|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 October 2005
doi: 10.1242/dev.02102
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Genetics Unit, Department of Biochemistry, University of Oxford, South Parks
Road, Oxford OX1 3QU, UK
2 Huffington Center on Ageing and Department of Molecular and Cellular Biology,
Baylor College of Medicine, One Baylor Plaza, Room M-320, Houston TX 77030,
USA
* Author for correspondence (e-mail: alison.woollard{at}bioch.ox.ac.uk)
Accepted 15 September 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Caenorhabditis elegans, Runx genes, Cell proliferation, Male tail development
| Introduction |
|---|
|
|
|---|
Coordination of cell division with growth and differentiation is achieved,
at least in part, through the integration of extracellular signals during the
G1 phase of the cell cycle (Zhu and
Skoultchi, 2001
). Cells respond to such signals by either
advancing into, or withdrawing from, the next division cycle. Ultimately,
signals impinge on the cell-cycle machinery intrinsic to each cell, composed
of cyclin-dependent kinases (CDKs) and CDK inhibitors (CDKIs) among other
factors.
During C. elegans development, cell divisions are almost
completely invariant and well characterised
(Sulston and Horvitz, 1977
;
Sulston et al., 1983
). The
effects of mutations on cell proliferation during development can thus be
analysed at high resolution. Normal development gives rise to 959 somatic
nuclei in the wild-type hermaphrodite and 1031 in the male. As an organism
develops, individual cells must either continue to divide (proliferate) or
differentiate and adopt a specialised function. Many cell lineage mutants have
been identified that do not produce the correct number of cells, and these may
be subdivided in various ways. For example, some mutants are defective in cell
division itself, others have defects in the timing of particular cell
divisions and a third group have defects in the polarity, or asymmetry, of
divisions, leading to fate changes that may influence the choice between
subsequent proliferation and differentiation.
The C. elegans male tail is an excellent system for genetic
studies because this sensory organ is dispensable for viability. The male tail
includes the proctodeum, which houses two sclerotized spicules and associated
musculature used for the transfer of sperm, and a cuticular fan containing
sensory rays used to locate the hermaphrodite vulva during mating
(Sulston et al., 1980
). The
male tail forms from postembryonic divisions of male-specific blast cells and
extra divisions of posterior lateral hypodermal (seam) cells and is
particularly sensitive to alterations in cell number, which result in
recognisable developmental defects. A well-defined set of mutants, the Mab
(male abnormal) mutants, have a range of defects in male tail development
(Hodgkin, 1983
). mab-2
mutants have variable defects in sensory ray formation
(Hodgkin, 1983
).
In this report, we show that the mab-2 phenotype is caused by
reduced proliferation of seam cells in both sexes, resulting in the loss of V
and T derived rays in males. We show that mab-2 encodes a Runt domain
transcription factor, RNT-1, which is similar to Runx proteins from other
species. In humans, mis-expression of Runx genes is associated with leukaemias
and other cancers (reviewed by Coffman,
2003
). Most importantly, we find that overexpression of
mab-2/rnt-1 in C. elegans causes seam cell hyperplasia,
suggesting that mab-2/rnt-1 is a conserved factor required to control
the extent of cell proliferation during the development of metazoan
organisms.
| Materials and methods |
|---|
|
|
|---|
Growth curves
Well fed young adult hermaphrodites were picked to a fresh plate and
allowed to lay eggs for 1 hour at 20°C. Hatched larvae were then measured
after 1, 2, 3 and 4 days growth at 20°C by mounting on 2% agarose pads
containing anaesthetic and measuring the length of each worm using Axiovision
software.
Mapping
mab-2 was originally mapped to the region between dpy-5
(0.00, cloned map position) and unc-13 (2.06, cloned map position) on
LGI (Jonathan Hodgkin, personal communication). Further mapping revealed
mab-2 to be to the right (or very close to the left) of
unc-40 (0.32, cloned map position) and to the left (or very close to
the right) of air-2 (0.49, cloned map position). The order of the
nine cosmids in this region (left to right) is as follows: T19B4 (contains
unc-40)C04F1F56H1T22E7B0414C32F10F33D11C34G6B020
7 (contains air-2). Confirmed single nucleotide polymorphism (SNP)
markers assayable by restriction enzyme analysis, which differ between the
Bristol N2 strain and the Hawaiian strain CB4856, are available for cosmids
C04F1 (C04F1:3815) and C34G6 (C34G6:15466). Recombinants were picked from the
heterozygote dpy-5 mab-2 unc-13/CB4856. Ten out of 10 Dpy Mab non-Unc
recombinants were found to be wild type for SNP C04F1:3815, and nine out of
nine Unc non-Mab non-Dpy recombinants were found to be Hawaiian for SNP
C04F1:3815. These data indicate that mab-2 is to the right of
C04F1:3815 (or very close to the left). Four out of four Unc Mab non-Dpy
recombinants were found to be wild type for SNP C34G6:15466, and seven out of
nine Unc non-Mab non-Dpy recombinants were found to be Hawaiian for SNP
C34G6:15466. These data indicate that mab-2 lies to the left of
C34G6:15466. The five cosmids between C04F1 and C34G6 were tested for rescue
of mab-2(e1241), and cosmid B0414 was found to rescue the mutant
phenotype completely. Oligos used for SNP C04F1:3815 were RN3
(5'GGATTTATCAGCGATGGATCAG) and RN4 (5'CATTGCCAGAGGGATTGAAC),
yielding a 784 bp PCR product, cut by Tsp45I in N2 to give bands of
490 bp and 294 bp. For SNP, C34G6:15466 oligos were RN5
(5'GCAGTTCGGTGAGTGGATTG) and RN6 (5'GGTAGCAGATGTTTACACAGTC),
yielding a 992 bp PCR product, cut by Taq
1 in N2 to give bands of 42
bp, 225 bp, 276 bp and 449 bp, and in CB4856 to give bands of 25 bp, 42 bp,
225 bp, 251 bp and 449 bp. These differences could be easily resolved on a 2%
agarose gel.
