|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 October 2005
doi: 10.1242/dev.02088
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

,

1 Department of Anatomy, University of California, San Francisco, CA 94143-0452,
USA
2 Department of Cellular and Molecular Medicine, Biomedical Sciences Graduate
Program, University of California, San Diego, La Jolla, CA 92093-0687,
USA
Author for correspondence (e-mail:
zena{at}itsa.ucsf.edu)
Accepted 14 September 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Homologous recombination, Knockout, Hypertrophic cartilage, Chondrocyte, Hereditary multiple exostoses, Heparan sulfate, Mouse
| Introduction |
|---|
|
|
|---|
Hereditary multiple exostoses (HME) is a skeletal disorder characterized by
the presence of multiple bony protuberances called exostoses (or
osteochondromas), usually arising in the epiphyseal growth plate of bones
formed by endochondral ossification. Although exostoses can be found on almost
every long bone, they appear more frequently at the distal end of the femur,
tibia, fibula, humerus and ribs. Often, the formation of an exostosis
interferes with normal bone development, resulting in deformities such as
shortening and bowing of the bones
(Hennekam, 1991
;
Solomon, 1963
). HME is a
multigenic disease and follows an autosomal dominant mode of inheritance.
Approximately 80% of affected individuals have a positive family history,
although exostoses can also appear sporadically. Genetic linkage studies and
mutation analyses have identified two main loci as being associated with the
disease: EXT1, located on chromosome 8q24.1; and EXT2,
located on chromosome 11p11 (Ahn et al.,
1995
; Stickens et al.,
1996
).
HS is a glycosaminoglycan (GAG), a linear polysaccharide composed of
alternating D-glucuronic acid (GlcA) and N-acetyl-D-glucosamine
(GlcNAc) subunits. The biosynthesis of HS is a complex process that involves a
whole host of enzymes (for review see Esko
and Selleck, 2002
). The EXT1 and EXT2 genes
encode the exostosins, glycosyltransferases involved in the synthesis of HS
(Lind et al., 1998
;
McCormick et al., 1998
;
Wei et al., 2000
). EXT1 and
EXT2 are type II transmembrane proteins involved in HS chain elongation,
catalyzing the alternating transfer of GlcA and GlcNAc residues. In vivo, EXT1
and EXT2 form a hetero-oligomeric complex in the Golgi apparatus and this
complex has a higher glycosyltransferase activity than either protein alone
(McCormick et al., 2000
;
Senay et al., 2000
). The
majority of cases of HME are caused by frameshift or missense mutations in
EXT1 or EXT2, creating truncated forms of the proteins they encode
(Ahn et al., 1995
;
Stickens et al., 1996
;
Wuyts and Van Hul, 2000
;
Zak et al., 2002
). The
clinical syndromes of HME caused by mutations at the EXT1 or the
EXT2 loci are identical, and no phenotype-genotype correlations exist
(Cook et al., 1993
;
Le Merrer et al., 1994
;
Wu et al., 1994
).
The initial identification of EXT genes as glycosyltransferases did not
yield an immediate understanding of the biological processes they control. If
HS is present on almost every cell type, then why do mutations in EXT genes
lead primarily to a bone phenotype? Further insight into the function of EXT
genes was obtained through the identification of the Drosophila Ext
genes tout-velu (homolog of EXT1), sister of tout-velu
(homolog of EXT2) and brother of tout-velu (homolog of EXTL3)
(Bellaiche et al., 1998
;
Han et al., 2004
;
Takei et al., 2004
). Mutations
in these genes result in the accumulation of Hedgehog, Wingless and
Decapentaplegic proteins in front of the mutant cells, suggesting that HS is
required for generating morphogen gradients. This was an important finding, as
mutations in EXT genes affect bone formation, and all three morphogens
[Hedgehog, Wnt proteins and bone morphogenic proteins (BMPs)] have a role in
skeletal development (Karsenty and Wagner,
2002
).
Targeted deletion of Ext1 in mice results in early embryonic
lethality and Ext1-null embryos die around the time of gastrulation.
Inactivation of Ext1 abolishes the production of HS, illustrating the
importance of Ext genes in HS synthesis
(Lin et al., 2000
).
Ext1 heterozygous mice show somewhat increased chondrocyte
proliferation and delayed hypertrophic differentiation owing to increased
Indian hedgehog [Ihh (Hilton et al.,
2005
)], but are not reported to show any gross skeletal phenotype.
