spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 19 October 2005
doi: 10.1242/dev.02102


Development 132, 5043-5054 (2005)
Published by The Company of Biologists 2005


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.02102v1
132/22/5043    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nimmo, R.
Right arrow Articles by Woollard, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nimmo, R.
Right arrow Articles by Woollard, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

mab-2 encodes RNT-1, a C. elegans Runx homologue essential for controlling cell proliferation in a stem cell-like developmental lineage

Rachael Nimmo1, Adam Antebi2 and Alison Woollard1,*

1 Genetics Unit, Department of Biochemistry, University of Oxford, South Parks Road, Oxford OX1 3QU, UK
2 Huffington Center on Ageing and Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Room M-320, Houston TX 77030, USA

* Author for correspondence (e-mail: alison.woollard{at}bioch.ox.ac.uk)

Accepted 15 September 2005


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
In this report, we demonstrate that C. elegans mab-2 mutants have defects in the development of a male-specific sense organ because of a failure in the proliferation of the stem cell-like lateral hypodermal (seam) cells. We show, by positional cloning, that mab-2 encodes RNT-1, the only C. elegans member of the Runx family of transcriptional regulators, which are postulated to act both as oncogenes and tumour suppressors in mammalian cells. Importantly, we find that rnt-1 is a rate-limiting regulator of seam cell proliferation in C. elegans, as overexpression of rnt-1 at particular developmental stages is capable of driving extra cell divisions, leading to seam cell hyperplasia. Loss of rnt-1 is correlated with upregulation of cki-1, a CDK inhibitor. Deregulated expression of Runx genes in humans is associated with various cancers, particularly leukaemias, suggesting a conserved role for Runx genes in controlling cell proliferation during development, especially in stem cell lineages. C. elegans is therefore an important model system for studying the biology, and oncogenic potential, of Runx genes.

Key words: Caenorhabditis elegans, Runx genes, Cell proliferation, Male tail development


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
During development, it is essential for cell division to be properly regulated in time and space so that the correct number of cells are produced in the appropriate location at the required time. These controls ensure that the developmental process culminates in an organism of the appropriate size and complexity. Failure of such controls over cell proliferation can result in tumourigenesis in many metazoan organisms.

Coordination of cell division with growth and differentiation is achieved, at least in part, through the integration of extracellular signals during the G1 phase of the cell cycle (Zhu and Skoultchi, 2001Go). Cells respond to such signals by either advancing into, or withdrawing from, the next division cycle. Ultimately, signals impinge on the cell-cycle machinery intrinsic to each cell, composed of cyclin-dependent kinases (CDKs) and CDK inhibitors (CDKIs) among other factors.

During C. elegans development, cell divisions are almost completely invariant and well characterised (Sulston and Horvitz, 1977Go; Sulston et al., 1983Go). The effects of mutations on cell proliferation during development can thus be analysed at high resolution. Normal development gives rise to 959 somatic nuclei in the wild-type hermaphrodite and 1031 in the male. As an organism develops, individual cells must either continue to divide (proliferate) or differentiate and adopt a specialised function. Many cell lineage mutants have been identified that do not produce the correct number of cells, and these may be subdivided in various ways. For example, some mutants are defective in cell division itself, others have defects in the timing of particular cell divisions and a third group have defects in the polarity, or asymmetry, of divisions, leading to fate changes that may influence the choice between subsequent proliferation and differentiation.

The C. elegans male tail is an excellent system for genetic studies because this sensory organ is dispensable for viability. The male tail includes the proctodeum, which houses two sclerotized spicules and associated musculature used for the transfer of sperm, and a cuticular fan containing sensory rays used to locate the hermaphrodite vulva during mating (Sulston et al., 1980Go). The male tail forms from postembryonic divisions of male-specific blast cells and extra divisions of posterior lateral hypodermal (seam) cells and is particularly sensitive to alterations in cell number, which result in recognisable developmental defects. A well-defined set of mutants, the Mab (male abnormal) mutants, have a range of defects in male tail development (Hodgkin, 1983Go). mab-2 mutants have variable defects in sensory ray formation (Hodgkin, 1983Go).

In this report, we show that the mab-2 phenotype is caused by reduced proliferation of seam cells in both sexes, resulting in the loss of V and T derived rays in males. We show that mab-2 encodes a Runt domain transcription factor, RNT-1, which is similar to Runx proteins from other species. In humans, mis-expression of Runx genes is associated with leukaemias and other cancers (reviewed by Coffman, 2003Go). Most importantly, we find that overexpression of mab-2/rnt-1 in C. elegans causes seam cell hyperplasia, suggesting that mab-2/rnt-1 is a conserved factor required to control the extent of cell proliferation during the development of metazoan organisms.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Strains and C. elegans maintenance
All C. elegans strains were derived from the wild-type Bristol strain N2. Routine maintenance of worms and genetic manipulations were performed as described previously (Sulston and Hodgkin, 1988Go). The him-5(e1490) and him-8(e1489) alleles were used where necessary to generate a high proportion of males. Phenotypic analyses were carried out using a Zeiss Axiophot microscope fitted with DIC and fluorescence optics as appropriate. Worms were anaesthetised on 2% agarose pads as previously described (Sulston and Hodgkin, 1988Go). Statistical analysis of quantitative data was performed using the unpaired two-tailed heteroscedastic t-test function of Microsoft Excel.

Growth curves
Well fed young adult hermaphrodites were picked to a fresh plate and allowed to lay eggs for 1 hour at 20°C. Hatched larvae were then measured after 1, 2, 3 and 4 days growth at 20°C by mounting on 2% agarose pads containing anaesthetic and measuring the length of each worm using Axiovision software.

Mapping
mab-2 was originally mapped to the region between dpy-5 (0.00, cloned map position) and unc-13 (2.06, cloned map position) on LGI (Jonathan Hodgkin, personal communication). Further mapping revealed mab-2 to be to the right (or very close to the left) of unc-40 (0.32, cloned map position) and to the left (or very close to the right) of air-2 (0.49, cloned map position). The order of the nine cosmids in this region (left to right) is as follows: T19B4 (contains unc-40)–C04F1–F56H1–T22E7–B0414–C32F10–F33D11–C34G6–B020 7 (contains air-2). Confirmed single nucleotide polymorphism (SNP) markers assayable by restriction enzyme analysis, which differ between the Bristol N2 strain and the Hawaiian strain CB4856, are available for cosmids C04F1 (C04F1:3815) and C34G6 (C34G6:15466). Recombinants were picked from the heterozygote dpy-5 mab-2 unc-13/CB4856. Ten out of 10 Dpy Mab non-Unc recombinants were found to be wild type for SNP C04F1:3815, and nine out of nine Unc non-Mab non-Dpy recombinants were found to be Hawaiian for SNP C04F1:3815. These data indicate that mab-2 is to the right of C04F1:3815 (or very close to the left). Four out of four Unc Mab non-Dpy recombinants were found to be wild type for SNP C34G6:15466, and seven out of nine Unc non-Mab non-Dpy recombinants were found to be Hawaiian for SNP C34G6:15466. These data indicate that mab-2 lies to the left of C34G6:15466. The five cosmids between C04F1 and C34G6 were tested for rescue of mab-2(e1241), and cosmid B0414 was found to rescue the mutant phenotype completely. Oligos used for SNP C04F1:3815 were RN3 (5'GGATTTATCAGCGATGGATCAG) and RN4 (5'CATTGCCAGAGGGATTGAAC), yielding a 784 bp PCR product, cut by Tsp45I in N2 to give bands of 490 bp and 294 bp. For SNP, C34G6:15466 oligos were RN5 (5'GCAGTTCGGTGAGTGGATTG) and RN6 (5'GGTAGCAGATGTTTACACAGTC), yielding a 992 bp PCR product, cut by Taq{alpha}1 in N2 to give bands of 42 bp, 225 bp, 276 bp and 449 bp, and in CB4856 to give bands of 25 bp, 42 bp, 225 bp, 251 bp and 449 bp. These differences could be easily resolved on a 2% agarose gel.

