|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 October 2005
doi: 10.1242/dev.02067
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Section of Plant Biology, University of California Davis, Davis, CA 95616,
USA
2 Department of Biology, Duke University, Durham, NC 27708, USA
3 Department of Plant Sciences, University of California Davis, Davis, CA 95616,
USA
* Author for correspondence (e-mail: jlbowman{at}ucdavis.edu)
Accepted 26 August 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Nectary, Carpel, CRABS CLAW, YABBY, Eudicot, Arabidopsis
| Introduction |
|---|
|
|
|---|
With the rapid progress in developmental genetics and confidence in the
establishment of the flowering plant phylogeny, a gene(s) involved in
particular developmental processes in model species can be evaluated in an
evolutionarily context by examining orthologs in divergent angiosperm species.
Through comparative expression and functional studies, it is possible to gain
insight into the relationship between the evolution of genes and morphology.
The nectary provides an interesting example with which to address this
question owing to its diversity in both structure and ontogeny. Nectaries are
highly variable in their morphologies, anatomies and locations, and are
defined based on their shared function: the secretion of nectar
(Fahn, 1979
). Depending on
location, nectaries either serve to attract pollinators or protect against
herbivores. Although nectaries reportedly occur in ferns
(Darwin, 1877
) and Gnetales
(Porsch, 1910
), they are most
widespread in angiosperms, predominantly developing or occurring within
flowers, when compared with other parts of the angiosperm plant body. Many
angiosperm flowers are animal pollinated
(Eriksson and Bremer, 1992
),
with pollinators attracted to flowers to gather nectar or pollen as food
sources. Fossil records of angiosperms and insects suggest that the timing of
the radiations of angiosperms and certain insect classes were coincident
(Crepet and Friis, 1987
;
Meeuse, 1978
;
Pellmyr, 1992
). Therefore,
along with the other floral organs, the innovation of nectaries may have
played a major role in angiosperm and metazoan evolution.
Although locations of nectaries within flowers are constant at the family
level, in broader taxonomic terms, their locations are highly variable
(Brown, 1938
). In basal
angiosperms, nectaries tend to be associated with the perianth (the
nonreproductive floral organs) (Endress,
2001
), while in the eudicots, nectaries are usually associated
with carpels and stamens. Thus, Fahn
(Fahn, 1953
) argued that there
is a trend in nectary position within flowers, shifting from peripheral
perianth positions in basal taxa to central positions associated with
reproductive organs in more derived taxa. In addition, extrafloral nectaries
are currently known in 68 angiosperm families
(Elias, 1983
). Their
structures and locations are also diverse across the families, although they
occur most often `on the upper half of the petiole at or near the base of the
leaf blade than any other site' (Elias,
1983
). The diversity of nectary forms and distributions within
flowering plants suggest that they may have multiple independent origins.
However, this does not preclude diverse nectaries from sharing developmental
genetic machinery.
In Arabidopsis, crabs claw (crc) is the only known single
mutant that lacks floral nectaries (Baum et
al., 2001
; Bowman and Smyth,
1999
). CRC is expressed in nectaries, with expression
commencing before the emergence of nectary glands and continuing until after
anthesis. Although ectopic expression of CRC alone does not result in
ectopic nectaries, ectopic expression of CRC in conjunction with
other genes, such as UFO, or in specific mutant backgrounds, results
in the development of ectopic nectaries at the bases of flower pedicels
(Baum et al., 2001
). Thus,
CRC is required for nectary development and ectopic CRC
expression in some contexts is sufficient for nectary formation
(Baum et al., 2001
).
CRC activation in nectaries is mediated by a combination of florally
expressed MADS box proteins, although the tissue-specific factors limiting
expression to nectaries and carpels are unknown
(Lee et al., 2005
).
CRC encodes a putative transcription factor of the YABBY gene
family (Bowman and Smyth,
1999
). Several members of the YABBY gene family are expressed
abaxially in developing leaf primordia and floral organs with their ectopic
adaxial expression transforming the adaxial leaf surface into one with abaxial
characteristics, implicating members of this gene family in establishing or
interpreting leaf polarity (Sawa et al.,
1999
; Siegfried et al.,
1999
). Although crc single mutants do not affect carpel
polarity, when combined with other mutations, such as kanadi, adaxial
tissues develop in abaxial positions, indicating that CRC is required
for proper carpel polarity (Eshed et al.,
1999
). Consistent with CRC promoting abaxial
differentiation, CRC is expressed abaxially in the carpels
(Bowman and Smyth, 1999
). In
addition, genetic studies with floral homeotic ABC mutants in
Arabidopsis showed that CRC specifies carpel identity in
parallel with AGAMOUS (Alvarez and
Smyth, 1999
). Studies of CRC orthologs in Oryza
and Amborella, which together with Arabidopsis span the
phylogenetic diversity of angiosperms, suggest that a role in carpel
development is likely to be the ancestral function of CRC in
angiosperms (Fourquin et al.,
2005
; Yamaguchi et al.,
2004
). In this study, we examined whether CRC has an
ancestral function in the nectaries of angiosperms or whether CRC was
recruited for a role in nectary development within the angiosperm lineage.