Other evidence of a direct relationship between Ihh, Ext genes and bone
development has come from the analysis of mice with a hypomorphic
Ext1 allele (Ext1gt/gt) that was generated by a
gene-trap method (Koziel et al.,
2004
). In contrast to Ext1-null mice,
Ext1gt/gt mice survive until E14.5 and some
embryos can be recovered at E16.5. Interestingly, in the growth plates of
Ext1gt/gt mice, Ihh has an expanded range of
signaling. These data suggest that Ext1 might play a role in endochondral
ossification by modulating the distribution of Ihh. As EXT1 and EXT2 form a
complex and HME is caused by mutations in either gene, we generated mice
deficient for Ext2 and analyzed the homozygous and heterozygous
phenotypes to better understand the etiology of this disease.
| Materials and methods |
|---|
|
|
|---|
Genotyping
ES cell DNA and mouse tail DNA were screened for the Ext2 targeted
mutation by digestion with SpeI or HindIII, followed by
southern blot hybridization with probe A or probe B, respectively (see Fig. S1
in the supplementary material). Replacement of exon 2 of the Ext2
gene with a neo cassette introduced SpeI and HindIII sites
that could be used to distinguish the wild-type allele from the targeted
allele. Upon digestion of genomic DNA with SpeI and hybridization
with probe A, wild-type and targeted alleles produced fragments of 9 kb and
5.3 kb, respectively. Following digestion with HindIII and
hybridization with probe B, wild-type and targeted alleles produced fragments
of 6 kb and 3.5 kb, respectively. Probe A is a 1.8 kb
SpeI-HindIII fragment external to the region of vector
homology. Probe B is a 300 bp PCR amplification product (forward primer,
5'ACATTATGATCACATATTGC; reverse primer,
5'GGAGTACAATGAACTGCTGACG3'), 3' from exon2 and internal to
the region of vector homology. PCR genotyping was accomplished using a
four-primer PCR amplification (wild-type allele: Ext2-GT-150F,
GGTCTGGACGATAGGTGTCAGG; Ext2-GT-640F, GTGACGTAGTAGATTCGGTGC; the amplification
product is 190 bp) (targeted allele: Ext2-GT-810R, GTTGAACAATCCAATCCACGC;
Ext2-GT-NEO-R, CATGCTCCAGACTGCCTTGG; the amplification product is 260 bp).
Trophoblast stem cells (TSC)
TSC were isolated as previously described
(Tanaka et al., 1998
) with
some modifications: 3.5 dpc mouse blastocysts were isolated from
Ext2+/ C57BL/6 mice crossings. They were
individually plated into four-well plates and cultured on mouse embryonic
fibroblasts (MEF) in MEF medium + Fgf4 (25 ng/ml) + heparin (1 µg/ml). The
medium was changed on day 3 and the blastocyst outgrowths were trypsinized on
day 4 or 5. Flat colonies appeared between day 6 and day 10 and were split
once they had reached 50% confluence. The medium was changed every 2 days and
the cells were passaged at 80 to 90% confluence at 1 part in 10 or 20. When
the blastocyst outgrowths or the cell lines were trypsinized, the doses of
Fgf4 and heparin used for the cultures were 1.5 x the normal dose. TSC
were weaned from the MEFs after two passages.
Histological analyses and immunohistochemistry
Tissues were fixed in 4% paraformaldehyde in phosphate-buffered saline,
decalcified in EDTA, paraffin embedded, sectioned at 5 µm and stained with
von Kossa's stain, Safranin O/Fast Green or Masson Trichrome. Briefly, for
Safranin O/Fast Green staining, deparaffinized rehydrated sections were
stained in Weigert's Iron Hematoxylin (Sigma,), 0.02% aqueous Fast Green
(Sigma) followed by a rinse in 1% acetic acid and 0.1% aqueous Safranin O
(Sigma). For Masson Trichrome staining, a kit was used according to the
instructions of the manufacturer (Sigma).
For immunohistochemistry, tissues were fixed, embedded and sectioned as described above. For HS immunostaining, sections were deparaffinized, washed in PBS and any endogenous peroxidase activity was blocked using 0.3% hydrogen peroxide (Sigma) in methanol for 30 minutes at ambient temperature. Sections were rinsed in PBS and incubated with M.O.M. blocking solution (M.O.M. kit, Vector Laboratories) for 1 hour at room temperature. After rinsing in PBS, sections were incubated overnight at 4°C with the mouse monoclonal antibody 10E4 (Seikagaku) at a dilution of 1:100. Unbound antibody was removed by washing in PBS. Bound antibody was detected using an HRP-conjugated anti-mouse IgM secondary antibody (Jackson ImmunoResearch Laboratories) for 1 hour at ambient temperature. After washing in PBS, the peroxidase was detected using a DAB detection kit (Zymed). Sections were washed in tap water and counterstained with Methyl Green (Sigma). Control sections were overlaid with 2.5 mU of heparitinase I (Sigma) in 0.5 ml of buffer (100 mM NaCl, 1 mM CaCl2, 50 mM sodium HEPES, pH 7.0, containing 25 mg of BSA) for 2 hours at 37°C. After rinsing in PBS, sections were incubated with the HS antibody 10E4 as described above.