Lineage analysis
Worms were mounted on 2% agarose pads (Sulston and Hodgkin, 1988Go) in 2 µl of M9 to which a smear of OP50 bacteria had been added and mixed. A 12x12 mm coverslip was gently lowered onto the worm and the divisions of the seam cells were observed using Nomarski DIC optics and a 63 x oil immersion objective (Zeiss) over a period of 18-20 hours.

Transgenic worms
Plasmids were injected into the syncytial gonad of young adult hermaphrodite worms at a concentration of 30 ng/µl as described (Mello and Fire, 1995Go), along with the rol-6 transformation marker (at 50-100 ng/µl). Rol progeny were picked and stable lines selected for analysis. Several lines were generated for each construct.

Transformation rescue of rnt-1
Cosmid B0414 was found to rescue the rnt-1(e1241) mutant phenotype. Subclones were generated to test for single gene rescuing activity and a fragment containing the single gene B0414.2 was found to rescue. This subclone was generated by PCR amplification from cosmid B0414 and TA cloned into TOPOXL (Invitrogen) in two halves using oligos RN64 and RN83 (5' half) and RN68 and RN82 (3' half). The 3' half (7902 bp) was then subcloned into the 3' end of the 5' half (8428 bp) using XbaI and BglII to generate the full-length B0414.2 genomic clone pAW258. The rescued strain referred to in this report carrying the whole cosmid B0414 is AW44 [rnt-1(e1241); him-5(e1490); ouEx15[B0414 + rol-6]] and the rescued strain referred to in this report carrying the single gene B0414.2 (rnt-1) is AW68 [rnt-1(e1241); him-5(e1490); ouEx17[B0414.2 + rol-6]].

Sequencing of rnt-1 alleles
Primers were used to amplify rnt-1 coding sequences from appropriate mutant worms for sequencing using the high-fidelity Expand DNA polymerase (Roche). PCR from worms was performed as described previously (Williams, 1995Go). Sequences (both strands) of at least two independent PCR products were analysed using Pairwise Alignment in BioEdit.

GFP reporter constructs
A rnt-1 translational GFP fusion construct was made using pPD vectors kindly supplied by the Fire Lab (Stanford University). All constructs were verified by sequencing. To make rnt-1::GFP, GFP from pPD119.16 was excised using SmaI and inserted into the StuI site at the 3' end of the 3' rnt-1 clone. Then, this GFP-tagged 3' clone was inserted into the 3' end of the 5' clone using XbaI and BglII as above, to generate a full-length genomic GFP-tagged rescuing construct, pAW260. The rescued strain referred to in this report carrying this rnt-1::GFP translational fusion is AW109 (rnt-1(e1241); him-5(e1490); ouEx26[rnt-1::GFP + rol-6]. rnt-1(ok351) him-5 (e1490) was crossed into the scm::GFP seam cell reporter strain (JR667) to generate the strain AW58, into a myo-3::GFP muscle cell reporter (strain PD4251) to generate the strain AW106 and into a cki-1::GFP reporter (strain VT825) to generate the strain AW148.

Heat-shock constructs
A full-length rnt-1 cDNA construct was generated by PCR from a C. elegans cDNA library (gift from R. Barstead, Oklahoma University) and used to generate two hsp-16 driven constructs (F primer 5'GCTAGCCAGTGCTGGAAGTATTCTGGG, RN87; R primer 5'GAGCTCCTGAAGAGGTAGGAAACAATTGAG, RN88, product 994bp). pAW261 consists of the rnt-1 cDNA cloned into pPD49.78 (hsp16-2 driven) as a NheI-SacI fragment. pAW262 consists of rnt-1 cDNA cloned into pPD49.83 (hsp16-41 driven) as a NheI-SacI fragment. The transgenic line generated for pAW261 described in this study is AW87 (him-5(e1490); ouEx19[hsp16-2::rnt-1 + rol-6+]). AW87 was crossed into the scm::GFP seam cell reporter strain to generate the strain AW102 and into rnt-1(e1241); him-5(e1490) to generate the strain AW103. A transgenic line was also constructed carrying pAW262 as well as an elt-2::GFP intestinal reporter (gift from Joel Rothman, University of California, Santa Barbara) by co-injecting both reporters in addition to the rol-6 transformation marker, to generate the strain AW100 (him-5 (e1490); ouEx23[hsp16-41::rnt-1 + elt-2::GFP + rol-6).

Heat-shock experiments
Worms were staged by bleaching gravid adult hermaphrodites to produce a pure egg population that was then allowed to hatch in the absence of food to produce a synchronous population of arrested L1 stage animals (Sulston and Hodgkin, 1988Go). These animals were then re-fed on OP50 seeded NGM plates and heatshocked at 33°C for 1 hour at different larval stages.

RNAi
PCR primers, including T7 or T3 RNA polymerase promoter sites were designed to be specific for rnt-1, and to amplify 504 bp of mostly exonic sequence (F primer 5'ATTAACCCTCACTAAAGGTTACGGTTGATGGACC, RN84; R primer 5'AATACGACTCACTATAGCGGAGAAGAACTATTCG, RN85). Primers specific for cki-1 amplified 602 bp (F primer 5'ATTAACCCTCACTAAAGGTCTTCTGCTCGTCGTTGCC, RN90; R primer 5'AATACGACTCACTATAGGAGAGCATGAAGATCGAGTTCTG, RN91). dsRNA was synthesised directly from gel-purified PCR product as previously described (Fire et al., 1998Go) and injected into young adult hermaphrodites at a concentration of ~1 mg/ml. Injected worms were transferred to fresh plates 6 hours following injection and thereafter every 24 hours for 3 days.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
mab-2 mutants have missing V and T lineage derived rays
mab-2(e1241) mutant males have a variable missing ray phenotype, typically lacking 5 rays from each side of the tail (Fig. 1, Fig. 2D). The phenotype is identical in two other alleles of mab-2, os11 and os58 [kind gifts from Hitoshi Sawa (Fig. 2 and data not shown)]. Both V and T derived rays are variably missing. We also noticed a low (5-10%) penetrance ray fusion phenotype in mab-2 males (Fig. 1E). Ray fusions may simply be a consequence of missing intervening rays. However, it is also possible that mab-2 has some downstream function in specifying ray identity, separate from its function in specifying ray number.



View larger version (90K):
[in this window]
[in a new window]
 
Fig. 1. Loss of V and T rays in mab-2 mutants. (A) him-5(e1490) male tail, wild-type appearance. Lateral view. Nine sensory rays are visible on this side of the animal. Rays 1-6 are derived from the V lineage and rays 7-9 are T-lineage derived. Scale bar: 10 µm. (B) mab-2(e1241); him-5(e1490) male tail. Only three rays are present (white arrows). Scale bar: 10 µm. During execution of the ray sublineages, the ray precursor cells (R1-R9) divide to give a posterior hypodermal cell (R1.p-R9.p) and an anterior daughter that will go on to undergo two rounds of division to give rise to three cells (the fourth will die) that will make up the ray (two neuronal cells and a structural cell). R1.p-R5.p will make up the tail seam (set), whereas R6.p-R9.p will later fuse with hyp 7. At the stage shown, Rn.p cells are visible (labelled), as are cells from the anterior branch of each ray sublineage that will comprise each ray (white asterisks). Scale bar: 10 µm. (C,D) The arrangement of male tail hypodermal cells in L4 males visualised using the ajm-1::GFP reporter in him-5 and him-5; mab-2 animals. (C) him-5(e1490) male tail. Lateral view. R1.p-R8.p and associated ray cells are visible in this focal plane. (D) mab-2(e1241); him-5(e1490) male tail. Four Rn.p cells are present. These cells have enlarged to fill the gap left by the absence of other Rn.p cells. Scale bar: 10 µm. (E) mab-2(e1241); him-5(e1490) male showing a low penetrance (5-10%) ray fusion phenotype. Two white arrows indicate the fused rays. Scale bar: 10 µm. Posterior is towards the right in all panels.