| Materials and methods |
|---|
|
|
|---|
Cloning of CRABS CLAW orthologs
Total RNA was isolated from nectary or carpel tissue using the RNeasy Plant
Mini kit (Qiagen, Hilden, Germany). First strand cDNA was synthesized using
SuperScript II reverse transcriptase (Invitrogen, Carlsbad, USA). Partial
fragments of CRC cDNAs were amplified by using degenerate primers
dCRC-ZnF (5'-CDGTRACRGTGAAATGYGGYCATTGYRGYA-3') and dCRC-YB
(5'-AIGCGATGGRAGYCTSTGYTTCTTCTCRGG-3') (see Fig. S1 in the
supplementary material). Polymerase chain reactions (PCR) were conducted with
Takara ExTaq polymerase (Madison, USA) on a RoboCycler (Stratagene, La Jolla,
USA) with the following protocol: 2 minutes at 94°C, 35 cycles of 30
seconds at 94°C, 30 seconds at 42-60°C and 30 seconds at 72°C,
followed by one cycle of 2 minutes at 72°C. PCR products were separated on
0.7% TAE agarose gels, gel isolated (Quiagen, Hilden, Germany) and TOPO TA
cloned (Invitrogen, Carlsbad, USA). Purified DNA was sequenced using an ABI
PRISM 377 DNA sequencer. Following confirmation of CRC ortholog
sequences, full-length cDNA sequences were obtained by 5' and 3'
RACE using a SMART RACE cDNA amplification kit (Clontech, Palo Alto, USA).
Phylogenetic analyses
To determine whether genes from various angiosperm groups represent
orthologs, phylogenetic analyses were conducted employing the Bayesian method.
We included CRC genes determined in this study, as well as sequences of YABBY
gene family members from GenBank (the gene list is provided in Table S1 in
supplementary material). Deduced amino acid sequences of the YABBY genes were
aligned using ClustalX (Thompson et al.,
1997
) and manually adjusted using the program Se-Al (A. Rambaut,
see
http://evolve.zoo.ox.ac.uk/).
The alignment confirmed the two domains recognized by Bowman and Smyth
(Bowman and Smyth, 1999
) (zinc
finger and YABBY domains) are highly conserved across genes from angiosperms
and gymnosperms (see amino acid alignment in Fig. S1 in the supplementary
material). However, it is difficult to assume positional homology in the
remaining regions of the genes owing to a higher level of variability. Thus,
we analyzed only nucleotide sequences of the two conserved domains. The
aligned data matrix was submitted to the TreeBase database
(http://www.treebase.org)
and is available upon request.
Bayesian phylogenetic analyses were performed with MrBayes 3.0
(Huelsenbeck and Ronquist,
2001
) using the sequences from gymnosperms as outgroups. A
Metropolis-coupled Markov chain Monte Carlo algorithm was employed for 2
million generations, sampling trees every 100 generations, with four
independent chains running simultaneously. The general time-reversal model
(Swofford et al., 1996
) with
six rate parameters and the gamma distribution, as determined by the
hierarchical likelihood ratio test using Modeltest
(Posada and Crandall, 1998
),
was used to estimate the likelihood values. All 20,001 resulting trees were
imported into PAUP* 4.0b10 (Swofford,
2002
), and a 50% majority-rule consensus tree was generated after
discarding the first 1001 trees (100,000 generations). These `burn-in'
generations, for which the log-likelihood values had not reached a plateau,
were determined by plotting a graph of the log-likelihoods of each generation
versus generation numbers (Huelsenbeck and
Ronquist, 2001
).
Microscopy
For Scanning Electron Microscopy (SEM), tissue was fixed overnight with 3%
glutaraldehyde, phosphate buffered to pH 7, followed by the overnight fixation
in 0.5% osmium tetraoxide. Tissue was dehydrated and critical-point dried.
