-overexpressing eye-disc cells. Therefore, tsh has
the potential not only to sensitize eye disc cells to wg and
dpp signals, but also to make them prone to neural differentiation.
Niwa and co-workers (Niwa et al.,
2004
) have recently shown that dpp and wg
regulate the spatial activation of ato to position several adult
sensory organs, including the eye, within the corresponding imaginal discs.
This mechanism for positioning ato would define, according to these
authors, a sensory organ prototype upon which selector genes, such as
ey, would specify the final sensory type. Interestingly, the ectopic
ato expression induced by tsh is not disc specific and, if
tsh induction is transient, results in ectopic neurons
(Fig. 5E,F). This ato
induction might be mediated by tsh enabling cells to respond to
dpp and wg.
Temporal regulation of tsh in establishing competence and allowing differentiation
Our results underlie the importance of the precise and dynamic
spatiotemporal pattern of expression of tsh: on the one hand,
tsh expression must be confined to the ME layer of the eye disc; on
the other, and in order for eye development to proceed, tsh has to be
first expressed in undifferentiated cells to be later turned off to allow
retinal differentiation. The earlier paradox of tsh acting both as
eye repressor and inductor, depending on the Gal4 promoters used, can now be
explained as follows: Gal4 promoters that are not repressible by the gene
expression changes induced upon tsh overexpression, such as
ey-GAL4, will lead to sustained expression of tsh and,
therefore, to a blockage of eye development
(Manfroid et al., 2004
;
Singh et al., 2002
). Other
drivers that are turned off after tsh expression (i.e. MS1096, MD705,
this study) will mimic the situation found in the ME (that is, on/off), and in
these cases, eye development will proceed. We note that in experiments where
ey is ectopically expressed, eyes tend to develop in the proximal
parts of appendages (Bessa et al.,
2002
; Chen et al.,
1999
; Halder et al.,
1998
) (J.B. and F.C., unpublished) which derive from
tsh-expressing domains in their respective imaginal discs
(Azpiazu and Morata, 2000
;
Casares and Mann, 2000
;
Wu and Cohen, 2002
). This
correlation reinforces the idea of tsh as a potential eye-competence
factor.
Multiple roles of tsh during eye disc development
Several studies have uncovered at least three roles for tsh during
eye development: promoting proliferation
(Bessa et al., 2002
;
Singh et al., 2002
), acting as
an eye repressor (Bessa et al.,
2002
; Singh et al.,
2002
) and acting as an eye inducer
(Pan and Rubin, 1998
;
Singh et al., 2002
;
Singh et al., 2004
). The first
two roles (proliferation and eye repression) are linked to the function of the
transcription factor Hth (Singh et al.,
2002
; Bessa et al.,
2002
). Thus, Tsh and Hth (together with Ey) maintain the eye disc
cells in a proliferative, undifferentiated state, which is incompatible with
eye differentiation (Bessa et al.,
2002
; Singh et al.,
2002
). This state is kept as long as cells express hth,
which is positively regulated by wg
(Pichaud and Casares, 2000
;
Baonza and Freeman, 2002
;
Lee and Treisman, 2001
;
Singh et al., 2002
) and
repressed by dpp (Bessa et al.,
2002
). As tsh keeps hth on, sustaining
tsh expression artificially in the disc blocks further eye
differentiation (Singh et al.,
2002
; Bessa et al.,
2002
) (this work). Once hth is repressed by Dpp signaling
close to the MF, cells enter a preproneural state, that still maintains
tsh expression, in which dpp activates the expression of
retinal genes such as eya. Our results suggest that tsh is
required for the eye-specific interpretation of Wg and Dpp signals, and
therefore for both the maintenance of proliferation and the specification of
the retina. This model thus predicts that removal of the earliest tsh
function (which corresponds to the most anterior regions in older discs)
should result in eye loss due to either lack of proliferation or to the
incorrect specification of the primordium; removal of later tsh
function (which corresponds to more posterior regions of older discs) should
cause a premature derepression of the eye differentiation program and excess
of eye. In fact, Singh and co-workers
(Singh et al., 2002
) have
described both phenotypes in tsh loss-of-function clones: eye loss
and eye overgrowths. Our experiments, in which tsh function is
reduced uniformly from early stages of eye development, agrees with an early
role of tsh in eye specification and/or proliferation. This model of
tsh function is further complicated by the fact that the dorsoventral
genes also impinge on tsh function
(Singh et al., 2004
). Still,
some tshclones showed no phenotype
(Pan and Rubin, 1998
;
Singh et al., 2002
). This
might be explained by perdurance of the Tsh product, local differences in the
requirement of tsh within the eye disc or the existence of
compensatory functions.
tsh acts in parallel to ey in the eye-specification gene network
toy and ey lay atop the eye specification genetic network
in Drosophila. However, neither Toy nor Ey is able to activate the
expression of tsh in the PE (Fig.