 
To examine the cellular basis of the missing ray phenotype, we examined tail development using the ajm-1::GFP reporter (Strain SU93), which marks adherens junctions and shows the outlines of male tail precursor cells derived from the posterior seam. We found fewer ray precursor cells in mab-2 mutants compared with wild type (Fig. 1), indicating either a failure of cell proliferation or a cell fate transformation in V5, V6 and T lineages.

mab-2 encodes RNT-1, a member of the Runx group of transcription factors
We mapped mab-2 to the centre of chromosome 1, between unc-40 and air-2, using three-factor crosses (see Materials and methods). SNP mapping was then used to further map mab-2 to a region spanned by seven cosmids (see Materials and methods) and these cosmids were tested for rescuing activity. The cosmid B0414 was found to completely rescue the phenotype of mab-2 mutant worms, and a subclone including the full ORF of only one gene, B0414.2, was subsequently found to provide all of this rescuing activity (Fig. 2A). Examination of the sequence of B0414.2 revealed it to encode a transcription factor of the Runx family, members of which include human RUNX1, RUNX2, RUNX3 and Drosphila runt and lozenge (Fig. 2C). B0414.2 has been given the name RNT-1 in Wormbase (http://www.wormbase.org/) and is the only Runx orthologue present in the worm genome.

A deletion allele of rnt-1 is available from the C. elegans Knockout Consortium (Oklahoma, USA, allele ok351). We found that this allele fails to complement the male tail phenotype of mab-2(e1241) (Fig. 2A), demonstrating that mab-2 and rnt-1 are allelic. For simplicity we will henceforward refer to mab-2 as rnt-1. The male tail phenotype of the rnt-1 deletion allele, ok351, is indistinguishable from e1241, with the same number of rays, on average, being missing from each side of the tail (Fig. 2D).



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 2. mab-2 encodes RNT-1, a Runx transcription factor. (A) (i) him-5(e1490) male tail. (ii) mab-2(e1241); him-5(e1490) male tail. (iii) mab-2(e1241); him-5(e1490); ouEx15[B0414 + rol-6] male tail. Wild-type appearance is restored using this cosmid. (iv) mab-2(e1241); him-5(e1490); ouEx17[B0414.2 + rol-6] male tail. Wild-type appearance is restored using the single gene B0414.2, encoding the Runx transcription factor rnt-1. (v) male tail from a e1241/ok351 trans-heterozygote, showing that these two alleles fail to complement each other. (vi) Male tail from a e1241/os58 trans-heterozygote, again showing non-complementation between the two alleles. Scale bar: 10 µm. Posterior is towards the right in all panels. (B) Schematic representation showing the genomic structure of the rnt-1 gene, the nature and position of the mutations in e1241 and os58 alleles, and the deletion in ok351. The genomic region shown corresponds to the region cloned in the rescuing construct pAW258. The position of the GFP insertion in pAW260 is also indicated. (C) Alignment of Runx genes from various species showing the conserved DNA-binding domain. Identical amino acids are shown in black; similar amino acids are in grey. The Runt domain of rnt-1 (Accession Number O01834) is 51% similar to Drosophila Runt (Accession Number CAA39817), 50% similar to human RUNX1 (Accession Number NP_001745) and 50% similar to mouse Runx1 (Accession Number Q03347). Sequence alignments were performed using ClustalW and processed using BioEdit software. The nature of the mutations in e1241, os58 and ok351 animals are indicated with asterisks. The ok351 deletion removes 10 amino acids of the Runt domain plus 29 amino acids downstream in an in-frame deletion. (D) Bar chart showing a quantitative analysis of ray number in wild-type (n=33), rnt-1(os58) (n=37), rnt-1(e1241) (n=31), rnt-1(ok351) (n=35), rnt-1(RNAi) (n=28) and rnt-1(e1241); ouEx26[rnt-1::GFP+rol-6+] (n=35) males. Ray number in all three rnt-1 alleles, as well as in rnt-1(RNAi) males is significantly different from wild type (P<0.0001). Ray number in rnt-1(e1241); Ex[rnt-1::GFP] males is not significantly different from wild type (P>0.05), indicating rescue. Error bars represent the standard error of the mean. (E) Graph showing length growth curves of wild-type and rnt-1(ok351) animals. There is no significant reduction in the length of ok351 animals compared with wild-type animals until the worms have reached adulthood, 4 days after eggs were laid. A ~5% decrease in ok351 body length is seen at this time point (n=33 for wild type, 30 for ok351, P<0.00001). Error bars represent the s.e.m.

 
The molecular nature of the lesions associated with these alleles are shown in Fig. 2. The mutation in e1241 results in a single amino acid substitution, I112K, in a conserved part of the DNA-binding domain, changing a hydrophobic residue into a hydrophilic one. os58 contains a premature stop codon near the N terminus of the protein (H. Kagoshima, personal communication). This allele is therefore a likely null allele and has the same male tail phenotype as e1241 and ok351 (Fig. 2D). The trans-heterozygote os58/e1241 is indistinguishable from a e1241 or os58 homozygote (Fig. 2A; data not shown). The deletion in ok351 removes 10 amino acids from the Runt domain plus an additional 29 amino acids downstream, but leaves the reading frame intact.

Silencing rnt-1 using RNA interference (RNAi) also gave rise to males with missing rays, similar to the loss of function alleles described (Fig. 2D). There was a small but significant amount of embryonic lethality associated with rnt-1 RNAi (18% embryonic lethality at 25°C in him-8(e1489); rnt-1(RNAi) animals compared with 3.6% embryonic lethality in him-8(e1489) animals kept at 25°C but not subjected to RNAi: 14.4% lethality is thus attributable to the effects of rnt-1 RNAi). A similar amount of embryonic lethality is seen in rnt-1(os58) animals [50% embryonic lethality in rnt-1(os58); him-5(e1490) animals kept at 25°C compared with 38% embryonic lethality in him-5(e1490) animals alone kept at 25°C: 12% lethality is thus associated with the os58 allele]. None of the other rnt-1 alleles displays any significant embryonic lethality, so it is possible that those alleles, including the deletion allele ok351, are non-null. rnt-1(os11) was found to be largely inviable at 25°C, with much reduced fertility, but the lesion in os11 animals appears to be a large deletion also affecting a neighbouring gene (R.N. and A.W., unpublished), which known from genome-wide RNAi screens to be essential (Kamath et al., 2003Go).

rnt-1 hermaphrodites have no defects at the gross morphological level, except a slight (5%) reduction in body length at adulthood (Fig. 2E). The slight reduction in body length is similar in all alleles tested (data not shown). We noticed that the reduction in body length was more pronounced in rnt-1 worms recovering from starvation, and these worms were found to be very sick (data not shown), suggesting that rnt-1 may have some function in stimulating growth following starvation. No other defects were observed in any of the rnt-1 mutant strains tested, or in rnt-1(RNAi) animals.