After sputter coating with gold/palladium, tissue was observed on a Hitachi
S-3500N scanning electron microscope. Anatomical analysis was carried out
according to the method of Baum and Rost
(Baum and Rost, 1996
). Tissue
sections were stained using the PAS reaction.
In situ hybridizations and semi-quantitative RT-PCR
In situ RT-PCR was performed following Xoconostle-Cázares et al.
(Xoconostle-Cázares et al.,
1999
) on thin hand-sectioned tissues from leaves and involucres of
Gossypium hirsutum. Gene-specific primers GhCRC-1
(GGTTCCACAATCCGAGCATCTTT) and GhCRC-2 (CACAAACGGATGATGCTGCTGGAGAA) were added
to a RT-PCR mixture containing Oregon Green-labeled dUTP (Molecular Probes,
Eugene, USA). Slides with fresh tissue and PCR mixture were sealed and the PCR
was run at 60°C for 20 minutes followed by 10 cycles of 30 seconds at
94°C, 30 seconds at 60°C and 1 minute at 72°C. As a negative
control, RT-PCR was run in parallel without gene-specific primers. After
washing out free dNTPs, fluorescent signals were observed using confocal laser
scanning microscopy (CLSM).
For semi-quantitative RT-PCR, the above gene-specific primers were used along with actin primers as a quantitative control: Ghactin-F (CCTCTTCCAGCCATCTTTCATC) and Ghactin-R (ATTCATCATACTCACCCTTGGA). Total RNA was extracted from various regions of plant tissue using a Qiagen RNeasy Plant Mini kit. Total RNA (2.5 µg) was used for cDNA synthesis and PCR was performed using Takara ExTaq polymerase. PCR was run at 94°C for 1 minute followed by 30 or 35 cycles of 30 seconds at 94°C, 30 seconds at 58°C, and 1 minute at 72°C, and an extension of 5 minutes at 72°C.
Standard RNA in situ hybridization was as described by Vielle Calzada et
al. (Vielle Calzada et al.,
1999
), except tissue in paraffin was sectioned at 10-15 µm and
hybridization was carried out at 55°C for 36 hours.
Virus induced gene silencing (VIGS)
A previously described Tobacco Rattle Virus (TRV)-based VIGS system was
used to silence CRC in Petunia and Nicotiana
(Liu et al., 2002
;
Chen et al., 2004
). A 575 bp
fragment of the petunia CRC gene corresponding to entire coding
region was cloned into pTRV2 to form pTRV2 CRC. The constructs pTRV1
and pTRV2 or pTRV2 (see Liu et al.,
2002
) CRC were transformed into Agrobacterium
strain GV3101 by electroporation. Virus infection was achieved by
Agrobacterium-mediated infection of Petunia hybrida or
Nicotiana bethamiana as described by Chen et al.
(Chen et al., 2004
). Flowers
were examined for aberrant phenotypes 2-6 weeks post infection. Selection of
Petunia flowers for examination was facilitated by the simultaneous
VIGS mediated silencing of chalcone synthase
(Chen et al., 2004
).
| Results |
|---|
|
|
|---|
Single origin of CRC in angiosperms
Bayesian phylogenetic analysis based on nucleotide sequences of two domains
of several members of the YABBY family from a broad spectrum of
angiosperm species and four gymnosperms resolved five major gene lineages,
represented by INO, CRC, YABBY2, FIL/YABBY3 and
YABBY5 (Fig. 2).
INO, CRC and YABBY5 genes formed strongly supported clades
with the posterior probabilities (i.e. probability of the hypothesis given the
data) of 100. YABBY2 and FIL/YABBY3 genes were,
however, weakly supported as monophyletic lineages. Each clade contains
members from basal angiosperms or monocots, suggesting the ancestral
angiosperms had five YABBY family genes, consistent with the results of Yamada
et al. (Yamada et al., 2004
).
Our gene trees weakly suggested that INO and CRC genes, both
of which are involved in developmental processes in flowers, are derived from
other YABBY genes that are expressed in all lateral organs
(Siegfried et al., 1999
).
Further sampling in gymnosperms is required to ascertain the antiquity of the
different clades of YABBY gene family members.
Our phylogenetic analysis of YABBY genes indicated that
CRC genes originated once during the evolution of the YABBY
genes. Thus, CRC genes in various diploid angiosperms are orthologs
(Hillis, 1994
) that have
diversified via speciation not by gene duplication. The topology within the
CRC gene clade is consistent with Soltis et al.