Lineage analysis
Worms were mounted on 2% agarose pads
(Sulston and Hodgkin, 1988
) in
2 µl of M9 to which a smear of OP50 bacteria had been added and mixed. A
12x12 mm coverslip was gently lowered onto the worm and the divisions of
the seam cells were observed using Nomarski DIC optics and a 63 x oil
immersion objective (Zeiss) over a period of 18-20 hours.
Transgenic worms
Plasmids were injected into the syncytial gonad of young adult
hermaphrodite worms at a concentration of 30 ng/µl as described
(Mello and Fire, 1995
), along
with the rol-6 transformation marker (at 50-100 ng/µl). Rol
progeny were picked and stable lines selected for analysis. Several lines were
generated for each construct.
Transformation rescue of rnt-1
Cosmid B0414 was found to rescue the rnt-1(e1241) mutant
phenotype. Subclones were generated to test for single gene rescuing activity
and a fragment containing the single gene B0414.2 was found to rescue. This
subclone was generated by PCR amplification from cosmid B0414 and TA cloned
into TOPOXL (Invitrogen) in two halves using oligos RN64 and RN83 (5'
half) and RN68 and RN82 (3' half). The 3' half (7902 bp) was then
subcloned into the 3' end of the 5' half (8428 bp) using
XbaI and BglII to generate the full-length B0414.2 genomic
clone pAW258. The rescued strain referred to in this report carrying the whole
cosmid B0414 is AW44 [rnt-1(e1241); him-5(e1490); ouEx15[B0414 +
rol-6]] and the rescued strain referred to in this
report carrying the single gene B0414.2 (rnt-1) is AW68
[rnt-1(e1241); him-5(e1490); ouEx17[B0414.2 +
rol-6]].
Sequencing of rnt-1 alleles
Primers were used to amplify rnt-1 coding sequences from
appropriate mutant worms for sequencing using the high-fidelity Expand DNA
polymerase (Roche). PCR from worms was performed as described previously
(Williams, 1995
). Sequences
(both strands) of at least two independent PCR products were analysed using
Pairwise Alignment in BioEdit.
GFP reporter constructs
A rnt-1 translational GFP fusion construct was made using pPD
vectors kindly supplied by the Fire Lab (Stanford University). All constructs
were verified by sequencing. To make rnt-1::GFP, GFP from pPD119.16
was excised using SmaI and inserted into the StuI site at
the 3' end of the 3' rnt-1 clone. Then, this GFP-tagged
3' clone was inserted into the 3' end of the 5' clone using
XbaI and BglII as above, to generate a full-length genomic
GFP-tagged rescuing construct, pAW260. The rescued strain referred to in this
report carrying this rnt-1::GFP translational fusion is AW109
(rnt-1(e1241); him-5(e1490); ouEx26[rnt-1::GFP + rol-6].
rnt-1(ok351) him-5 (e1490) was crossed into the scm::GFP seam
cell reporter strain (JR667) to generate the strain AW58, into a
myo-3::GFP muscle cell reporter (strain PD4251) to generate the
strain AW106 and into a cki-1::GFP reporter (strain VT825) to
generate the strain AW148.