Seam cell number is reduced in rnt-1 animals
In wild-type males, the rays are generated by seam cells. Seam cell divisions in both sexes provide hypodermal nuclei and a postdeirid neuroblast (Sulston and Horvitz, 1977Go). In males, extra divisions in the posterior seam cells V5, V6 and T and subsequent specification of ray neuroblasts result in generation of the 18 rays.

We analysed the number of seam cells in rnt-1 mutants using the seam cell marker scm::GFP. Wild-type adult hermaphrodites usually contain 16 seam cells on each side of the animal at the end of development, derived from the 10 embryonically derived blast cells H0, H1, H2, V1-V6 and T (Fig. 3). rnt-1 mutant hermaphrodites contain fewer, typically 13 (Fig. 3). Male rnt-1 mutant worms also contain fewer seam cells, typically 11, compared with 18 in wild type (Fig. 3). This indicates that rnt-1 activity is required in both males and hermaphrodites for either seam cell proliferation or differentiation, and that this is the basis of the male tail phenotype, as sensory rays are generated from posterior seam cells. Seam cells in rnt-1 animals (albeit reduced in number) fuse normally in L4 (visualised with ajm-1::GFP, data not shown), indicating that they maintain the correct fate. In hermaphrodites, seam cells are responsible for the formation of alae, cuticular ridges on the surface of the worm (Sulston and Horvitz, 1977Go). Despite the lack of seam cells in rnt-1 mutants, alae do not appear to be defective (data not shown), again indicating that correct seam cell fate is maintained in the remaining seam cells.

rnt-1 is expressed in seam cells
The expression pattern of a rescuing translational rnt-1::GFP fusion construct is shown in Fig. 4. rnt-1::GFP is visibly expressed in the nuclei of seam cells in embryos from around 260 minutes post fertilisation, just after the time at which seam cell are formed. Seam cell expression in both males and hermaphrodites is visible during all developmental stages, but is particularly strong until late L2. In males, rnt-1::GFP is expressed additionally in seam cell derived ray precursor cells and ray sublineages. rnt-1::GFP is also expressed transiently in body wall muscle nuclei from late embryogenesis until the end of L2 (Fig. 4). We could find no obvious phenotype associated with expression of rnt-1 in body wall muscle. Both the number and arrangement of body wall muscle nuclei (assayed using a myo-3::GFP reporter) in rnt-1 mutants appears normal (data not shown). We did not observe rnt-1::GFP expression in any other cell types. Expression of rnt-1 has been previously reported in intestinal cells (Nam et al., 2002Go), but we did not find any intestinal expression using our rescuing GFP reporter construct, nor did we observe any intestinal defects in rnt-1 mutant alleles or rnt-1(RNAi) animals. Our rescuing GFP reporter contains the endogenous rnt-1 3'UTR that was absent from the reporter described by Nam et al. It is possible that this difference in reporters accounts for the slight difference in the rnt-1 expression pattern observed.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3. rnt-1 mutants have fewer seam cells. (A) Lineage diagram showing V and T lineage divisions in wild-type males. Seam cells are indicated by circles, hyp7 nuclei by squares, glial and neuronal cells by diamonds, and ray precursor cells by triangles. Proliferative divisions are in bold. The broken lines indicate parts of the lineage omitted for simplicity. The V and T lineages of the male are identical to those of the hermaphrodite until the end of L2. Divisions are asymmetric and stem cell like, with the anterior daughter adopting the syncytial fate (fusing with the hypodermal cell hyp7) and the posterior daughter adopting the proliferative fate (Sulston and Horvitz, 1977Go). An exception to this division pattern is at the beginning of L2, when an extra symmetrical division occurs in both sexes in V1-V4, V6 and T, resulting in an increase in seam cell number. In hermaphrodites, asymmetric divisions then continue, whereas in males V5-, V6- and T-derived cells undergo extra symmetrical, proliferative divisions at the beginning of L3 in order to generate nine ray precursor cells (R1-R9) (Sulston and Horvitz, 1977Go). Male-specific ray sub-lineages then give rise to nine similar sets of neuronal-like cells (including a structural cell) on each side of the animal, corresponding to the nine rays found on each side of the male tail, as well as nine hypodermal-like cells (Rn.p cells). The characteristic ray sensilla are formed by retraction of the hypodermis surrounding the ray cell groups, leaving finger-like protrusions embedded in the cuticular fan. (B,C) Seam cells in adult hermaphrodites visualised using the scm::GFP reporter. This reporter shows all seam cell nuclei (white arrows indicate one such nucleus in each panel) present along the length of the animal. (B) him-5(e1490). All 16 seam cells are present. (C) rnt-1(ok351); him-5(e1490) adult hermaphrodite. Fewer seam cells are present, 11 in this specimen. The most anterior seam cell is not visible in this photograph. Scale bar in B: 70 µm for B,C. (D) Graph showing a quantitative analysis of seam cell number in him-5(e1490) (n=30) and rnt-1(ok351); him-5(e1490) (n=32) adult hermaphrodites and males (n=30 for him-5(e1490) males; n=28 for rnt-1(ok351); him-5(e1490) males). There is a significant difference between wild-type and rnt-1 seam cell number in both hermaphrodites and males (P<0.0001). Error bars represent the s.e.m. The y-axis starts at 10 to reflect the number of seam cells present at hatching, as it is only post-embryonic divisions that are affected in rnt-1 mutants.

 
rnt-1 is specifically required for seam cell proliferation, not cell fate determination
One possible interpretation of our data could be that rnt-1 is required for cell fate determination, rather than cell proliferation per se. For example, controls acting on the polarity of seam cell divisions can influence cell proliferation. The seam cells normally undergo polarized divisions during larval development, such that the posterior daughters (Vn.p) adopt the seam cell (proliferative) fate and the anterior daughters (Vn.a) adopt the non-proliferative, syncytial fate, fusing with the hypodermal syncytium hyp7 (Sulston and Horvitz, 1977Go). It is therefore possible that rnt-1 mutants could fail to maintain seam cell number if, at particular seam cell divisions, the posterior daughter adopted the hypodermal fate like its anterior neighbour. Alternatively, divisions could fail as a direct result of a failure to enter or progress through the cell cycle. In order to distinguish between these two possibilities, we performed a detailed lineage analysis of seam cell divisions in rnt-1 mutants. A lineage trace of seam cell divisions in a rnt-1(ok351) hermaphrodite from late L1 up to mid L3 is shown in Fig. 5B. Various seam division failures are evident in this animal, as discussed in the figure legend. A rnt-1(ok351) him-8(e1489) male seam cell lineage trace is shown in Fig. 5D.

The most common lineage defect in rnt-1 animals involves failures in L2 and L3 seam cell divisions. L1 divisions were found to be normal in all animals analysed. Thus, the main role of rnt-1 is to stimulate divisions of seam cells from L2 onwards. The lineage traces shown illustrate the variable nature of the division failures in different seam lineages. Moreover, different animals displayed different seam lineage failures (data not shown). This explains why rnt-1 males end up with a variable number of missing rays. L4 divisions and male ray sublineages were not extensively lineaged. The lineage defects observed do not appear to be heterochronic alterations, as lineages are only partially affected (usually the posterior branch). Two examples of potential cell fate transformations (in the anterior branch of V1 in the hermaphrodite and in the posterior branch of T in the male) were observed, but this type of defect was found to be rare.