(Soltis et al., 2000
), even
though our sampling of the genes is limited. The CRC genes from monocots and
Brassicales both formed strongly supported clades, as did two cotton
genes.
CRC expression in floral nectaries is well conserved in Brassicaceae/Cleomaceae
In Brassicaceae/Cleomaceae species
(Hall et al., 2002
), nectaries
develop at the bases of stamen filaments
(Fahn, 1979
). Norris
(Norris, 1941
) classified
Brassicaceae nectaries into three types: annular, four-nectary and two-nectary
types. Arabidopsis thaliana is a four-nectary type with two medial
and two lateral nectaries (Baum et al.,
2001
); Lepidium africanum is a two-nectary type with only
two medial nectaries (Fig. 3A);
and Cleome sparsifolia has annular type nectaries in which glands
develop continuously around the circumference of the androecium
(Fig. 3F). Although the sizes
of nectary glands vary among these species, their external organizations are
similar. Stomata develop at the abaxial tips of nectary glands
(Fig. 3B), and epidermal cells
of nectaries have distinctive reticulate cuticular thickenings
(Baum et al., 2001
). In these
species, CRC expression commences at or before initiation of nectary
development, increases during growth of the nectary, and decreases after
anthesis (Fig. 3C,D,G). In
carpels, CRC expression commences early, and is associated with
abaxial regions of the carpel walls (data not shown), similar to
Arabidopsis (Bowman and Smyth,
1999
).
|
To determine whether CRC expression correlates with extrafloral
nectary development in phylogenetically distant species, GhCRC
expression in extrafloral nectaries of Gossypium hirsutum (cotton)
was analyzed. In G. hirsutum, extrafloral nectaries develop from the
midvein on the abaxial sides of leaves and cotyledons, and on involucre
bracts, leaf-like organs that subtend flowers. Nectaries consist of
multicellular secretory structures that proliferate in a concave indentation
on the abaxial midvein, positioned approximately one-third of the distance to
the distal tip of the leaf (Fig.
4A-D). Owing to high concentrations of secondary metabolites, RNA
in situ hybridization was difficult in this species and our experimental
results were equivocal. Thus, GhCRC expression was analyzed by RT-PCR
and in situ RT-PCR, which detected GhCRC expression in the
nectariferous cells of the leaf and bract
(Fig. 4E,F). To evaluate the
specificity and levels of GhCRC expression during nectary
development, semi-quantitative RT PCR was performed using actin as a
quantitative control (Holland et
al., 2000
). GhCRC is not only expressed in developing
nectaries but also in other regions of the leaves, albeit at lower levels.
GhCRC expression commences at an early stage of leaf development
before any visible signs of secretory cells and is more abundant in the region
of developing extrafloral nectaries. This expression pattern is also observed
in extrafloral nectaries on involucre bracts. At a stage when nectaries are
morphologically visible, levels of GhCRC mRNA are clearly higher than
in other regions within the bract (Fig.
4G). Although not evident at the cellular level, RNA analysis
suggests that GhCRC is correlated with extrafloral nectary
development in G. hirsutum.
Gossypium tomentosum, a native Hawaiian species closely related to
G. hirsutum, does not develop extrafloral nectaries, a derived
condition within the genus (Small et al.,
1998
). Previous genetic analysis of the nectariless phenotype
suggested that two loci are involved, with the G. tomentosum alleles
being recessive (Meyer and Meyer,
1961
). As these species are AD genome allotetraploids, and the two
nectariless loci mapped to syntenous regions of the two genomes in G.
tomentosum, changes in a single gene may be responsible for the
nectariless phenotype. To determine whether mutations in CRC could be
responsible for the nectariless phenotype, two experiments were conducted.
First, we analyzed F2 plants derived from an F1 hybrid between G.
hirsutum and G. tomentosum, and examined the segregation of
CRC orthologs in nectariless individuals by RFLP analyses (data not
shown). That the nectariless individuals did not predominantly have the G.
tomentosum CRC allele indicates that alleles at this locus are not
involved in the nectariless phenotype. In addition, mapping studies using
CRC RFLP markers positioned the CRC orthologs on chromosomes
6 and 14, which does not correspond to the map positions of the nectariless
phenotype [chromosomes 5 and 9 according to Meyer and Meyer
(Meyer and Meyer, 1961
)]. In
G. tomentosum, CRC expression is reduced in seedlings when compared
with G. hirsutum. In the apices of seedlings at the stage when
cotyledons have expanded, CRC is expressed at high level in G.
hirsutum, whereas there is no expression detected in G.