Heat-shock constructs
A full-length rnt-1 cDNA construct was generated by PCR from a
C. elegans cDNA library (gift from R. Barstead, Oklahoma University)
and used to generate two hsp-16 driven constructs (F primer
5'GCTAGCCAGTGCTGGAAGTATTCTGGG, RN87; R primer
5'GAGCTCCTGAAGAGGTAGGAAACAATTGAG, RN88, product 994bp). pAW261 consists
of the rnt-1 cDNA cloned into pPD49.78 (hsp16-2 driven) as a
NheI-SacI fragment. pAW262 consists of rnt-1 cDNA
cloned into pPD49.83 (hsp16-41 driven) as a
NheI-SacI fragment. The transgenic line generated for pAW261
described in this study is AW87 (him-5(e1490); ouEx19[hsp16-2::rnt-1 +
rol-6+]). AW87 was crossed into the scm::GFP seam
cell reporter strain to generate the strain AW102 and into rnt-1(e1241);
him-5(e1490) to generate the strain AW103. A transgenic line was also
constructed carrying pAW262 as well as an elt-2::GFP intestinal
reporter (gift from Joel Rothman, University of California, Santa Barbara) by
co-injecting both reporters in addition to the rol-6 transformation
marker, to generate the strain AW100 (him-5 (e1490);
ouEx23[hsp16-41::rnt-1 + elt-2::GFP + rol-6).
Heat-shock experiments
Worms were staged by bleaching gravid adult hermaphrodites to produce a
pure egg population that was then allowed to hatch in the absence of food to
produce a synchronous population of arrested L1 stage animals
(Sulston and Hodgkin, 1988
).
These animals were then re-fed on OP50 seeded NGM plates and heatshocked at
33°C for 1 hour at different larval stages.
RNAi
PCR primers, including T7 or T3 RNA polymerase promoter sites were designed
to be specific for rnt-1, and to amplify 504 bp of mostly exonic
sequence (F primer 5'ATTAACCCTCACTAAAGGTTACGGTTGATGGACC, RN84; R primer
5'AATACGACTCACTATAGCGGAGAAGAACTATTCG, RN85). Primers specific for
cki-1 amplified 602 bp (F primer
5'ATTAACCCTCACTAAAGGTCTTCTGCTCGTCGTTGCC, RN90; R primer
5'AATACGACTCACTATAGGAGAGCATGAAGATCGAGTTCTG, RN91). dsRNA was synthesised
directly from gel-purified PCR product as previously described
(Fire et al., 1998
) and
injected into young adult hermaphrodites at a concentration of
1 mg/ml.
Injected worms were transferred to fresh plates 6 hours following injection
and thereafter every 24 hours for 3 days.
| Results |
|---|
|
|
|---|
|
mab-2 encodes RNT-1, a member of the Runx group of transcription factors
We mapped mab-2 to the centre of chromosome 1, between
unc-40 and air-2, using three-factor crosses (see Materials
and methods). SNP mapping was then used to further map mab-2 to a
region spanned by seven cosmids (see Materials and methods) and these cosmids
were tested for rescuing activity. The cosmid B0414 was found to completely
rescue the phenotype of mab-2 mutant worms, and a subclone including
the full ORF of only one gene, B0414.2, was subsequently found to provide all
of this rescuing activity (Fig.
2A). Examination of the sequence of B0414.2 revealed it to encode
a transcription factor of the Runx family, members of which include human
RUNX1, RUNX2, RUNX3 and Drosphila runt and lozenge
(Fig. 2C). B0414.2 has been
given the name RNT-1 in Wormbase
(http://www.wormbase.org/)
and is the only Runx orthologue present in the worm genome.
A deletion allele of rnt-1 is available from the C. elegans Knockout Consortium (Oklahoma, USA, allele ok351). We found that this allele fails to complement the male tail phenotype of mab-2(e1241) (Fig. 2A), demonstrating that mab-2 and rnt-1 are allelic. For simplicity we will henceforward refer to mab-2 as rnt-1. The male tail phenotype of the rnt-1 deletion allele, ok351, is indistinguishable from e1241, with the same number of rays, on average, being missing from each side of the tail (Fig. 2D).
|
Silencing rnt-1 using RNA interference (RNAi) also gave rise to
males with missing rays, similar to the loss of function alleles described
(Fig. 2D). There was a small
but significant amount of embryonic lethality associated with rnt-1
RNAi (18% embryonic lethality at 25°C in him-8(e1489);
rnt-1(RNAi) animals compared with 3.6% embryonic lethality in
him-8(e1489) animals kept at 25°C but not subjected to RNAi:
14.4% lethality is thus attributable to the effects of rnt-1 RNAi). A
similar amount of embryonic lethality is seen in rnt-1(os58) animals
[50% embryonic lethality in rnt-1(os58); him-5(e1490) animals kept at
25°C compared with 38% embryonic lethality in him-5(e1490)
animals alone kept at 25°C: 12% lethality is thus associated with the
os58 allele]. None of the other rnt-1 alleles displays any
significant embryonic lethality, so it is possible that those alleles,
including the deletion allele ok351, are non-null.
rnt-1(os11) was found to be largely inviable at 25°C, with much
reduced fertility, but the lesion in os11 animals appears to be a
large deletion also affecting a neighbouring gene (R.N. and A.W.,
unpublished), which known from genome-wide RNAi screens to be essential
(Kamath et al., 2003
).
rnt-1 hermaphrodites have no defects at the gross morphological level, except a slight (5%) reduction in body length at adulthood (Fig. 2E). The slight reduction in body length is similar in all alleles tested (data not shown). We noticed that the reduction in body length was more pronounced in rnt-1 worms recovering from starvation, and these worms were found to be very sick (data not shown), suggesting that rnt-1 may have some function in stimulating growth following starvation. No other defects were observed in any of the rnt-1 mutant strains tested, or in rnt-1(RNAi) animals.