View larger version (82K):
[in this window]
[in a new window]
 
Fig. 4. Domains of expression of rnt-1. (A,B) rnt-1(e1241); him-5(e1490) embryos carrying a rescuing rnt-1::GFP reporter construct. (A) rnt-1 expression is first seen in seam cell nuclei in embryos around 260 minutes after fertilisation. Dorsal view. Seam cells are visible on one side of the embryo (the left side) in this focal plane. Seven out of the nine H and V seam cells, labelled H0-H2 and V1-V4 are visible; V5 and V6 are out of focus. The T seam cell is ventral at this stage of development (Sulston et al., 1983Go). (B) Seam cell expression of rnt-1::GFP at the 1.5-fold stage. Lateral view. H and V seam cell nuclei are labelled. Again, T is out of focus, as is V6. Anterior is towards the left in both panels. Scale bar: 20 µm. (C,D) Seam cell expression of rnt-1::GFP in L1 larvae. (C) Lateral view. Seam cell nuclei are labelled. V5 is dividing (asterisk). Expression in H0 is fainter than in the other seam cells. Scale bar: 20 µm. (D) Corresponding Nomarski image. The outline of the dividing cell is clearly visible (asterisk). Inset is a higher magnification image of V3 (arrowhead) showing the morphology of seam cells. Anterior is towards the left in both panels. (E) Expression of rnt-1::GFP in body wall muscle nuclei. This is the same animal as in C, slightly different focal plane. Body wall muscle cells are present as four longitudinal rows at this stage, one ventral row and one dorsal row on each side of the animal. Two out of the four rows (one dorsal and one ventral) are visible in this lateral view (arrows). (F) myo-3::GFP body wall muscle reporter for comparison. Again, two longitudinal rows of cells are visible in this lateral view (arrows). Anterior is towards the left. Scale bar: 20 µm. (G) Male tail expression of rnt-1::GFP in early L3 showing ray precursor cells R1-R9. R5/6 and R8/9 have yet to divide. The V5-derived cell labelled with an arrowhead forms part of the body seam. Posterior is towards the right. Scale bar: 20 µm.

 
Ectopic expression of rnt-1 causes seam cell hyperplasia
Deregulated expression (both loss and gain of function) of Runx genes in humans is associated with various cancers (reviewed by Cameron and Neil, 2004Go). In particular, amplification of Runx1 has been associated with leukaemia (Roumier et al., 2003Go). To test the effects of overexpressing rnt-1 in C. elegans, we constructed transgenic worms carrying a full-length rnt-1 cDNA driven by the heat shock promoter hsp16-2, which drives high level expression in seam, hypodermal and neuronal cells (see Materials and methods). We found that heat shock of transgenic worms prior to L2 or after L3 had no effect on adult seam cell number (as assayed by scm::GFP expression), but heat shock during L2 and L3 caused a significant increase in the number of seam cells present in adult hermaphrodites (Fig. 6), indicating that rnt-1 is both necessary and sufficient for seam cell proliferation. Moreover, in males, these extra seam cells are capable of differentiating into extra rays (Fig. 6D).

Overexpression of rnt-1 does not appear to cause hyperplasia in other cell types. We looked at the number of intestinal nuclei (using an elt-2::GFP intestinal reporter) in heat shocked worms carrying an hsp16-41::rnt-1 construct (which would be expected to drive high level expression in the intestine) and found it to be normal (data not shown). We likewise found no increase in the number of body wall muscle cells, assayed using a myo-3::GFP reporter strain in heat shocked worms carrying an hsp16-2::rnt-1 construct (data not shown).

Suppression of rnt-1 seam cell division failures by cki-1 RNAi
cki-1 is a member of the KIP/CIP family of CDK inhibitors and is most similar to p27/kip1, which functions to link developmental programmes to cell cycle progression (Boxem and van den Heuvel, 2001Go; Fukuyama et al., 2003Go; Hong et al., 1998Go). KIP/CIP CDK inhibitors are thought to act by inhibiting the activity of the cyclin E/CDK2 complex during G1 (reviewed by Sherr, 2000Go). cki-1 in C. elegans has been reported to be required for developmental cell cycle arrest in several lineages and is known to be expressed in seam cells (Fukuyama et al., 2003Go; Hong et al., 1998Go). The temporal pattern of cki-1 expression in seam cells partially overlaps with that of rnt-1. Both genes are expressed strongly during embryogenesis and until mid-L1 (this report) (Fukuyama et al., 2003Go). High level expression of rnt-1 persists during larval development, whereas cki-1 expression declines sharply at mid-L1, to be restored during resting phases between larval moults and at L4, coincident with seam cell terminal differentiation (Fukuyama et al., 2003Go).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 5. rnt-1 is necessary for seam cell proliferation, not fate determination. Lineage traces are shown up to mid L3. The L1 asymmetric division is omitted for simplicity. Seam cells are indicated by circles, hyp7 nuclei by squares, and glial and neuronal cells by diamonds. Broken lines indicate incomplete lineages. The data shown are lineage traces for single animals. Five animals were lineaged and found to give similar results. (A) Wild-type hermaphrodite V1-V6 and T lineages. (B) rnt-1(ok351) hermaphrodite lineage trace of V1-V6 and T divisions. V2 and V3 divisions display a similar pattern in the lineage trace shown; the anterior branch divides normally, but there is a failure of the L2 asymmetric division in the posterior branch, leading to a reduction in hypodermal nuclei. V4 and V6 display a different defect; this time the L2 proliferative division fails, causing a reduction in seam and hypodermal nuclei. V5 divisions are normal in this lineage trace, leading to the correct formation of the post-deirid neuroblast. Normal post-deirids appeared to be present in all rnt-1 animals analysed (data not shown). V1 displays a similar defect to V2 and V3 in the posterior branch, a failure of the L2 asymmetric division, but there is an additional defect in the anterior branch. Both daughter nuclei from the L2 `asymmetric' division appear to fuse with the hypodermal syncytium, rather than the posterior daughter undergoing the proliferative fate. In the T lineage, the anterior branch is normal, but there is a division failure in the posterior branch, yielding just one seam cell, rather than a seam cell plus a glial cell. (C) Wild-type male V1-V4, V5, V6 and T lineages. A description of these divisions is given in the legend to Fig. 3. (D) rnt-1(ok351); him-8(e1489) male seam cell lineage trace. In V1 the L2 proliferative division occurs normally but there are no further divisions. Both daughters resemble seam cells. In V2, the posterior daughter of the L2 proliferative division does not divide further in L2 or L3 (it remains as a seam cell), while the anterior daughter undergoes one further asymmetric division in L2 to produce a hypodermal daughter and a seam daughter that fails to divide further in L3. In V3, the L2 proliferative division occurs normally and the anterior branch undergoes the normal asymmetric divisions in L2 and L3, while the posterior branch undergoes one asymmetric division in L2, after which the posterior seam daughter fails to divide further. In V4, the L2 proliferative division occurs normally and the anterior branch displays a similar division pattern to the anterior branch of V2, while the posterior branch undergoes the normal L2 and L3 asymmetric divisions. In V5, the anterior branch is normal but the posterior branch fails after the first L3 proliferative division, with both daughters failing to divide. In V6, L2 divisions are normal but there are failures in L3 divisions. The wild-type male V6 lineage normally undergoes two rounds of division in early L3, whereas in this rnt-1 male, only one round of division occurs in each branch. In the T lineage, the anterior branch was normal but there was, unusually, an extra proliferative division in the posterior branch during L2.