tomentosum (compare lane 29 with lane 32 in
Fig. 4G).
|
|
80% of N. benthamiana
flowers exhibited a severe phenotype, as depicted in
Fig. 5. In Petunia,
concomitant downregulation of chalcone synthase allows one to select flowers
exhibiting VIGS. The most severe phenotype observed was a loss of floral
meristem determinacy, with the cells normally giving rise to the placenta
instead developing into another flower
(Fig. 5M). However, in
Petunia hybrida, downregulation of PhCRC via VIGS was less
severe, with a conspicuous phenotype in only two plants out of eight examined,
and less than 50% of white flowers exhibiting indeterminacy. We interpret
these results as a partial loss of CRC function induced by VIGS in
Petunia and a more severe loss of CRC function in N.
benthamiana, perhaps owing to N. benthamiana being more
susceptible to virus infection (Yang et
al., 2004
Conservation and changes in regulating CRC: mechanisms to retain CRC as a nectary regulator?
CRC expression in extrafloral nectaries of Gossypium
hirsutum implies alterations in spatial and temporal control of
CRC gene regulation relative to that of Arabidopsis. Thus,
we examined whether changes have occurred in the GhCRC promoter
itself by examining its activity in Arabidopsis. The GUS reporter
gene was transcriptionally fused with 8 kb of sequence 5' to the coding
region of GhCRC and transformed into Arabidopsis. Whereas
the Arabidopsis CRC promoter drives expression in nectaries and
carpels, the Gossypium CRC promoter drives GUS expression in a
pattern reminiscent of CRC expression in Gossypium
(Fig. 6A-E). Expression
initiates in seedlings, primarily in the vasculature, with maximum expression
proximally in the midvein where nectaries normally develop in cotton
(Fig. 6A-C). GUS expression was
never found in floral nectaries of Arabidopsis, though floral
expression is detected in the pedicel and receptacle, as well as the style and
stigma of the gynoecium (Fig.
6D,E). In contrast to the dramatic differences in the
GhCRC promoter, a GhCRC cDNA is fully functional in
Arabidopsis, rescuing the phenotypic defects of crc-1
mutants when expressed under control of the Arabidopsis CRC promoter
(Fig. 6G). Consistent with the
change in expression domain, pGhCRC 8kb::GhCRC never rescued
nectary development in crc-1 mutants, although it frequently rescued
carpel fusion defects (data not shown), suggesting that promoter elements
directing carpel expression might be partially functionally conserved. As a
positive control, the heterologous Lepidium promoter
(pLaCRC, 4.3 kb) transcriptionally fused with GUS results in an
expression pattern indistinguishable from Arabidopsis CRC and
pLaCRC fused to the LaCRC-coding region can fully rescue
crc-1 mutants (Fig.
6F).
|
CRC expression in Aquilegia flowers (Ranunculaceae): a basal eudicot
Nectaries in Aquilegia flowers develop at the tips of petal spurs,
the length of which is pollinator specific. Although there has been some
debate on the identity of petal spurs of Aquilegia (e.g.
Erbar et al., 1998
), the
simplest interpretation is that spurs are extensions of petals
(Fig. 1;
Fig. 7A). As with petals in
most eudicot species, Aquilegia petals develop slowly compared with
the other floral organs. Initial growth is in the lateral dimension, which
causes the organs to be flattened. Subsequently, anticlinal cell divisions in
the central region of the organs result in a furrow and from this furrow the
spur will develop such that it extends from the abaxial side of the petal.
Spur-like structures have been characterized in Antirrhinum mutants
where ectopic expression of KNOX genes in the petals may be responsible for
spur-like growth (Golz et al.,
2002
). Whether a similar mechanism directs spur growth in
Aquilegia is unknown. Anatomical observations of Aquilegia
nectar spurs reveal small cytoplasmically dense parenchyma cells on the
adaxial side of the spur tip. These cells appear to comprise the nectary
tissue (Fig. 7H-I).
|
| Discussion |
|---|
|
|
|---|
|
|
That the Arabidopsis CRC promoter drives expression in nectaries
and carpels in tobacco is consistent with the idea that CRC is
regulated similarly in these two distantly related eudicot species. The
regulation of other genes specifically expressed in nectaries, which are
apparently involved in biochemical pathways in later stages of nectary
development, is conserved between Brassica and Petunia,
suggesting that gene regulation at later stages of nectary development might
also be conserved among eudicots (Ge et
al., 2000
; Song et al.,
2000
). To better understand the genetic homology and diversity of
nectaries, additional genes acting in conjunction and downstream of
CRC need to be surveyed across angiosperm taxa.