Seam cell number is reduced in rnt-1 animals
In wild-type males, the rays are generated by seam cells. Seam cell
divisions in both sexes provide hypodermal nuclei and a postdeirid neuroblast
(Sulston and Horvitz, 1977
).
In males, extra divisions in the posterior seam cells V5, V6 and T and
subsequent specification of ray neuroblasts result in generation of the 18
rays.
We analysed the number of seam cells in rnt-1 mutants using the
seam cell marker scm::GFP. Wild-type adult hermaphrodites usually
contain 16 seam cells on each side of the animal at the end of development,
derived from the 10 embryonically derived blast cells H0, H1, H2, V1-V6 and T
(Fig. 3). rnt-1 mutant
hermaphrodites contain fewer, typically 13
(Fig. 3). Male rnt-1
mutant worms also contain fewer seam cells, typically 11, compared with 18 in
wild type (Fig. 3). This
indicates that rnt-1 activity is required in both males and
hermaphrodites for either seam cell proliferation or differentiation, and that
this is the basis of the male tail phenotype, as sensory rays are generated
from posterior seam cells. Seam cells in rnt-1 animals (albeit
reduced in number) fuse normally in L4 (visualised with ajm-1::GFP,
data not shown), indicating that they maintain the correct fate. In
hermaphrodites, seam cells are responsible for the formation of alae,
cuticular ridges on the surface of the worm
(Sulston and Horvitz, 1977
).
Despite the lack of seam cells in rnt-1 mutants, alae do not appear
to be defective (data not shown), again indicating that correct seam cell fate
is maintained in the remaining seam cells.
rnt-1 is expressed in seam cells
The expression pattern of a rescuing translational rnt-1::GFP
fusion construct is shown in Fig.
4. rnt-1::GFP is visibly expressed in the nuclei of seam
cells in embryos from around 260 minutes post fertilisation, just after the
time at which seam cell are formed. Seam cell expression in both males and
hermaphrodites is visible during all developmental stages, but is particularly
strong until late L2. In males, rnt-1::GFP is expressed additionally
in seam cell derived ray precursor cells and ray sublineages.
rnt-1::GFP is also expressed transiently in body wall muscle nuclei
from late embryogenesis until the end of L2
(Fig. 4). We could find no
obvious phenotype associated with expression of rnt-1 in body wall
muscle. Both the number and arrangement of body wall muscle nuclei (assayed
using a myo-3::GFP reporter) in rnt-1 mutants appears normal
(data not shown). We did not observe rnt-1::GFP expression in any
other cell types. Expression of rnt-1 has been previously reported in
intestinal cells (Nam et al.,
2002
), but we did not find any intestinal expression using our
rescuing GFP reporter construct, nor did we observe any intestinal defects in
rnt-1 mutant alleles or rnt-1(RNAi) animals. Our rescuing
GFP reporter contains the endogenous rnt-1 3'UTR that was
absent from the reporter described by Nam et al. It is possible that this
difference in reporters accounts for the slight difference in the
rnt-1 expression pattern observed.
|
The most common lineage defect in rnt-1 animals involves failures in L2 and L3 seam cell divisions. L1 divisions were found to be normal in all animals analysed. Thus, the main role of rnt-1 is to stimulate divisions of seam cells from L2 onwards. The lineage traces shown illustrate the variable nature of the division failures in different seam lineages. Moreover, different animals displayed different seam lineage failures (data not shown). This explains why rnt-1 males end up with a variable number of missing rays. L4 divisions and male ray sublineages were not extensively lineaged. The lineage defects observed do not appear to be heterochronic alterations, as lineages are only partially affected (usually the posterior branch). Two examples of potential cell fate transformations (in the anterior branch of V1 in the hermaphrodite and in the posterior branch of T in the male) were observed, but this type of defect was found to be rare.
|
Overexpression of rnt-1 does not appear to cause hyperplasia in other cell types. We looked at the number of intestinal nuclei (using an elt-2::GFP intestinal reporter) in heat shocked worms carrying an hsp16-41::rnt-1 construct (which would be expected to drive high level expression in the intestine) and found it to be normal (data not shown). We likewise found no increase in the number of body wall muscle cells, assayed using a myo-3::GFP reporter strain in heat shocked worms carrying an hsp16-2::rnt-1 construct (data not shown).