 
To test for a genetic interaction between rnt-1 and cki-1, we removed cki-1 expression by RNAi in a rnt-1 mutant background and assayed seam cell number. cki-1 RNAi in wild-type worms causes an increase in seam cell number in treated animals which survive to adulthood (Fig. 7A), indicating that cki-1 normally acts to limit seam cell proliferation. This is in agreement with a previous report showing seam cell hyperplasia induced by cki-1 RNAi in embryos (Fukuyama et al., 2003Go). When rnt-1(ok351) animals (which normally have reduced seam cell proliferation) are subjected to cki-1 RNAi, adult seam cell number is restored to almost wild-type levels (Fig. 7A). This suggests that rnt-1 and cki-1 may act at a similar point in the cell cycle to control seam cell proliferation in opposing ways.

One model for the opposing roles of rnt-1 and cki-1 in controlling seam cell proliferation would be that RNT-1 negatively regulates cki-1 expression in seam cells. We tested this possibility by examining cki-1::GFP expression in a rnt-1 mutant. The best situation in which cki-1 expression could be robustly analysed in seam cells during larval development was found to be during L1 (we found cki-1::GFP reporter expression to be too faint to analyse reliably after L1). Although, as discussed above, loss of rnt-1 does not normally affect the L1 stem cell division, we found that this division fails in rnt-1 animals that have been arrested in L1 diapause by hatching in the absence of food, before being allowed to recommence larval development by introducing food (Fig. 7B). By contrast, wild-type animals undergo this division normally when subjected to the same treatment (Fig. 7B), i.e. starvation sensitises the L1 division to loss of rnt-1. As shown in Fig. 7B, we found that cki-1::GFP expression in rnt-1 mutants whose seam cells fail to divide in L1 is higher than in wild-type animals whose seam cells divide normally. In other words, division failure is correlated with increased cki-1::GFP expression. This is good evidence that rnt-1 normally acts during G1 of the cell cycle to promote cell division by somehow downregulating cki-1 expression. It is not clear at present whether this interaction is direct or indirect.



View larger version (101K):
[in this window]
[in a new window]
 
Fig. 6. Overexpression of rnt-1 drives extra seam cell divisions. (A) Control wild-type worms subjected to heat shock (33°C, 1 hour) have the normal number of seam cells, visualised in adults with the scm:GFP reporter (white arrow). Scale bar: 70 µm. (B) Adult hermaphrodite carrying the hsp16-2::rnt-1 construct, previously subjected to heat shock (33°C, 1 hour) in L3. Several extra seam cells are visible with the scm::GFP reporter (white arrow). Anterior is towards the left in both panels. Scale bar: 70 µm. (C) Graph showing a quantitative analysis of adult seam cell number in heat shocked worms. Wild-type hermaphrodites subjected to heat shock (33°C, 1 hour) during L2 or L3 have the normal adult number of seam cells (data not shown). Transgenic worms carrying the hsp16-2::rnt-1 construct display the normal adult seam cell number following no heat shock (n=30), or heat shock during L1 (n=42) or L4 (n=25), but have extra seam cells following heat shock during L2 (n=31, P<0.01) or L3 (n=48, P<0.00001). Error bars represent the standard error of the mean. (D) him-5(e1490) male carrying the hsp16-2::rnt-1 construct. This animal had been previously subjected to heat shock during L2. An extra ray 3 is visible on one side of the animal, fused to the expected single ray 3 (white arrows). Scale bar: 10 µm

 

    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
rnt-1 promotes seam cell proliferation
All alleles of rnt-1 examined display similar male tail abnormalities owing to the loss of V and T lineage-derived rays. The cellular basis of the ray loss phenotype is a reduction in seam cell proliferation during larval development. Our data suggest that rnt-1 is required for both the proliferative and asymmetric divisions of seam cells that occur in males and hermaphrodites. In males, the cumulative effect of V5, V6 and T lineage divisions is to produce the correct number of ray precursor cells and execute the correct ray sublineages, hence rnt-1 mutants have missing rays. We found that silencing of cki-1, a G1 inhibitor normally active in seam cells, suppresses the seam cell proliferation defect, suggesting that rnt-1 and cki-1 act on the cell cycle to regulate cell proliferation in opposing ways. Intriguingly, we found that cki-1::GFP seam cell expression is upregulated in rnt-1 mutants, suggesting that RNT-1 acts in G1 to promote seam cell divisions via the downregulation of cki-1.

Our data support the view that the loss of seam cells is mainly the result of a defect in cell proliferation per se, rather than a change in cell fate. The rare cell fate, as opposed to cell proliferation, defects we did observe in rnt-1 animals may be explained by signalling defects. It is known that signalling among seam cells (acting in conjunction with lineage cues) is important for cell fate determination. This has been demonstrated most clearly in ablation studies, where extensive ablation of seam cells was found to cause various cell fate changes in the remaining seam cells (Sulston and White, 1980Go). Thus, cells with inappropriate neighbours may be expected to take on the wrong fate under certain circumstances. In this context, it becomes somewhat artificial to postulate a clear distinction between cell proliferation and cell fate determination.

A recent report suggests that rnt-1 functions to regulate body size and ray morphogenesis in C. elegans by interacting with components of the Sma/Mab TGFß signalling pathway (Ji et al., 2004Go). Although we do observe a small (5%) decrease in length in rnt-1 adult hermaphrodites, this is much less severe than in Sma animals. In the case of rnt-1, we suggest that this slight reduction in size is caused by a reduction in the number of nuclei in the hypodermal syncytium, which is caused by seam cell division failures. The relationship between hypodermal ploidy and body size in C. elegans has been previously discussed (Flemming et al., 2000Go). Moreover, we can see no phenotypic similarities between rnt-1 and Sma male tails. The Sma phenotype is typified by fused rays (Hodgkin, 1983Go; Morita et al., 1999Go; Savage-Dunn et al., 2003Go), whereas the rnt-1 phenotype is typified by missing rays caused by failures in seam cell proliferation, as indicated by our lineage analysis. It is possible that rnt-1 has some minor downstream role in ray morphogenesis, as evidenced by the very low penetrance ray fusion phenotype we observe in rnt-1 animals, but it is certain that the major focus of rnt-1 action is in the regulation of seam cell proliferation. Given that missing rays are not observed in Sma mutants, we consider it unlikely that this major function of rnt-1 involves an interaction with the Sma/Mab TGFß pathway.

Other genes known to influence ray development tend to affect specific ray sublineages. For example, mab-5, a posterior Hox gene, is required for proliferation and ray production in V5 and V6 sublineages but does not affect T lineage-derived rays (Kenyon, 1986Go; Salser and Kenyon, 1996Go). By contrast, ray loss in mab-19 mutants is restricted to T lineage-derived rays (Sutherlin and Emmons, 1994Go). rnt-1, however, has a more general role in seam cell proliferation which is required for the subsequent development of both V and T-derived rays.