2E), and tsh expression in maintained in ey
mutant discs (not shown). The reverse is also true, as tsh
upregulates ey expression in the eye disc
(Bessa et al., 2002
;
Pan and Rubin, 1998
), but is
unable to activate its expression de novo in any other disc. This indicates
that tsh expression is regulated independently of the Pax6
genes in the eye disc. This situation is analogous to that of Optix,
a Six3 homolog, which is expressed in the eye disc independently of
ey with a pattern reminiscent of that of tsh
(Seimiya and Gehring, 2000
).
Nevertheless, Optix does not seem to regulate tsh, as
ectopic expression of Optix in the eye disc does not trigger
tsh expression (J.B. and F.C., unpublished). Taking into account all
these results, we propose that tsh functions in parallel to
ey (and probably to toy) as an eye competence factor.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Azpiazu, N. and Morata, G. (2000). Function and
regulation of homothorax in the wing imaginal disc of Drosophila.Development 127,2685
-2693.[Abstract]
Baena-Lopez, L. A., Pastor-Pareja, J. C. and Resino, J.
(2003). Wg and Egfr signalling antagonise the
development of the peripodial epithelium in Drosophila wing discs.
Development 130,6497
-6506.
Baonza, A. and Freeman, M. (2002). Control of
Drosophila eye specification by Wingless signalling.
Development 129,5313
-5322.
Bessa, J., Gebelein, B., Pichaud, F., Casares, F. and Mann, R.
S. (2002). Combinatorial control of Drosophila eye
development by eyeless, homothorax, and teashirt. Genes
Dev. 16,2415
-2427.
Bonini, N. M., Leiserson, W. M. and Benzer, S.
(1993). The eyes absent gene: genetic control of cell
survival and differentiation in the developing Drosophila eye.
Cell 72,379
-395.[CrossRef][Medline]
Brand, A. H. and Perrimon, N. (1993). Targeted
gene expression as a means of altering cell fates and generating dominant
phenotypes. Development
118,401
-415.[Abstract]
Casares, F. and Mann, R. S. (1998). Control of
antennal versus leg development in Drosophila. Nature
392,723
-726.[CrossRef][Medline]
Casares, F. and Mann, R. S. (2000). A dual role
for homothorax in inhibiting wing blade development and specifying
proximal wing identities in Drosophila. Development
127,1499
-1508.[Abstract]
Chen, R., Halder, G., Zhang, Z. and Mardon, G.
(1999). Signaling by the TGF-beta homolog
decapentaplegic functions reiteratively within the network of genes
controlling retinal cell fate determination in Drosophila.Development 126,935
-943.[Abstract]
Chow, R. L. and Lang, R. A. (2001). Early eye
development in vertebrates. Annu. Rev. Cell Dev. Biol.
17,255
-296.[CrossRef][Medline]
Curtiss, J. and Mlodzik, M. (2000).
Morphogenetic furrow initiation and progression during eye development in
Drosophila: the roles of decapentaplegic, hedgehog and
eyes absent. Development
127,1325
-1336.[Abstract]
Czerny, T., Halder, G., Kloter, U., Souabni, A., Gehring, W. J.
and Busslinger, M. (1999). twin of eyeless, a
second Pax-6 gene of Drosophila, acts upstream of
eyeless in the control of eye development. Mol.
Cell 3,297
-307.[CrossRef][Medline]
Desplan, C. (1997). Eye development: governed
by a dictator or a junta? Cell
91,861
-864.[CrossRef][Medline]
Dominguez, M. (1999). Dual role for
Hedgehog in the regulation of the proneural gene atonal
during ommatidia development. Development
126,2345
-2353.[Abstract]
Dominguez, M. and Hafen, E. (1997).