Suppression of rnt-1 seam cell division failures by cki-1 RNAi
cki-1 is a member of the KIP/CIP family of CDK inhibitors and is
most similar to p27/kip1, which functions to link developmental
programmes to cell cycle progression (Boxem
and van den Heuvel, 2001
;
Fukuyama et al., 2003
;
Hong et al., 1998
). KIP/CIP CDK
inhibitors are thought to act by inhibiting the activity of the cyclin E/CDK2
complex during G1 (reviewed by Sherr,
2000
). cki-1 in C. elegans has been reported to
be required for developmental cell cycle arrest in several lineages and is
known to be expressed in seam cells
(Fukuyama et al., 2003
;
Hong et al., 1998
). The
temporal pattern of cki-1 expression in seam cells partially overlaps
with that of rnt-1. Both genes are expressed strongly during
embryogenesis and until mid-L1 (this report)
(Fukuyama et al., 2003
). High
level expression of rnt-1 persists during larval development, whereas
cki-1 expression declines sharply at mid-L1, to be restored during
resting phases between larval moults and at L4, coincident with seam cell
terminal differentiation (Fukuyama et al.,
2003
).
|
One model for the opposing roles of rnt-1 and cki-1 in controlling seam cell proliferation would be that RNT-1 negatively regulates cki-1 expression in seam cells. We tested this possibility by examining cki-1::GFP expression in a rnt-1 mutant. The best situation in which cki-1 expression could be robustly analysed in seam cells during larval development was found to be during L1 (we found cki-1::GFP reporter expression to be too faint to analyse reliably after L1). Although, as discussed above, loss of rnt-1 does not normally affect the L1 stem cell division, we found that this division fails in rnt-1 animals that have been arrested in L1 diapause by hatching in the absence of food, before being allowed to recommence larval development by introducing food (Fig. 7B). By contrast, wild-type animals undergo this division normally when subjected to the same treatment (Fig. 7B), i.e. starvation sensitises the L1 division to loss of rnt-1. As shown in Fig. 7B, we found that cki-1::GFP expression in rnt-1 mutants whose seam cells fail to divide in L1 is higher than in wild-type animals whose seam cells divide normally. In other words, division failure is correlated with increased cki-1::GFP expression. This is good evidence that rnt-1 normally acts during G1 of the cell cycle to promote cell division by somehow downregulating cki-1 expression. It is not clear at present whether this interaction is direct or indirect.
|
| Discussion |
|---|
|
|
|---|
Our data support the view that the loss of seam cells is mainly the result
of a defect in cell proliferation per se, rather than a change in cell fate.
The rare cell fate, as opposed to cell proliferation, defects we did observe
in rnt-1 animals may be explained by signalling defects. It is known
that signalling among seam cells (acting in conjunction with lineage cues) is
important for cell fate determination. This has been demonstrated most clearly
in ablation studies, where extensive ablation of seam cells was found to cause
various cell fate changes in the remaining seam cells
(Sulston and White, 1980
).
Thus, cells with inappropriate neighbours may be expected to take on the wrong
fate under certain circumstances. In this context, it becomes somewhat
artificial to postulate a clear distinction between cell proliferation and
cell fate determination.
A recent report suggests that rnt-1 functions to regulate body
size and ray morphogenesis in C. elegans by interacting with
components of the Sma/Mab TGFß signalling pathway
(Ji et al., 2004
). Although we
do observe a small (5%) decrease in length in rnt-1 adult
hermaphrodites, this is much less severe than in Sma animals. In the case of
rnt-1, we suggest that this slight reduction in size is caused by a
reduction in the number of nuclei in the hypodermal syncytium, which is caused
by seam cell division failures. The relationship between hypodermal ploidy and
body size in C. elegans has been previously discussed
(Flemming et al., 2000
).
Moreover, we can see no phenotypic similarities between rnt-1 and Sma
male tails. The Sma phenotype is typified by fused rays
(Hodgkin, 1983
;
Morita et al., 1999
;
Savage-Dunn et al., 2003
),
whereas the rnt-1 phenotype is typified by missing rays caused by
failures in seam cell proliferation, as indicated by our lineage analysis. It
is possible that rnt-1 has some minor downstream role in ray
morphogenesis, as evidenced by the very low penetrance ray fusion phenotype we
observe in rnt-1 animals, but it is certain that the major focus of
rnt-1 action is in the regulation of seam cell proliferation. Given
that missing rays are not observed in Sma mutants, we consider it unlikely
that this major function of rnt-1 involves an interaction with the
Sma/Mab TGFß pathway.
Other genes known to influence ray development tend to affect specific ray
sublineages. For example, mab-5, a posterior Hox gene, is required
for proliferation and ray production in V5 and V6 sublineages but does not
affect T lineage-derived rays (Kenyon,
1986
; Salser and Kenyon,
1996
). By contrast, ray loss in mab-19 mutants is
restricted to T lineage-derived rays
(Sutherlin and Emmons, 1994
).
rnt-1, however, has a more general role in seam cell proliferation
which is required for the subsequent development of both V and T-derived
rays.