Defective male tail formation is the only highly penetrant gross morphological phenotype associated with loss of rnt-1 function, and consistent with this we found seam cells, and ray sublineage cells in the male, to be the major focus of rnt-1 expression. However, we did notice a low level of embryonic lethality associated with rnt-1 RNAi and in the presumed null allele os58. The reason for this low level of embryonic lethality is not clear. Perhaps rnt-1 acts partially redundantly with some other factor in embryos. We also found rnt-1 to be transiently expressed in body wall muscle nuclei from late embryogenesis until the end of L2, but this expression does not appear to be associated with any obvious muscle function. Using a rescuing GFP reporter construct, we did not see rnt-1 expression in any other cell type. In particular, we did not see expression in hyp7 nuclei, suggesting that rnt-1 expression is switched off in cells derived from the seam, whose fate is to fuse with hyp7, and therefore to stop dividing.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7. Suppression of rnt-1 cell division failures by silencing of cki-1. (A) Graph showing the number of seam cells present in adult hermaphrodites (assayed by scm::GFP expression) in wild-type (n=30), rnt-1(ok351) (n=32), cki-1(RNAi) (n=36) and rnt-1(ok351); cki-1(RNAi) (n=31) animals. All strains were in a him-5(e1490) background. cki-1 RNAi causes an increase in seam cell number relative to wild type (P<0.0001). The number of seam cells in rnt-1(ok351); cki-1(RNAi) animals is restored to near wild-type levels (no significant difference compared with wild type, P>0.05). Error bars represent the standard error of the mean. (B) cki-1::GFP expression in the seam cells of L1 larvae. The left hand panel shows the L1 stem cell division pattern of V1-V6 in wild-type and rnt-1(ok351) animals. Seam cells are indicated by circles, hyp7 nuclei by squares. Crosses in the lineage diagrams indicate where divisions failed. (i,ii) Worms hatched in the absence of food, kept 24 hours at 20°C then re-fed and the division pattern examined by observing hypodermal and seam nuclei present in late L1 or mid L2 stages. In this situation, the L1 stem cell division failed in rnt-1 mutants 52% of the time (n=84). In wild type, the division pattern was always normal (n=66). (iii,iv) Worms were examined in late L1 after hatching on food, having never been subjected to starvation. Wild-type animals always underwent the normal L1 division (n=60) and rnt-1(ok351) animals displayed the normal division pattern 98% of the time (n=60). The right-hand panel shows cki-1::GFP expression under these conditions, prior to the time of the expected L1 stem-cell division. Individual seam cells are labelled. The increased cki-1::GFP expression observed in rnt-1 L1 larvae hatched in the absence of food, compared with wild-type animals subjected to the same treatment, was consistently observed (n=30). Scale bars: 20 µm.

 
rnt-1 overexpression drives ectopic cell divisions
Loss of rnt-1 function is associated with a failure of seam cell proliferation, whereas overexpression of rnt-1 drives seam cell hyperplasia, indicating that rnt-1 can function as a rate-limiting regulator of cell proliferation. It is noteworthy that seam cell hyperplasia occurs only if rnt-1 is overexpressed in L2 or L3. This is consistent with the normal expression pattern of rnt-1 in seam cells becoming fainter from L2 onwards, suggesting that seam cell lineages may not be able to cope with high level rnt-1 expression after this stage. High level expression during L2 and L3 is therefore sufficient to drive inappropriate cell divisions, leading to seam cell hyperplasia. Perhaps during L4 there are other constraints on cell proliferation, rendering seam cells recalcitrant to high-level rnt-1 expression during late larval development.

Overexpression of rnt-1 was not found to be associated with hyperplasia in other cell types. The tissue and stage specificity of RNT-1-induced hyperplasia suggests that the ability of RNT-1 to drive cell proliferation may be limited by the expression of some co-factor or of some other proliferation `licensing factor'. Runx genes have been shown to associate with a binding partner, CBFß, in other species (reviewed by Coffman, 2003Go). An orthologue of CBFß, bro-1, exists in C. elegans, but the function and expression pattern of this subunit has not yet been reported. Perhaps if rnt-1 and bro-1 were co-expressed, more widespread hyperplasia would result.

Conservation of Runx function
Runx genes have previously been characterised from a variety of metazoan organisms (reviewed by Coffman, 2003Go). In mammals there are three members of the family and they appear to have lineage-specific functions. Runx1 (also known as AML1, PEBP2{alpha}B and CBFA2) is required for definitive haematopoiesis (reviewed by Okuda et al., 2001Go). Recently, it has also been shown that Runx1 is required for the proliferation of early developing thymocytes (Sato et al., 2003Go). Clinically, Runx1 is strongly associated with human leukaemia. Indeed, Runx1 is one of the genes most frequently deregulated in leukaemia through different mechanisms involving translocation, mutation and amplification (reviewed by Roumier et al., 2003Go). Runx1 has been shown to actively drive cultured mammalian cells from G1 into S phase (Strom et al., 2000Go), and overexpression of Runx1 in NIH3T3 cells has been reported to lead to neoplastic transformation (Kurokawa et al., 1996Go). Runx1 has been regarded in the literature both as a tumour suppressor and as a proto-oncogene (Cameron and Neil, 2004Go; Coffman, 2003Go).

An intriguing link between the function of rnt-1 in C. elegans seam cells and the function of Runx1 in haematopoiesis is that both of these developmental lineages have stem cell-like properties: relatively undifferentiated cells continue dividing (self renewal), throwing off daughter cells that can undergo terminal differentiation into particular cell types. Perhaps a particular kind of signal, involving Runx genes, must be generated in stem cell-like lineages to promote proliferation.

Runx2 and Runx3 also appear to function in developmental lineages with stem cell-like properties. Runx2–/– mice fail to undergo osteogenesis, dying shortly after birth (Komori et al., 1997Go; Otto et al., 1997Go). In humans, Runx2 (also known as Cbfa1) is commonly associated with the congenital bone malformation cleidocranial dysplasia (Otto et al., 2002Go). Runx3 is required in mice for neurogenesis of the dorsal root ganglia (Inoue et al., 2002Go; Levanon et al., 2002Go). Runx3 has also been reported to be involved in controlling growth of the gastric epithelium in mice, and has been associated with human gastric cancers where it appears to act as a tumour suppressor gene (Li et al., 2002Go).

Overall, it has been suggested that Runx genes are required to maintain the balance between cell proliferation and differentiation in a variety of developmental contexts (reviewed in Coffman, 2003Go). One of the most important controls concerns the regulation of cell number. Too few cells in a given lineage and formation of a particular structure will not be possible, too many cells and an aberrant structure or a tumour may form. rnt-1 in C. elegans is part of the control that ensures developmental outputs are composed of the appropriate number of cells. In other systems, deregulated cell proliferation is at the heart of carcinogenesis.

It is noteworthy that the C. elegans genome contains only one Runx gene, whereas most other genomes so far examined contain multiple Runx orthologues. This makes C. elegans an organism of choice for the further study of this important family of transcription factors. Perhaps rnt-1 in C. elegans represents the primitive Runx function, promoting cell proliferation in developmental lineages where choices must be continually made between proliferative and differentiative division patterns.


    ACKNOWLEDGMENTS
 
We thank Hitoshi Sawa (Kobe, Japan) and Hiroshi Kagoshima (Shizuoka, Japan) for sharing alleles and information prior to publication. We also thank the Caenorhabditis Genetics Center (Minneapolis, USA) and the C. elegans KO Consortium (Oklahoma, USA) for sending strains. This work was funded by the UK Medical Research Council and the Association for International Cancer Research.