Preparation and staining of whole skeletons
Whole skeletal preparations of 2-week-old mice were prepared and stained
with Alizarin Red and Alcian Blue as previously described
(McLeod, 1980
). For the
measurements of bone length and localization of exostoses, skeletons were
prepared by Dermestid beetles as described
(Hefti et al., 1980
).
BrdU labeling and histology
A 10 mg/ml stock of bromodeoxyuridine (BrdU; Sigma) was injected
intraperitoneally into one-week-old mice at a dose of 100 µg BrdU/g. Mice
were sacrificed 1 hour after injection, bones were harvested and processed as
described in the section `Histological analyses and immunohistochemistry'.
Staining for BrdU was carried out on paraffin sections using a kit according
to manufacturer's directions (Zymed).
RT-PCR analysis
Poly (A) RNA was isolated (Micro-FastTrack, Invitrogen) from TSC according
to manufacturer instructions. cDNA was synthesized using a kit from Invitrogen
(Two-step RT-PCR system) and used as template for PCR reactions using the
following primers: Ext2-exon2 forward, 5'GTGGATGATGCCGGTGTTCC 3';
Ext2-exon3 reverse, 5' CAGGCAACATATTGAACAGC 3'; Ext2-exon8
forward, 5' CCTACAGATCATCAATGACAGG 3'; Ext2-exon9 reverse,
5' AGCAGCTTGGACAGACTGG 3'. Primer sets represent coding regions
that span introns. E-cadherin primers were used as a control for RNA
integrity. PCR amplification was performed using 30 cycles and products were
analyzed on 2% agarose gels.
In situ hybridization
Paraffin sections were placed on acid-etched, TESPA-treated slides and
prepared for in situ hybridization as described
(Albrecht et al., 1997
).
Plasmids were linearized with the appropriate restriction enzymes to
transcribe either sense or antisense 35S-labeled riboprobes. Probes
were as follows: collagen type 2 (Col2a1), collagen type 10
(col10a), Indian hedgehog (Ihh) and patched 1
(Ptch1) (Albrecht et al.,
1997
; Ferguson et al.,
1999
); parathyroid hormone/parathyroid hormone-like peptide
receptor (Pthr1) (Kobayashi et
al., 2002
); Fgf8
(Crossley and Martin, 1995
);
brachyury (Wilkinson et al.,
1990
); Apoe
(Basheeruddin et al., 1987
);
H19 (Poirier et al.,
1991
); Lim1 (Shawlot
and Behringer, 1995
); Snai1
(Nieto et al., 1992
);
Otx2 (Simeone et al.,
1993
); and Hesx1
(Thomas and Beddington, 1996
).
Slides were washed at a final stringency of 65°C in 23 xSSC, dipped
in emulsion and exposed for 1-2 weeks. Slides were counterstained with Hoechst
33342 or Hematoxylin.
Protein purification, immunoprecipitation and western blotting
Cell culture supernatants (with or without serum) were collected on ice in
the presence of protease inhibitors [pepstatin (5 µg/ml), leupeptin (1
µg/ml), aprotinin (10 µg/ml), benzamidine (10 µg/ml) (Sigma)],
centrifuged at 150 g for five minutes at 4°C to remove
non-adherent cells and cell debris, aliquoted and stored at 80°C.
Whole-cell lysates were prepared by scraping cultured cells into RIPA buffer
(20 mM Tris pH 7.2, 10 mM EDTA, 0.3 M NaCl, 0.1% SDS, 1% Triton X100, 0.05%
Tween 20) containing the same protease inhibitors. Cell debris was removed by
centrifugation at 20,000 g for 20 minutes at 4°C and the
protein aliquots were stored at 80°C until used. The BCA protein
assay kit (Pierce, Rockford, IL) was used to determine the protein
concentration of the supernatants and of the cell lysates. The polyclonal
antibody against Ext2 was a generous gift from Dr Takahiko Shimizu (Tokyo
Metropolitan Institute of Gerontology)
(Morimoto et al., 2002
).