Defective male tail formation is the only highly penetrant gross morphological phenotype associated with loss of rnt-1 function, and consistent with this we found seam cells, and ray sublineage cells in the male, to be the major focus of rnt-1 expression. However, we did notice a low level of embryonic lethality associated with rnt-1 RNAi and in the presumed null allele os58. The reason for this low level of embryonic lethality is not clear. Perhaps rnt-1 acts partially redundantly with some other factor in embryos. We also found rnt-1 to be transiently expressed in body wall muscle nuclei from late embryogenesis until the end of L2, but this expression does not appear to be associated with any obvious muscle function. Using a rescuing GFP reporter construct, we did not see rnt-1 expression in any other cell type. In particular, we did not see expression in hyp7 nuclei, suggesting that rnt-1 expression is switched off in cells derived from the seam, whose fate is to fuse with hyp7, and therefore to stop dividing.
|
Overexpression of rnt-1 was not found to be associated with
hyperplasia in other cell types. The tissue and stage specificity of
RNT-1-induced hyperplasia suggests that the ability of RNT-1 to drive cell
proliferation may be limited by the expression of some co-factor or of some
other proliferation `licensing factor'. Runx genes have been shown to
associate with a binding partner, CBFß, in other species
(reviewed by Coffman, 2003
). An
orthologue of CBFß, bro-1, exists in C.
elegans, but the function and expression pattern of this subunit has not
yet been reported. Perhaps if rnt-1 and bro-1 were
co-expressed, more widespread hyperplasia would result.
Conservation of Runx function
Runx genes have previously been characterised from a variety of metazoan
organisms (reviewed by Coffman,
2003
). In mammals there are three members of the family and they
appear to have lineage-specific functions. Runx1 (also known as
AML1, PEBP2
B and CBFA2) is required for
definitive haematopoiesis (reviewed by
Okuda et al., 2001
). Recently,
it has also been shown that Runx1 is required for the proliferation
of early developing thymocytes (Sato et
al., 2003
). Clinically, Runx1 is strongly associated with
human leukaemia. Indeed, Runx1 is one of the genes most frequently
deregulated in leukaemia through different mechanisms involving translocation,
mutation and amplification (reviewed by
Roumier et al., 2003
).
Runx1 has been shown to actively drive cultured mammalian cells from
G1 into S phase (Strom et al.,
2000
), and overexpression of Runx1 in NIH3T3 cells has
been reported to lead to neoplastic transformation
(Kurokawa et al., 1996
).
Runx1 has been regarded in the literature both as a tumour suppressor
and as a proto-oncogene (Cameron and Neil,
2004
; Coffman,
2003
).
An intriguing link between the function of rnt-1 in C. elegans seam cells and the function of Runx1 in haematopoiesis is that both of these developmental lineages have stem cell-like properties: relatively undifferentiated cells continue dividing (self renewal), throwing off daughter cells that can undergo terminal differentiation into particular cell types. Perhaps a particular kind of signal, involving Runx genes, must be generated in stem cell-like lineages to promote proliferation.
Runx2 and Runx3 also appear to function in developmental
lineages with stem cell-like properties.
Runx2/ mice fail to undergo osteogenesis,
dying shortly after birth (Komori et al.,
1997
; Otto et al.,
1997
). In humans, Runx2 (also known as Cbfa1) is
commonly associated with the congenital bone malformation cleidocranial
dysplasia (Otto et al., 2002
).
Runx3 is required in mice for neurogenesis of the dorsal root ganglia
(Inoue et al., 2002
;
Levanon et al., 2002
).
Runx3 has also been reported to be involved in controlling growth of
the gastric epithelium in mice, and has been associated with human gastric
cancers where it appears to act as a tumour suppressor gene
(Li et al., 2002
).
Overall, it has been suggested that Runx genes are required to maintain the
balance between cell proliferation and differentiation in a variety of
developmental contexts (reviewed in
Coffman, 2003
). One of the most
important controls concerns the regulation of cell number. Too few cells in a
given lineage and formation of a particular structure will not be possible,
too many cells and an aberrant structure or a tumour may form. rnt-1
in C. elegans is part of the control that ensures developmental
outputs are composed of the appropriate number of cells. In other systems,
deregulated cell proliferation is at the heart of carcinogenesis.
It is noteworthy that the C. elegans genome contains only one Runx gene, whereas most other genomes so far examined contain multiple Runx orthologues. This makes C. elegans an organism of choice for the further study of this important family of transcription factors. Perhaps rnt-1 in C. elegans represents the primitive Runx function, promoting cell proliferation in developmental lineages where choices must be continually made between proliferative and differentiative division patterns.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Boxem, M. and van den Heuvel, S. (2001). lin-35
Rb and cki-1 Cip/Kip cooperate in developmental regulation of G1 progression
in C. elegans. Development
128,4349
-4359.