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 

Boxem, M. and van den Heuvel, S. (2001). lin-35 Rb and cki-1 Cip/Kip cooperate in developmental regulation of G1 progression in C. elegans. Development 128,4349 -4359.[Abstract/Free Full Text]

Cameron, E. R. and Neil, J. C. (2004). The Runx genes: lineage-specific oncogenes and tumor suppressors. Oncogene 23,4308 -4314.[CrossRef][Medline]

Coffman, J. A. (2003). Runx transcription factors and the developmental balance between cell proliferation and differentiation. Cell. Biol. Int. 27,315 -324.[CrossRef][Medline]

Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans [see comments]. Nature 391,806 -811.[CrossRef][Medline]

Flemming, A. J., Shen, Z. Z., Cunha, A., Emmons, S. W. and Leroi, A. M. (2000). Somatic polyploidization and cellular proliferation drive body size evolution in nematodes. Proc. Natl. Acad. Sci. USA 97,5285 -5290.[Abstract/Free Full Text]

Fukuyama, M., Gendreau, S. B., Derry, W. B. and Rothman, J. H. (2003). Essential embryonic roles of the CKI-1 cyclin-dependent kinase inhibitor in cell-cycle exit and morphogenesis in C elegans. Dev. Biol. 260,273 -286.[CrossRef][Medline]

Hodgkin, J. (1983). Male phenotypes and mating efficiency in Caenorhabditis elegans. Genetics 103, 43-64.[Abstract/Free Full Text]

Hong, Y., Roy, R. and Ambros, V. (1998). Developmental regulation of a cyclin-dependent kinase inhibitor controls postembryonic cell cycle progression in Caenorhabditis elegans. Development 125,3585 -3597.[Abstract]

Inoue, K., Ozaki, S., Shiga, T., Ito, K., Masuda, T., Okado, N., Iseda, T., Kawaguchi, S., Ogawa, M., Bae, S. C. et al. (2002). Runx3 controls the axonal projection of proprioceptive dorsal root ganglion neurons. Nat. Neurosci. 5, 946-954.[CrossRef][Medline]

Ji, Y. J., Nam, S., Jin, Y. H., Cha, E. J., Lee, K. S., Choi, K. Y., Song, H. O., Lee, J., Bae, S. C. and Ahnn, J. (2004). RNT-1, the C. elegans homologue of mammalian RUNX transcription factors, regulates body size and male tail development. Dev. Biol. 274,402 -412.[CrossRef][Medline]

Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M. et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421,231 -237.[CrossRef][Medline]

Kenyon, C. (1986). A gene involved in the development of the posterior body region of C. elegans. Cell 46,477 -487.[CrossRef][Medline]

Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y., Bronson, R. T., Gao, Y. H., Inada, M. et al. (1997). Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89,755 -764.[CrossRef][Medline]

Kurokawa, M., Tanaka, T., Tanaka, K., Ogawa, S., Mitani, K., Yazaki, Y. and Hirai, H. (1996). Overexpression of the AML1 proto-oncoprotein in NIH3T3 cells leads to neoplastic transformation depending on the DNA-binding and transactivational potencies. Oncogene 12,883 -892.[Medline]

Levanon, D., Bettoun, D., Harris-Cerruti, C., Woolf, E., Negreanu, V., Eilam, R., Bernstein, Y., Goldenberg, D., Xiao, C., Fliegauf, M. et al. (2002). The Runx3 transcription factor regulates development and survival of TrkC dorsal root ganglia neurons. EMBO J. 21,3454 -3463.[CrossRef][Medline]

Li, Q. L., Ito, K., Sakakura, C., Fukamachi, H., Inoue, K., Chi, X. Z., Lee, K. Y., Nomura, S., Lee, C. W., Han, S. B. et al. (2002). Causal relationship between the loss of RUNX3 expression and gastric cancer. Cell 109,113 -124.[CrossRef][Medline]

Mello, C. and Fire, A. (1995). DNA transformation. In Caenorhabditis elegans: Modern Biological Analysis of an Organism, Vol. 48 (ed. D. Shakes and H. Epstein), pp. 451-482. London: Academic Press.

Morita, K., Chow, K. L. and Ueno, N. (1999). Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-beta family. Development 126,1337 -1347.[Abstract]

Nam, S., Jin, Y. H., Li, Q. L., Lee, K. Y., Jeong, G. B., Ito, Y., Lee, J. and Bae, S. C. (2002). Expression pattern, regulation, and biological role of runt domain transcription factor, run, in Caenorhabditis elegans. Mol. Cell. Biol. 22,547 -554.[Abstract/Free Full Text]

Okuda, T., Nishimura, M., Nakao, M. and Fujita, Y. (2001). RUNX1/AML1: a central player in hematopoiesis. Int. J. Hematol. 74,252 -257.[Medline]

Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C., Rosewell, I. R., Stamp, G. W., Beddington, R. S., Mundlos, S., Olsen, B. R. et al. (1997). Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89,765 -771.[CrossRef][Medline]

Otto, F., Kanegane, H. and Mundlos, S. (2002). Mutations in the RUNX2 gene in patients with cleidocranial dysplasia. Hum. Mutat. 19,209 -216.[CrossRef][Medline]

Roumier, C., Fenaux, P., Lafage, M., Imbert, M., Eclache, V. and Preudhomme, C. (2003). New mechanisms of AML1 gene alteration in hematological malignancies. Leukemia 17, 9-16.[CrossRef][Medline]

Salser, S. J. and Kenyon, C. (1996). A C. elegans Hox gene switches on, off, on and off again to regulate proliferation, differentiation and morphogenesis. Development 122,1651 -1661.[Abstract]

Sato, T., Ito, R., Nunomura, S., Ohno, S., Hayashi, K., Satake, M. and Habu, S. (2003). Requirement of transcription factor AML1 in proliferation of developing thymocytes. Immunol. Lett. 89,39 -46.[CrossRef][Medline]

Savage-Dunn, C., Maduzia, L. L., Zimmerman, C. M., Roberts, A. F., Cohen, S., Tokarz, R. and Padgett, R. W. (2003). Genetic screen for small body size mutants in C. elegans reveals many TGFbeta pathway components. Genesis 35,239 -247.[CrossRef][Medline]

Sherr, C. J. (2000). The Pezcoller lecture: cancer cell cycles revisited. Cancer Res. 60,3689 -3695.[Abstract/Free Full Text]

Strom, D. K., Nip, J., Westendorf, J. J., Linggi, B., Lutterbach, B., Downing, J. R., Lenny, N. and Hiebert, S. W. (2000). Expression of the AML-1 oncogene shortens the G(1) phase of the cell cycle. J. Biol. Chem. 275,3438 -3445.[Abstract/Free Full Text]

Sulston, J. E. and Horvitz, H. R. (1977). Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev. Biol. 56,110 -156.[CrossRef][Medline]

Sulston, J. E. and White, J. G. (1980). Regulation and cell autonomy during postembryonic development of Caenorhabditis elegans. Dev. Biol. 78,577 -597.[CrossRef][Medline]

Sulston, J. and Hodgkin, J. (1988). Methods. In The Nematode Caenorhabditis elegans (ed. W. B. Wood), pp. 587-606. New York: Cold Spring Harbor Laboratory Press.

Sulston, J. E., Albertson, D. G. and Thomson, J. N. (1980). The Caenorhabditis elegans male: postembryonic development of nongonadal structures. Dev. Biol. 78,542 -576.[CrossRef][Medline]

Sulston, J. E., Schierenberg, E., White, J. G. and Thomson, J. N. (1983). The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100,64 -119.[CrossRef][Medline]

Sutherlin, M. E. and Emmons, S. W. (1994). Selective lineage specification by mab-19 during Caenorhabditis elegans male peripheral sense organ development. Genetics 138,675 -688.[Abstract]

Williams, B. D. (1995). Genetic mapping with polymorphic sequence-tagged sites. In Caenorhabditis elegans: Modern Biological Analysis of an Organism, Vol.48 (ed. D. Shakes and H. Epstein), pp.81 -96. London: Academic Press.

Zhu, L. and Skoultchi, A. I. (2001). Coordinating cell proliferation and differentiation. Curr. Opin. Genet. Dev. 11,91 -97.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
DevelopmentHome page
H. Kagoshima, R. Nimmo, N. Saad, J. Tanaka, Y. Miwa, S. Mitani, Y. Kohara, and A. Woollard
The C. elegans CBF{beta} homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal
Development, November 1, 2007; 134(21): 3905 - 3915.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.02102v1
132/22/5043    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nimmo, R.
Right arrow Articles by Woollard, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nimmo, R.
Right arrow Articles by Woollard, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?