Analyses of glycosaminoglycan chains and cellular enzyme activities
Trophoblast stem cells or ES cells were cultured for 72 hours in a medium
composed of 70% MEF-conditioned medium and 30% sulfate-depleted RPMI medium or
for 48 hours with 50 µCi/ml of 35SO4 (Dupont NEN) in
sulfate-reduced F12 medium, respectively. [35S]GAG chains were
isolated by DEAE chromatography and a sample was treated with chondroitinase
ABC at 37°C overnight (Bame and Esko,
1989
). Treated and untreated chains were separated by
anion-exchange HPLC. Glycosaminoglycans were eluted with a linear gradient of
NaCl (0.2-1 M) using a flow rate of 1 ml/minute and increasing the NaCl
concentration by 10 mM/minute. The effluent from the column was monitored for
radioactivity with an in-line radioactivity detector (Radiomatic floOne/beta,
Packard Instruments) with sampling rates every 6 seconds and data averaged
over 1-minute intervals.
| Results |
|---|
|
|
|---|
We expected that inactivation of Ext2 would also abolish HS synthesis. To test this hypothesis, we isolated wild type, Ext2+/ and Ext2/ TSC, and collected RNA for RT-PCR analyses (Fig. 1A). As expected, no amplification product was obtained in an RT-PCR reaction using primers for exon 2. However, an amplification product of the expected size was obtained when primers for exon 8 were used, indicating that a truncated form of the Ext2 RNA transcript was being made. Cell lysates from wild-type, heterozygous and Ext2/ TSC were analyzed by western blot (Fig. 1B). Incubation with a polyclonal antibody against EXT2 showed an expected band of 82 kDa in cell lysates from wild-type and Ext2+/ TSC. However, heterozygotes showed a second band of lower molecular weight and of varying intensity, suggesting that a truncated form of the protein was being produced. Immunoblots of lysates from Ext2/ cells revealed that these cells express only the truncated form of the protein.
ES cells derived from wild-type, heterozygous and null embryos were grown
in culture with 35SO4 to label sulfated
glycosaminoglycans, which in wild-type cells consist of a mixture of HS and
chondroitin sulfate (CS) (Lin et al.,
2000
). A sample of the 35S-GAG chains was analyzed by
anion exchange chromatography directly and another sample was first treated
with chondroitinase ABC, which depolymerizes chondroitin sulfate. As shown in
Fig. 1C, wild-type and
heterozygous Ext2 ES cells both produced two peaks of labeled material. The
first peak was resistant to chondroitinase and signifies HS, whereas the
second peak was sensitive to chondroitinase and signifies CS.
Ext2/ ES cells only produced one peak, which
co-eluted with CS and was sensitive to chondroitinase, and thus no HS was
being produced.
Next, we verified that HS was not produced by staining sections of E7.5 wild-type and Ext2/ embryos with an antibody that recognizes HS (10E4) (Fig. 1D). In wild-type embryos, a strong signal was detected in the basement membranes of the ectodermal, endodermal and mesodermal cell layers. By contrast, specific staining for HS was not detected in Ext2/ mutants. Therefore, although an immunoreactive fragment of the Ext2 protein is produced, it is inactive in HS synthesis.
Loss of Ext2 results in early embryonic lethality
Mice heterozygous for the Ext2 mutant allele appeared
phenotypically normal and gave rise to litters of normal size when crossed
with wild-type animals. We did not detect any
Ext2/ neonates from nearly 300 offspring of
Ext2 heterozygous intercross matings, indicating that mutant mice
died during embryogenesis (Table
1). To characterize the embryonic lethality, timed
Ext2+/ matings were set up and embryos were
genotyped and morphologies examined starting at E6.0. At E6.0, Ext2 mutants
were indistinguishable from wild-type embryos (data not shown). However, at
E6.5 the first visible and reproducible differences with wild-type embryos
became apparent (Fig. 2A,B).
Mutant embryos appeared to have formed a normal ectoplacental cone, but the
extra-embryonic regions were underdeveloped and the egg cylinder did not
elongate. At E7.5, all wild-type embryos had initiated gastrulation and had
formed a primitive streak. Although all of the mutants were smaller than
wild-type embryos, there was heterogeneity with respect to the degree of egg
cylinder elongation and formation of extra-embryonic structures connecting the
embryonic structures to the ectoplacental cone
(Fig. 2C,D). Despite the
morphological variation of Ext2/ embryos,
none of the mutants showed any visible evidence of primitive streak formation
(Fig. 2E-H). By E8.5, the
Ext2/ embryos had degenerated and lacked
recognizable structures (data not shown).
|
|
|
A second class of mutants (class 2), representing about 50% of all mutants, developed some extra-embryonic structures, but they were composed of immature extra-embryonic ectoderm and endoderm, when compared with wild type, and lacked extra-embryonic mesoderm entirely (Fig. 2G). The egg cylinder had elongated to about one-third the size of the wild-type embryos, but only consisted of embryonic ectoderm and visceral endoderm. TUNEL assays showed only a few apoptotic cells (Fig. 2K).