Cameron, E. R. and Neil, J. C. (2004). The Runx
genes: lineage-specific oncogenes and tumor suppressors.
Oncogene 23,4308
-4314.[CrossRef][Medline]
Coffman, J. A. (2003). Runx transcription
factors and the developmental balance between cell proliferation and
differentiation. Cell. Biol. Int.
27,315
-324.[CrossRef][Medline]
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S.
E. and Mello, C. C. (1998). Potent and specific
genetic interference by double-stranded RNA in Caenorhabditis elegans [see
comments]. Nature 391,806
-811.[CrossRef][Medline]
Flemming, A. J., Shen, Z. Z., Cunha, A., Emmons, S. W. and
Leroi, A. M. (2000). Somatic polyploidization and cellular
proliferation drive body size evolution in nematodes. Proc. Natl.
Acad. Sci. USA 97,5285
-5290.
Fukuyama, M., Gendreau, S. B., Derry, W. B. and Rothman, J.
H. (2003). Essential embryonic roles of the CKI-1
cyclin-dependent kinase inhibitor in cell-cycle exit and morphogenesis in C
elegans. Dev. Biol. 260,273
-286.[CrossRef][Medline]
Hodgkin, J. (1983). Male phenotypes and mating
efficiency in Caenorhabditis elegans. Genetics
103, 43-64.
Hong, Y., Roy, R. and Ambros, V. (1998).
Developmental regulation of a cyclin-dependent kinase inhibitor controls
postembryonic cell cycle progression in Caenorhabditis elegans.
Development 125,3585
-3597.[Abstract]
Inoue, K., Ozaki, S., Shiga, T., Ito, K., Masuda, T., Okado, N.,
Iseda, T., Kawaguchi, S., Ogawa, M., Bae, S. C. et al.
(2002). Runx3 controls the axonal projection of proprioceptive
dorsal root ganglion neurons. Nat. Neurosci.
5, 946-954.[CrossRef][Medline]
Ji, Y. J., Nam, S., Jin, Y. H., Cha, E. J., Lee, K. S., Choi, K.
Y., Song, H. O., Lee, J., Bae, S. C. and Ahnn, J.
(2004). RNT-1, the C. elegans homologue of mammalian RUNX
transcription factors, regulates body size and male tail development.
Dev. Biol. 274,402
-412.[CrossRef][Medline]
Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R.,
Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M. et al.
(2003). Systematic functional analysis of the Caenorhabditis
elegans genome using RNAi. Nature
421,231
-237.[CrossRef][Medline]
Kenyon, C. (1986). A gene involved in the
development of the posterior body region of C. elegans.
Cell 46,477
-487.[CrossRef][Medline]
Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K.,
Deguchi, K., Shimizu, Y., Bronson, R. T., Gao, Y. H., Inada, M. et
al. (1997). Targeted disruption of Cbfa1 results in a
complete lack of bone formation owing to maturational arrest of osteoblasts.
Cell 89,755
-764.[CrossRef][Medline]
Kurokawa, M., Tanaka, T., Tanaka, K., Ogawa, S., Mitani, K.,
Yazaki, Y. and Hirai, H. (1996). Overexpression of the AML1
proto-oncoprotein in NIH3T3 cells leads to neoplastic transformation depending
on the DNA-binding and transactivational potencies.
Oncogene 12,883
-892.[Medline]
Levanon, D., Bettoun, D., Harris-Cerruti, C., Woolf, E.,
Negreanu, V., Eilam, R., Bernstein, Y., Goldenberg, D., Xiao, C.,
Fliegauf, M. et al. (2002). The Runx3 transcription factor
regulates development and survival of TrkC dorsal root ganglia neurons.
EMBO J. 21,3454
-3463.[CrossRef][Medline]
Li, Q. L., Ito, K., Sakakura, C., Fukamachi, H., Inoue, K., Chi,
X. Z., Lee, K. Y., Nomura, S., Lee, C. W., Han, S. B. et al.
(2002). Causal relationship between the loss of RUNX3 expression
and gastric cancer. Cell
109,113
-124.[CrossRef][Medline]
Mello, C. and Fire, A. (1995). DNA
transformation. In Caenorhabditis elegans: Modern Biological
Analysis of an Organism, Vol. 48 (ed. D.
Shakes and H. Epstein), pp. 451-482. London: Academic
Press.
Morita, K., Chow, K. L. and Ueno, N. (1999).
Regulation of body length and male tail ray pattern formation of
Caenorhabditis elegans by a member of TGF-beta family.
Development 126,1337
-1347.[Abstract]
Nam, S., Jin, Y. H., Li, Q. L., Lee, K. Y., Jeong, G. B., Ito,
Y., Lee, J. and Bae, S. C. (2002). Expression pattern,
regulation, and biological role of runt domain transcription factor, run, in
Caenorhabditis elegans. Mol. Cell. Biol.
22,547
-554.