Derived nectary positions within the eudicots
Although nectaries in most eudicots are associated with reproductive
organs, some taxa, such as Capparis and Gossypium, exhibit
extrafloral or perianth associated nectaries. Mutant analyses in
Arabidopsis have shown that in some genetic backgrounds, e.g.
leafy and apetala1 mutants, nectaries develop extraflorally.
In these mutants, ectopic nectary structures expressing CRC develop
at the pedicel base or along the pedicel
(Baum et al., 2001
). However,
ectopic expression of CRC is not sufficient to generate ectopic
nectaries, implying that additional genes are required for nectary development
and that multiple changes in gene regulation, including that of CRC,
might be required to alter nectary positions in eudicot lineages. When
introduced into Arabidopsis, the Gossypium CRC promoter
directs expression of a reporter gene in a pattern reminiscent of CRC
expression in Gossypium, rather than the endogenous Arabidopsis
CRC pattern, suggesting that the trans-acting factors directing the
respective CRC expression patterns in the two species are conserved,
but are largely nonoverlapping. This is in contrast to the conservation of
gene regulation observed with pAtCRC::GUS in
Nicotiana where both cis- and trans-acting elements may be
functionally conserved. Thus, while activation of CRC in nectaries
associated with reproductive tissues in core eudicots could be conserved at
the level of trans-acting factors, activation of CRC in nectaries in
derived positions required the recruitment of different transcriptional
networks.
| Conclusions |
|---|
|
|
|---|
Shared CRC gene expression in diverse nectaries of core eudicots is in some
ways comparable with shared gene regulation during eye development.
Specification of the eye field requires homologous members of a retinal
determination gene network, including PAX6; the network is conserved
for different types of eyes in Bilateria
(Silver and Rebay, 2004
). This
striking conservation of master regulators of eye development challenged the
long-standing view of multiple origins of eye evolution
(Abouheif, 1997
). However,
developmental and physiological differences between insect and human eyes are
enormous, suggesting differential recruitment of downstream programs of eye
formation in each lineage under the same master regulators
(Pichaud et al., 2001
;
Nilsson, 2004
). Such genetic
conservation of master regulation is explained as a result of evolutionary
constraints of regulatory circuits for cuing some developmental processes
(Hodin, 2000
). Identifying
where genetic differences occur in each eye development pathway will shed
light on understanding the developmental differences arising during evolution.
Likewise, identification of additional nectary regulators is required to gain
insight into the conservation and divergence of nectaries within
angiosperms.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/22/5021/DC1
| REFERENCES |
|---|
|
|
|---|
Abouheif, E. (1997). Developmental genetics and homology: a hierarchical approach. Trends Ecol. Evol. 12,405 -408.
Alvarez, J. and Smyth, D. R. (1999). CRABS CLAW and SPATULA, two Arabidopsis genes that control carpel development in parallel with AGAMOUS.Development 126,2377 -2386.[Abstract]
Ambrose, B. A., Lerner, D. R., Ciceri, P., Padilla, C. M., Yanofsky, M. and Schmidt, R. J. (2000). Molecular and genetic analysis of the Silky1 gene reveal conservation in floral organ specification between eudicots and monocots. Mol. Cell 5,569 -579.[CrossRef][Medline]
APG (1998). An ordinal classification for the families of flowering plants. Annu. Missouri Bot. Gard. 85,531 -553.
Baum, S. F. and Rost, T. L. (1996). Root apical organization in Arabidopsis thaliana 1. Root cap and protoderm. Protoplasma 192,178 -188.[CrossRef]
Baum, S. F., Eshed, Y. and Bowman, J. L. (2001). The Arabidopsis nectary is an ABC-independent floral structure. Development 128,4657 -4667.[Medline]
Bowman, J. L. and Smyth, D. R. (1999). CRABS CLAW, a gene that regulates carpel and nectary development in Arabidopsis, encodes a novel protein with zinc finger and helix-loop-helix domains. Development 126,2387 -2396.[Abstract]
Brown, W. H. (1938). The bearing of nectaries on the phylogeny of flowering plants. Proc. Am. Phil. Soc. 79,549 -595.
Chen, J.-C., Jiang, C.-Z., Gookin, T., Hunter, D., Clark, D. and Reid, M. (2004). Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence. Plant Mol. Biol. 55,521 -530.[CrossRef][Medline]
Crepet, W. L. and Friis, E. M. (1987). The evolution of insect pollination in angiosperms. In The Origin of Angiosperms and their Biological Consequences (ed. E. M. Friis, W. G. Chaloner and P. R. Crane), pp. 181-202. Cambridge: Cambridge University Press.