A third group of Ext2 mutants (class 3), showed further elongation of the embryonic and extra-embryonic regions, but still no embryonic or extra-embryonic mesoderm was present (Fig. 2H). Interestingly, these mutants had initiated the formation of a head fold and histological analyses showed the presence of neuroectoderm. This region of the embryo contained a high number of TUNEL-positive cells (Fig. 2L). Further histological analyses indicated that cavitation was taking place in the region of TUNEL-positive cells (data not shown).
|
|
Our histological analyses indicated that some E7.5
Ext2/ embryos can initiate the formation of
a head fold and accumulate neuroectoderm. Otx2 is normally detected
in anterior neuroectoderm at late streak stage, in the region encompassing the
prospective forebrain and midbrain (Ang et
al., 1994
; Simeone et al.,
1993
). Hesx1 is initially expressed in anterior visceral
endoderm (AVE) and subsequently in definitive endoderm. Hesx1
expression then intensifies and spreads laterally into neuroectoderm, but
remains restricted to the most anterior region of the brain
(Hermesz et al., 1996
;
Thomas and Beddington, 1996
).
Therefore, we performed in situ hybridization with Otx2 and
Hesx1 probes, and were able to confirm that the anterior cell mass
observed in the Ext2/ mutants is indeed
neuroectoderm (Fig. 3S,T).
Ext2 heterozygous mice form exostoses
Humans with HME are heterozygous for either EXT1 or EXT2. Close examination
of the skeletons of Ext2+/ mice revealed the
presence of one or more exostoses on the ribs of 7 out of 25 (28%) Ext2
heterozygotes, whereas exostoses were never detected in wild-type animals
(Fig. 4A,B). In humans, ribs
are a common location for exostoses formation, although nearly every bone,
with the exception of membranous bones, is involved. However, we did not find
exostoses on the long bones (tibia, femur, ulna and radius) of the
Ext2+/ mice. Despite this difference, the exostoses
we examined in the mice were very similar to those seen in humans and varied
in shape and size from a small widening of the metaphyseal region to a large
bulky outgrowth. Most mice only had a single exostosis (range 1-3). The
distribution of lesions was uniform throughout the rib cage and there was no
preferential orientation of the projection (ventrally, dorsally or
laterally).
Mouse exostoses resembled those in humans. The lesions were located near the costochondral junction and were composed of cortical and medullary bone with an overlying hyaline cartilage cap (Fig. 4C-E). Characteristic for exostoses, the bone marrow cavity was continuous with that of the underlying bone. The cartilage cap was covered with a thin layer of fibrous tissue that was continuous with the perichondrium. Within the cartilage cap we found random patches of calcification. Some chondrocytes appeared to be lined up, resembling the organization of chondrocytes in a normal growth plate. Histological sections of the exostosis cartilage cap stained positive for HS with the HS antibody 10E4 (Fig. 4F). These results demonstrate that chondrocytes of the exostosis produce HS, and are therefore not null for Ext2.
Frequently, the formation of exostoses is accompanied by short stature
(Hennekam, 1991
). It has been
previously reported that Ext1+/ mice have a
10% reduction in bone length (Lin et
al., 2000
). We examined bone length in
Ext2+/ mice on the C57BL/6 background. Skeletons at
12 weeks of age were cleaned by Dermestid beetles and found no significant
difference in either total length [wild type, 95.2±0.534 mm
(n=27); Ext2+/, 96.0±0.637 mm
(n=25); P=0.351, two-tailed t-test], measured from
tip of the snout to base of the tail, or in the ratio of total length divided
by length of tibia plus femur [wild type, 2.90±0.012 mm
(n=25); Ext2+/, 2.91±0.014 mm
(n=25); P=0.887, two-tailed t-test). Our
reevaluation of Ext1+/ mice also showed no
significant differences in bone length (B.M.Z., D.S., M. Hilton, G. Evans,
Z.W., D. Wells and J.D.E., unpublished).