Okuda, T., Nishimura, M., Nakao, M. and Fujita, Y.
(2001). RUNX1/AML1: a central player in hematopoiesis.
Int. J. Hematol. 74,252
-257.[Medline]
Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K.
C., Rosewell, I. R., Stamp, G. W., Beddington, R. S., Mundlos, S.,
Olsen, B. R. et al. (1997). Cbfa1, a candidate gene for
cleidocranial dysplasia syndrome, is essential for osteoblast differentiation
and bone development. Cell
89,765
-771.[CrossRef][Medline]
Otto, F., Kanegane, H. and Mundlos, S. (2002).
Mutations in the RUNX2 gene in patients with cleidocranial dysplasia.
Hum. Mutat. 19,209
-216.[CrossRef][Medline]
Roumier, C., Fenaux, P., Lafage, M., Imbert, M., Eclache, V.
and Preudhomme, C. (2003). New mechanisms of AML1 gene
alteration in hematological malignancies. Leukemia
17, 9-16.[CrossRef][Medline]
Salser, S. J. and Kenyon, C. (1996). A C.
elegans Hox gene switches on, off, on and off again to regulate proliferation,
differentiation and morphogenesis. Development
122,1651
-1661.[Abstract]
Sato, T., Ito, R., Nunomura, S., Ohno, S., Hayashi, K., Satake,
M. and Habu, S. (2003). Requirement of transcription
factor AML1 in proliferation of developing thymocytes. Immunol.
Lett. 89,39
-46.[CrossRef][Medline]
Savage-Dunn, C., Maduzia, L. L., Zimmerman, C. M., Roberts, A.
F., Cohen, S., Tokarz, R. and Padgett, R. W. (2003).
Genetic screen for small body size mutants in C. elegans reveals many TGFbeta
pathway components. Genesis
35,239
-247.[CrossRef][Medline]
Sherr, C. J. (2000). The Pezcoller lecture:
cancer cell cycles revisited. Cancer Res.
60,3689
-3695.
Strom, D. K., Nip, J., Westendorf, J. J., Linggi, B.,
Lutterbach, B., Downing, J. R., Lenny, N. and Hiebert, S. W.
(2000). Expression of the AML-1 oncogene shortens the G(1) phase
of the cell cycle. J. Biol. Chem.
275,3438
-3445.
Sulston, J. E. and Horvitz, H. R. (1977).
Post-embryonic cell lineages of the nematode, Caenorhabditis elegans.
Dev. Biol. 56,110
-156.[CrossRef][Medline]
Sulston, J. E. and White, J. G. (1980).
Regulation and cell autonomy during postembryonic development of
Caenorhabditis elegans. Dev. Biol.
78,577
-597.[CrossRef][Medline]
Sulston, J. and Hodgkin, J. (1988). Methods. In
The Nematode Caenorhabditis elegans (ed. W. B. Wood),
pp. 587-606. New York: Cold Spring Harbor Laboratory
Press.
Sulston, J. E., Albertson, D. G. and Thomson, J. N.
(1980). The Caenorhabditis elegans male: postembryonic
development of nongonadal structures. Dev. Biol.
78,542
-576.[CrossRef][Medline]
Sulston, J. E., Schierenberg, E., White, J. G. and Thomson, J.
N. (1983). The embryonic cell lineage of the nematode
Caenorhabditis elegans. Dev. Biol.
100,64
-119.[CrossRef][Medline]
Sutherlin, M. E. and Emmons, S. W. (1994).
Selective lineage specification by mab-19 during Caenorhabditis elegans male
peripheral sense organ development. Genetics
138,675
-688.[Abstract]
Williams, B. D. (1995). Genetic mapping with
polymorphic sequence-tagged sites. In Caenorhabditis elegans:
Modern Biological Analysis of an Organism, Vol.48
(ed. D. Shakes and H. Epstein), pp.81
-96. London: Academic Press.
Zhu, L. and Skoultchi, A. I. (2001).
Coordinating cell proliferation and differentiation. Curr. Opin.
Genet. Dev. 11,91
-97.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. Hajduskova, M. Jindra, M. A. Herman, and M. Asahina The nuclear receptor NHR-25 cooperates with the Wnt/{beta}-catenin asymmetry pathway to control differentiation of the T seam cell in C. elegans J. Cell Sci., September 1, 2009; 122(17): 3051 - 3060. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Maekawa, T. Inoue, H. Kobuna, T. Nishimura, K. Gengyo-Ando, S. Mitani, and H. Arai Functional analysis of GS28, an intra-Golgi SNARE, in Caenorhabditis elegans Genes Cells, August 1, 2009; 14(8): 1003 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kagoshima, R. Nimmo, N. Saad, J. Tanaka, Y. Miwa, S. Mitani, Y. Kohara, and A. Woollard The C. elegans CBF{beta} homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal Development, November 1, 2007; 134(21): 3905 - 3915. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||