Darwin, F. (1877) On the nectar glands of the common brakeferns. Bot. J. Linn. Soc. 15,407 -409.
Doebley, J. and Lukens, L. (1998).
Transcriptional regulators and the evolution of plant form. Plant
Cell 10,1075
-1082.
Elias, T. S. (1983). Extrafloral nectaries: their structure and distribution. In The Biology of Nectaries (ed. B. Bentley and T. S. Elias), pp.174 -203. New York: Columbia University Press.
Endress, P. K. (1986). Floral structure, systematics, and phylogeny in Trochodendrales. Annu. Missouri Bot. Gard. 73,297 -324.
Endress, P. K. (2001). The flowers in extant basal angiosperms and inferences on ancestral flowers. Int. J. Plant Sci. 162,1111 -1140.[CrossRef]
Erbar, C., Kusma, S. and Leins, P. (1998). Development and interpretation of nectary organs in Ranunculaceae. Flora 194,317 -332.
Eriksson, O. and Bremer, B. (1992). Pollination systems, dispersal modes, life forms, and diversification rates in angiosperm families. Evolution 46,258 -266.[CrossRef]
Eshed, Y., Baum, S. F. and Bowman, J. L. (1999). Distinct mechanisms promote polarity establishment in carpels of Arabidopsis. Cell 99,199 -209.[CrossRef][Medline]
Fahn, A. (1953). The topography of the nectary in the flower and its phylogenetic trend. Phytomorphology 3,424 -426.
Fahn, A. (1979). Secretory tissues in plants. New York: Academic Press.
Ferrario, S., Immink, R. G. and Angenent, G. C. (2004). Conservation and diversity in flower land. Curr. Opin. Plant Biol. 7, 84-91.[CrossRef][Medline]
Fourquin, C., Vinauger-Douard, M., Fogliani, B., Dumas, C. and
Scutt, C. P. (2005). Evidence that CRABS CLAW
and TOUSLED have conserved their roles in carpel development since
the ancestor of the extant angiosperms. Proc. Natl. Acad. Sci.
USA 102,4649
-4654.
Ge, Y.-X., Angenent, G. C., Wittich, P. E., Peters, J., Franken, J., Busscher, M., Zhang, L.-M., Dahlhaus, E., Kater, M. M., Wullems, G. J. et al. (2000). NEC1, a novel gene, highly expressed in nectary tissue of Petunia hybrida. Plant J. 24,725 -734.[CrossRef][Medline]
Golz, J. F., Keck, E. J. and Hudson, A. (2002). Spontaneous mutations in KNOX genes give rise to a novel floral structure in Antirrhinum. Curr. Biol. 12,515 -522.[CrossRef][Medline]
Hall, J. C., Systsma, K. J. and Iltis, H. H.
(2002). Phylogeny of Capparaceae and Brassicaceae based on
chloroplast sequences data. Am. J. Bot.
89,1826
-1842.
Hillis, D. M. (1994). Homology in molecular biology. In Homology: The Hierarchical Basis of Comparative Biology (ed. B. K. Hall), pp. 339-367. New York: Academic Press.
Hodin, J. (2000). Plasticity and constraints in development and evolution. J. Exp. Zool. 288, 1-20.[CrossRef][Medline]
Holland, N., Holland, D., Helentjaris, T., Dhugga, K. S.,
Xoconostle-Cazares, B. and Delmer, D. P. (2000). A
comparative analysis of the plant cellulose synthase (CesA) gene family.
Plant Physiol. 123,1313
-1323.
Huelsenbeck, J. P. and Ronquist, F. (2001).
MrBayes: Bayesian inference of phylogeny.
Bioinformatics 17,754
-755.
Izhaki, A., Borochov, A., Zamski, E. and Weiss, D. (2002). Gibberellin regulates post-microsporogenesis processes in Petunia anthers. Physiol. Plant 115,442 -447.[CrossRef][Medline]
Kyozuka, J., Kobayashi, T., Morita, M. and Shimamoto, K. (2000). Spatially and temporally regulated expression of rice MADS box genes with similarity to Arabidopsis class A, B and C genes. Plant Cell Physiol. 41,710 -718.[Medline]
Lee, J.-Y., Baum, S. F., Alvarez, J., Patel, A., Chitwood, D. H.
and Bowman, J. L. (2005). Activation of CRABS
CLAW in the nectaries and carpels of Arabidopsis. Plant
Cell 17,25
-36.