Ribs of Ext2+/ mice show chondrocyte abnormalities
We also observed a 100% penetrant phenotype in postnatal Ext2
heterozygotes: nodules or single misplaced chondrocytes were detected on every
rib and appeared throughout the entire length of the costochondral cartilage
(Fig. 5A). These displaced
chondrocytes were present as single cells
(Fig. 5B) or as clusters
(Fig. 5C) near the
perichondrium. On rare occasions, a nodule was large enough to be detected on
a whole-mount skeletal stain (Fig.
5D). The abnormal chondrocytes were always found with overlying
perichondrium. In many cases, this appeared to make the perichondrium bulge
out.
|
|
|
As the displaced cartilage had the appearance of prematurely differentiated chondrocytes, we performed in situ hybridization analysis with a Col10 antisense probe to check for evidence of cartilage hypertrophy (Fig. 7D). At 2 weeks of age, hypertrophic cells in the center of the rib cartilage expressed Col10, while cells in the periphery did not. The nodules of displaced chondrocytes expressed Col10, but were separated from the centrally located hypertrophic cells by a layer of chondrocytes that did not express Col10. This thin layer of cells did express Col2 (data not shown). These data indicate that cells in the nodule had differentiated prematurely. Staining with the HS antibody 10E4 further showed that the chondrocytes in the nodules still produced HS, and thus were not Ext2/ cells (Fig. 7E).
We next asked what mechanism underlies these defects in cartilage formation. The Ihh/Pthr1 pathway was a good candidate, as altered activation of this pathway can potentiate chondrocyte differentiation. We observed that, although Ihh is expressed in the growth plate of rib cartilage at the time the defects appear, it is absent from the rest of the rib cartilage and from areas where premature differentiation was observed (data not shown). To determine hedgehog activity more sensitively, we crossed the Ext2+/ mice with mice carrying lacZ under control of the hedgehog receptor patched 1 (Ptch1). At 1-2 weeks of age, when the premature hypertrophic differentiation was observed, no lacZ staining could be found in the rib cartilage other than in the growth plate of the rib (data not shown; see Fig. 10 for schematic representation of expression domains). This result is in agreement with our in situ analysis and indicates that there is no aberrant hedgehog activity in the Ext2+/ chondrocytes.
What is the mechanism of cartilage hypertrophy?
Pthlp/ mice show hypertrophic
differentiation that is reversed by introducing a constitutively active Pthr1
under the control of the Col2 promoter
(Soegiarto et al., 2001
). To
test whether the abnormal chondrocyte hypertrophy seen in the nodules of the
Ext2+/ ribs was due to reduced Pthlp signaling, we
crossed the constitutively active Col2-Pthr1 transgene into the
Ext2+/ mice
(Fig. 8). However, this was
unable to prevent the premature hypertrophic differentiation of the rib
cartilage of Ext2+/ mice. Taken together, these
data suggest that the rib cartilage abnormalities seen in the
Ext2+/ mice are not the direct result of
alterations in Ihh/Pthr1 signaling.
Ext2+/ mice show chondrocyte abnormalities in growth plates of long bones
The phenotype seen in the ribs prompted us to look for phenotypes in the
growth plates of long bones. There were no overt morphological differences in
growth plates in histological sections of ulna, radius and femur from E18.5
wild-type and Ext2+/ mice
(Fig. 9A,B). Mineralization of
the cartilage matrix, formation of the bony collar surrounding the
hypertrophic chondrocytes and formation of trabecular bone all appeared to be
normal (Fig. 9E,F).
|
However, closer examination of the chondrocytes in the proliferative zone
showed a loss of the characteristic columnar organization normally seen in
wild-type growth plates (Fig.
9A-D). Although the organizational defect in
Ext2+/ long bones was subtle, it was consistent for
all (8/8) bones examined. Similar chondrocyte disorganization was observed in
embryonic mice homozygous for a gene trap insertion in the Ext1 gene
(Ext1gt/gt)
(Koziel et al., 2004
).
In wild-type mice, Pthr1 and Ihh are expressed in prehypertrophic chondrocytes in domains that were partially overlapping (Fig. 9K,L and Fig. 9M,N, respectively). Ptch1 was expressed in the perichondrium, adjacent to the expression domain of Ihh and in proliferating chondrocytes (Fig. 9I,J). Ext2+/ mice expressed Ptch1, Ihh and Pthr1 in the appropriate places, but there was a small decrease in the expression domains of Pthr1 and Ihh, while the Ptch1 expression domain in Ext2+/ seemed comparable with that in wild type. We then analyzed the distribution of Ihh protein by immunohistochemistry using Ab80, a sonic hedgehog antibody that crossreacts with Ihh. We did not see any obvious difference in the localization of the hedgehog protein between wild type and Ext2+/ (data not shown). These data show that inactivation of one allele of Ext2 interferes with normal chondrocyte development. However, as we could not detect any differences in total length of bones, this differentiation defect does not appear to influence the endochondral ossification process in any significant way.