Hedgehog directly controls initiation and propagation of retinal
differentiation in the Drosophila eye. Genes
Dev. 11,3254
-3264.
Dominguez, M. and Casares, F. (2005). Organ
specification-growth control connection: New in-sights from the
Drosophila eye-antennal disc. Dev. Dyn.
232,673
-684.[CrossRef][Medline]
Fasano, L., Roder, L., Core, N., Alexandre, E., Vola, C., Jacq,
B. and Kerridge, S. (1991). The gene teashirt is
required for the development of Drosophila embryonic trunk segments
and encodes a protein with widely spaced zinc finger motifs.
Cell 64,63
-79.[CrossRef][Medline]
Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A. and
Shotwell, S. L. (1982). Monoclonal antibodies against the
Drosophila nervous system. Proc. Natl. Acad. Sci.
USA 79,7929
-7933.
Gallet, A., Erkner, A., Charroux, B., Fasano, L. and Kerridge,
S. (1998). Trunk-specific modulation of wingless
signalling in Drosophila by teashirt binding to armadillo.
Curr. Biol. 8,893
-902.[CrossRef][Medline]
Gallet, A., Angelats, C., Erkner, A., Charroux, B., Fasano, L.
and Kerridge, S. (1999). The C-terminal domain of armadillo
binds to hypophosphorylated teashirt to modulate wingless signalling
in Drosophila. EMBO J.
18,2208
-2217.[CrossRef][Medline]
Gehring, W. J. (2002). The genetic control of
eye development and its implications for the evolution of the various
eye-types. Int. J. Dev. Biol.
46, 65-73.[CrossRef][Medline]
Greenwood, S. and Struhl, G. (1999).
Progression of the morphogenetic furrow in the Drosophila eye: the
roles of Hedgehog, Decapentaplegic and the Raf pathway.
Development 126,5795
-5808.[Abstract]
Halder, G., Callaerts, P. and Gehring, W. J.
(1995). Induction of ectopic eyes by targeted expression of the
eyeless gene in Drosophila. Science
267,1788
-1792.
Halder, G., Callaerts, P., Flister, S., Walldorf, U., Kloter, U.
and Gehring, W. J. (1998). Eyeless initiates
the expression of both sine oculis and eyes absent during
Drosophila compound eye development.
Development 125,2181
-2191.[Abstract]
Haynie, J. L. and Bryant, P. J. (1986).
Development of the eye-antenna imaginal disc and morphogenesis of the adult
head in Drosophila melanogaster. J. Exp.
Zool. 237,293
-308.[CrossRef][Medline]
Hazelett, D. J., Bourouis, M., Walldorf, U. and Treisman, J.
E. (1998). decapentaplegic and wingless are
regulated by eyes absent and eyegone and interact to direct
the pattern of retinal differentiation in the eye disc.
Development 125,3741
-3751.[Abstract]
Heberlein, U., Wolff, T. and Rubin, G. M.
(1993). The TGF beta homolog dpp and the segment
polarity gene hedgehog are required for propagation of a
morphogenetic wave in the Drosophila retina.
Cell 75,913
-926.[CrossRef][Medline]
Ito, K., Awano, W., Suzuki, K., Hiromi, Y. and Yamamoto, D.
(1997). The Drosophila mushroom body is a quadruple
structure of clonal units each of which contains a virtually identical set of
neurones and glial cells. Development
124,761
-771.[Abstract]
Jarman, A. P., Grau, Y., Jan, L. Y. and Jan, Y. N.
(1993). atonal is a proneural gene that directs
chordotonal organ formation in the Drosophila peripheral nervous
system. Cell 73,1307
-1321.[CrossRef][Medline]
Jarman, A. P., Grell, E. H., Ackerman, L., Jan, L. Y. and Jan,
Y. N. (1994). Atonal is the proneural gene for
Drosophila photoreceptors. Nature
369,398
-400.[CrossRef][Medline]
Jazwinska, A., Kirov, N., Wieschaus, E., Roth, S. and Rushlow,
C. (1999). The Drosophila gene brinker
reveals a novel mechanism of Dpp target gene regulation.
Cell 96,563
-573.[CrossRef][Medline]
Jurgens, G. and Hartenstein, V. (1993). The
terminal regios of the body pattern. In The development of
Drosophila melanogaster, vol. I (ed. M.