Liu, Y., Schiff, M. and Dinesh-Kumar, S. P. (2002). Virus-induced gene silencing in tomato. Plant J. 31,777 -786.[CrossRef][Medline]
Meeuse, A. D. J. (1978). Nectarial secretion, floral evolution, and the pollination syndrome in early angiosperms. Proc. K. Ned. Akad. B Ph. 81,300 -326.
Meyer, J. R. and Meyer, V. G. (1961). Origin and inheritance of nectariless cotton. Crop Sci. 1, 167-169.[Medline]
Nilsson, D.-E. (2004). Eye evolution: a question of genetic promiscuity. Curr. Opin. Neurobiol. 14,407 -414.[CrossRef][Medline]
Norris, T. (1941). Torus anatomy and nectary characteristics as phylogenetic criteria in the Rhoeadales. Am. J. Bot. 28,101 -113.[CrossRef]
Pellmyr, O. (1992). Evolution of insect pollination and angiosperm diversification. Trends Ecol. Evo. 7,46 -49.
Pichaud, F., Treisman, J. and Desplan, C. (2001). Reinventing a common strategy for patterning the eye. Cell 105,9 -12.[CrossRef][Medline]
Porsch, O. (1910). Ephedra campylopoda C. A. Mey, eine entomophyle Gymnosperme. Ber. Dtsch. Bot. Ges. 31,580 -590.
Posada, D. and Crandall, K. A. (1998).
Modeltest: testing the model of DNA substitution.
Bioinformatics 14,817
-818.
Proctor, M., Yeo, P. and Lack, A. (1996). The natural history of pollination. Portland, Oregon: Timber Press.
Qiu, Y.-L., Lee, J., Bernasconi-Quadroni, F., Soltis, D. E., Soltis, P. S., Zanis, M., Zimmer, E. A., Chen, Z., Savolainen, V. and Chase, M. W. (1999). The earliest angiosperms: evidence from mitochondrial, plastid and nuclear genes. Nature 402,404 -407.[CrossRef]
Ronse DeCraene, L. P. (2004). Floral development of Berberidopsis corallina: a crucial link in the evolution of flowers in the core eudicots. Annu. Bot. 94,741 -751.
Sawa, S., Watanabe, K., Goto, K., Kanaya, E., Morita, E. M. and
Okada, K. (1999). Filamentous Flower, a
meristem and organ identity gene of Arabidopsis encodes a protein
with a zinc finger and HMG-related domains. Genes Dev.
13,1079
-1088.
Siegfried, K. R., Eshed, Y., Baum, S. F., Otsuga, D., Drews, G. N. and Bowman, J. L. (1999). Members of the YABBY gene family specify abaxial cell fate in Arabidopsis.Development 126,4117 -4128.[Abstract]
Silver, S. and Rebay, I. (2004). Signaling circuitries in development: insights from the retinal determination gene network. Development 132, 3-13.
Small, R. L., Ryburn, J. A., Cronn, R. C., Seelanan, T. and
Wendel, J. F. (1998). The tortoise and the hare: choosing
between noncoding plastome and nuclear Adh sequences for phylogeny
reconstruction in a recently diverged plant group. Am. J.
Bot. 85,1301
-1315.
Soltis, P. S., Soltis, D. E. and Chase, M. W. (1999). Angiosperm phylogeny inferred from multiple genes as a tool for comparative biology. Nature 402,402 -404.[CrossRef]
Soltis, D. E., Soltis, P. S., Chase, M. W., Mort, M. E., Albach, D. C., Zanis, M., Savolainen, V., Hahn, W. H., Hoot, S. B., Fay, M. F. et al. (2000). Angiosperm phylogeny inferred from 18S rDNA, rbcL, and atpB sequences. Bot. J. Linn. Soc. 133,381 -461.[CrossRef]
Song, J. T., Seo, H. S., Song, S. I., Lee, J. S. and Choi, Y. D. (2000). NTR1 encodes a floral nectary-specific gene in Brassica campestris L. ssp. pekinensis. Plant Mol. Biol. 42,647 -655.[CrossRef][Medline]
Swofford, D. L. (2002). PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4.0b10. Sunderland, MA: Sinauer Press.
Swofford, D. L., Olsen, G. K., Waddell, P. J. and Hillis, D. M. (1996). Phylogeny reconstruction. In Molecular Systematics, 2nd ed. (ed. D. M. Hillis, C. Morit