| Discussion |
|---|
|
|
|---|
Lack of mesoderm formation in Ext2-null mutants
Inactivation of Ext2 results in early embryonic lethality around the time
of gastrulation. The morphogenic movements and differentiation of cells that
accompany gastrulation are in large part directed by signaling molecules, such
as members of the transforming growth factor ß (Tgfß) superfamily
(Zhao, 2003
), Wnt proteins
(Kelly et al., 2004
) and Fgf
proteins (Ciruna and Rossant,
2001
). Many of these signaling molecules can bind HS, at least in
vitro (for a review, see Lin,
2004
). Our data show that inactivation of Ext2 abolishes
production of HS, possibly resulting in an effect on one or more of these
signaling pathways. One candidate is Ihh, as mice with a gene trap mutation in
the Ext1 gene have altered Indian hedgehog signaling
(Koziel et al., 2004
).
However, Ihh-null mutants die around mid-gestation, between 10.5 and
12.5 dpc (St-Jacques et al.,
1999
), much later than the Ext2-null mice.
The lack of Ext2 leads to a gastrulation defect and abnormalities in the
formation of extra-embryonic structures. As proteoglycans are required for
gastrulation and specifically to promote Fgf signaling
(Garcia-Garcia and Anderson,
2003
), it is plausible that FGF signaling is affected in Ext
mutants. However, Fgf4 and Fgfr2 mutant mice die shortly
after implantation (Arman et al.,
1998
; Feldman et al.,
1995
), and thus have an earlier phenotype than Ext-null mice. Ext
mutants share some similarities with Fgfr1 and Fgf8 mutants,
although they differ greatly with respect to formation of extra-embryonic
structures.
|
Exostoses formation and chondrocytes differentiation abnormalities
HME is characterized by the presence of multiple bony outgrowths or lumps
on the metaphyses of long bones. In this study, we show that exostoses formed
in Ext2 heterozygote mice with all of the features found in human exostoses.
To determine why exostoses in mice only form on the ribs is in principle no
different from asking why individuals with HME do not have exostoses on all of
their bones. Is there a phenotype that is common to all heterozygotes that
could predispose them to exostoses formation? Indeed, we found a subtle
disorganization of late proliferative chondrocytes in the growth plates of all
bones of the Ext2 heterozygotes and a small but reproducible decrease
in the expression zone of Ihh and Pthr1. However, Ihh expression was greatly
reduced postnatally and, thus, it is possible that there was a difference in
diffusion of the Ihh protein, too subtle to be detected with our methods.
Alternatively, the disorganization of chondrocytes could be the result of
changes in the ECM caused by the reduction of HS.
|
The EXT1 and EXT2 genes have been suggested to function
as tumor suppressor genes on the basis of studies showing loss of
heterozygosity for markers around the EXT1 and EXT2 loci in
both sporadic and exostosis-derived chondrosarcomas
(Hecht et al., 1995
). Our
analyses show a reduction in the amount of HS in the chondrocyte zones of
exostoses, but never a total loss, lending further support to the model that
exostoses formation is the result of haploinsufficiency.
The dependence of FGF signaling pathways on HS has been well documented. In
the long bones, FGF signaling shortens proliferative columns both by
decreasing chondrocyte proliferation directly and by suppressing Ihh
expression (Minina et al.,
2002
; Naski and Ornitz,
1998
; Ornitz and Marie,
2002
). Bmps antagonize the effects of Fgf signaling
(Minina et al., 2002
;
Minina et al., 2001
).
Mutations in Ext1 and Ext2 decrease HS synthesis, which
might result in reduced Fgf signaling, leading to defects in chondrocyte
differentiation. Our preliminary data support the hypothesis that altered Fgf
signaling could cause the Ext2 phenotype (B.M.Z., D.S., M. Hilton, G. Evans,
Z.W., D. Wells and J.D.E., unpublished).