Bate and A. Martinez-Arias), pp. 687-746. New York:
Cold Spring Harbor Press.
Kenyon, K. L., Ranade, S. S., Curtiss, J., Mlodzik, M. and
Pignoni, F. (2003). Coordinating proliferation and tissue
specification to promote regional identity in the Drosophila head.
Dev. Cell 5,403
-414.[CrossRef][Medline]
Kumar, J. P. and Moses, K. (2001). EGF receptor
and Notch signaling act upstream of Eyeless/Pax6 to control
eye specification. Cell
104,687
-697.[CrossRef][Medline]
Lee, J. D. and Treisman, J. E. (2001). The role
of Wingless signaling in establishing the anteroposterior and dorsoventral
axes of the eye disc. Development
128,1519
-1529.[Abstract]
Manfroid, I., Caubit, X., Kerridge, S. and Fasano, L.
(2004). Three putative murine Teashirt orthologues
specify trunk structures in Drosophila in the same way as the
Drosophila teashirt gene. Development
131,1065
-1073.
Mann, R. S. and Morata, G. (2000). The
developmental and molecular biology of genes that subdivide the body of
Drosophila. Annu. Rev. Cell Dev. Biol.
16,243
-271.[CrossRef][Medline]
Mardon, G., Solomon, N. M. and Rubin, G. M.
(1994). dachshund encodes a nuclear protein required for
normal eye and leg development in Drosophila.Development 120,3473
-3486.[Abstract]
McGuire, S. E., Le, P. T., Osborn, A. J., Matsumoto, K. and
Davis, R. L. (2003). Spatiotemporal rescue of memory
dysfunction in Drosophila. Science
302,1765
-1768.
McNeill, H. (2000). Sticking together and
sorting things out: adhesion as a force in development. Nat. Rev.
Genet. 1,100
-108.[CrossRef][Medline]
Milan, M., Diaz-Benjumea, F. J. and Cohen, S. M.
(1998). Beadex encodes an LMO protein that regulates
Apterous LIM-homeodomain activity in Drosophila wing development: a
model for LMO oncogene function. Genes Dev.
12,2912
-2920.
Nellen, D., Burke, R., Struhl, G. and Basler, K.
(1996). Direct and long-range action of a DPP morphogen gradient.
Cell 85,357
-368.[CrossRef][Medline]
Niwa, N., Hiromi, Y. and Okabe, M. (2004). A
conserved developmental program for sensory organ formation in
Drosophila melanogaster. Nat. Genet.
36,293
-297.[CrossRef][Medline]
O'Neill, E. M., Rebay, I., Tjian, R. and Rubin, G. M.
(1994). The activities of two Ets-related transcription factors
required for Drosophila eye development are modulated by the Ras/MAPK
pathway. Cell 78,137
-147.[CrossRef][Medline]
Pai, C. Y., Kuo, T. S., Jaw, T. J., Kurant, E., Chen, C. T.,
Bessarab, D. A., Salzberg, A. and Sun, Y. H. (1998). The
Homothorax homeoprotein activates the nuclear localization of another
homeoprotein, extradenticle, and suppresses eye development in Drosophila.Genes Dev. 12,435
-446.
Pan, D. and Rubin, G. M. (1998). Targeted
expression of teashirt induces ectopic eyes in Drosophila.Proc. Natl. Acad. Sci. USA
95,15508
-15512.
Pappu, K. S. and Mardon, G. (2004). Genetic
control of retinal specification and determination in Drosophila.Int. J. Dev. Biol. 48,913
-924.[CrossRef][Medline]
Pichaud, F. and Casares, F. (2000).
homothorax and iroquois-C genes are required for the
establishment of territories within the developing eye disc. Mech.
Dev. 96,15
-25.[CrossRef][Medline]
Pichaud, F., Treisman, J. and Desplan, C.
(2001). Reinventing a common strategy for patterning the eye.
Cell 105,9
-12.[CrossRef][Medline]
Rieckhof, G. E., Casares, F., Ryoo, H. D., Abu-Shaar, M. and
Mann, R. S. (1997). Nuclear translocation of extradenticle
requires homothorax, which encodes an extradenticle-related
homeodomain protein. Cell
91,171
-183.[CrossRef][Medline]
Riggleman, B., Schedl, P. and Wieschaus, E.
(1990). Spatial expression of the Drosophila segment
polarity gene armadillo is posttranscriptionally regulated by
wingless. Cell 63,549
-560.[CrossRef][Medline]
Rushlow, C., Colosimo, P. F., Lin, M. C., Xu, M. and Kirov,
N. (2001). Transcriptional regulation of the
Drosophila gene zen by competing Smad and Brinker inputs.
Genes Dev. 15,340
-351.
Saller, E., Kelley, A. and Bienz, M. (2002).
The transcriptional repressor Brinker antagonizes Wingless signaling.
Genes Dev. 16,1828
-1838.
Seimiya, M. and Gehring, W. J. (2000). The
Drosophila homeobox gene optix is capable of inducing
ectopic eyes by an eyeless-independent mechanism.
Development 127,1879
-1886.[Abstract]
Singh, A., Kango-Singh, M. and Sun, Y. H.
(2002). Eye suppression, a novel function of teashirt,
requires Wingless signaling. Development
129,4271
-4280.
Singh, A., Kango-Singh, M., Choi, K. W. and Sun, Y. H.
(2004). Dorsoventral asymmetric functions of teashirt in
Drosophila eye development depend on spatial cues provided by early
DV patterning genes. Mech. Dev.
121,365
-370.[CrossRef][Medline]
Staehling-Hampton, K., Jackson, P. D., Clark, M. J., Brand, A.
H. and Hoffmann, F. M. (1994). Specificity of bone
morphogenetic protein-related factors: cell fate and gene expression changes
in Drosophila embryos induced by decapentaplegic but not
60A. Cell Growth Diff.
5, 585-593.[Abstract]
Struhl, G. and Basler, K. (1993). Organizing
activity of wingless protein in Drosophila. Cell
72,527
-540.[CrossRef][Medline]
Tolwinski, N. S. and Wieschaus, E. (2001).
Armadillo nuclear import is regulated by cytoplasmic anchor Axin and nuclear
anchor dTCF/Pan. Development
128,2107
-2117.
Treisman, J. E. and Heberlein, U. (1998). Eye
development in Drosophila: formation of the eye field and control of
differentiation. Curr. Top. Dev. Biol.
39,119
-158.[Medline]
Willert, K., Logan, C. Y., Arora, A., Fish, M. and Nusse, R.
(1999). A Drosophila Axin homolog, Daxin, inhibits Wnt
signaling. Development
126,4165
-4173.[Abstract]
Wu, J. and Cohen, S. M. (2000). Proximal distal
axis formation in the Drosophila leg: distinct functions of
teashirt and homothorax in the proximal leg.
Mech. Dev. 94,47
-56.[CrossRef][Medline]
Wu, J. and Cohen, S. M. (2002). Repression of
Teashirt marks the initiation of wing development.
Development 129,2411
-2418.
Zecca, M. and Struhl, G. (2002). Control of
growth and patterning of the Drosophila wing imaginal disc by
EGFR-mediated signaling. Development
129,1369
-1376.
This article has been cited by other articles:
![]() |
H. W. Peng, M. Slattery, and R. S. Mann Transcription factor choice in the Hippo signaling pathway: homothorax and yorkie regulation of the microRNA bantam in the progenitor domain of the Drosophila eye imaginal disc Genes & Dev., October 1, 2009; 23(19): 2307 - 2319. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lee, B. G. Stultz, and D. A. Hursh The Zic family member, odd-paired, regulates the Drosophila BMP, decapentaplegic, during adult head development Development, April 1, 2007; 134(7): 1301 - 1310. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Pereira, A. Teixeira, S. Pinho, P. Ferreira, J. Fernandes, C. Oliveira, R. Seruca, G. Suriano, and F. Casares E-cadherin missense mutations, associated with hereditary diffuse gastric cancer (HDGC) syndrome, display distinct invasive behaviors and genetic interactions with the Wnt and Notch pathways in Drosophila epithelia Hum. Mol. Genet., May 15, 2006; 15(10): 1704 - 1712. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Culi, P. Aroca, J. Modolell, and R. S. Mann jing Is Required for Wing Development and to Establish the Proximo-Distal Axis of the Leg in Drosophila melanogaster Genetics, May 1, 2006; 173(1): 255 - 266. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||