An intriguing issue is whether the premature differentiation of chondrocytes leads to the formation of exostoses or whether distinct processes cause the two phenomena. It has been suggested that the formation of the exostoses is the result of a defect in the bony collar that surrounds the growth plate. Alternatively, the passage of the growth plate might result in vascularization of the tissue, causing the chondrocytes in the nodule, which have an opposite orientation of differentiation, to initiate the outgrowth of an exostosis at a 90° angle from the parent bone (Fig. 10). During rib growth, the ratio of cartilage to bone in the ribs is essentially constant. The probability of the growth plate passing a nodule is relatively small, as the nodules appear only between 1 and 2 weeks, and are rare compared with the overall number of chondrocytes. Thus, the random distribution of nodules relative to the growth plate could explain the low penetrance and variable distribution of exostoses.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/22/5055/DC1
* Present address: Merck Research Laboratories, 126 Lincoln Avenue, Rahway,
NJ 07065-0900, USA ![]()
These authors contributed equally to this work ![]()
Present address: Hôpital BichatClaude-Bernard, 46 Rue
Henri-Huchard, 75018 Paris, France ![]()
| REFERENCES |
|---|
|
|
|---|
Ahn, J., Ludecke, H. J., Lindow, S., Horton, W. A., Lee, B.,
Wagner, M. J., Horsthemke, B. and Wells, D. E. (1995).
Cloning of the putative tumour suppressor gene for hereditary multiple
exostoses (EXT1). Nat. Genet.
11,137
-143.[CrossRef][Medline]
Albrecht, U., Eichele, G., Helms, J. A. and Lu, H.
(1997). Visualization of gene expression patterns by in situ
hybridization. In Molecular and Cellular Methods in Developmental
Toxicology (ed. G. Daston), pp. 23-48.
Boca Raton: CRC Press.
Ang, S. L., Conlon, R. A., Jin, O. and Rossant, J.
(1994). Positive and negative signals from mesoderm regulate the
expression of mouse Otx2 in ectoderm explants.
Development 120,2979
-2989.[Abstract]
Arman, E., Haffner-Krausz, R., Chen, Y., Heath, J. K. and Lonai,
P. (1998). Targeted disruption of fibroblast growth factor
(FGF) receptor 2 suggests a role for FGF signaling in pregastrulation
mammalian development. Proc. Natl. Acad. Sci. USA
95,5082
-5087.
Bame, K. J. and Esko, J. D. (1989).
Undersulfated heparan sulfate in a Chinese hamster ovary cell mutant defective
in heparan sulfate N-sulfotransferase. J. Biol. Chem.
264,8059
-8065.
Barnes, J. D., Crosby, J. L., Jones, C. M., Wright, C. V. and
Hogan, B. L. (1994). Embryonic expression of Lim-1, the mouse
homolog of Xenopus Xlim-1, suggests a role in lateral mesoderm differentiation
and neurogenesis. Dev. Biol.
161,168
-178.[CrossRef][Medline]
Basheeruddin, K., Stein, P., Strickland, S. and Williams, D.
L. (1987). Expression of the murine apolipoprotein E gene is
coupled to the differentiated state of F9 embryonal carcinoma cells.
Proc. Natl. Acad. Sci. USA
84,709
-713.
Bellaiche, Y., The, I. and Perrimon, N. (1998).
Tout-velu is a Drosophila homologue of the putative tumour suppressor EXT-1
and is needed for Hh diffusion. Nature
394, 85-88.[CrossRef][Medline]
Bornemann, D. J., Duncan, J. E., Staatz, W., Selleck, S. and
Warrior, R. (2004). Abrogation of heparan sulfate synthesis
in Drosophila disrupts the Wingless, Hedgehog and Decapentaplegic signaling
pathways. Development
131,1927
-1938.
Ciruna, B. and Rossant, J. (2001). FGF
signaling regulates mesoderm cell fate specification and morphogenetic
movement at the primitive streak. Dev. Cell
1, 37-49.[CrossRef][Medline]
Conlon, F. L., Lyons, K. M., Takaesu, N., Barth, K. S., Kispert,
A., Herrmann, B. and Robertson, E. J. (1994). A
primary requirement for nodal in the formation and maintenance of the
primitive streak in the mouse. Development
120,1919
-1928.[Abstract]
Cook, A., Raskind, W., Blanton, S. H., Pauli, R. M., Gregg, R.
G., Francomano, C. A., Puffenberger, E., Conrad, E. U., Schmale, G.,
Schellenberg, G. et al. (1993). Genetic heterogeneity in
families with hereditary multiple exostoses. Am. J. Hum.
Genet. 53,71
-79.[Medline]
Crossley, P. H. and Martin, G. R. (1995). The
mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions
that direct outgrowth and patterning in the developing embryo.
Development 121,439
-451.[Abstract]
Esko, J. D. and Selleck, S. B. (2002). Order
out of chaos: assembly of ligand binding sites in heparan sulfate.
Annu. Rev. Biochem. 71,435
-471.[CrossRef][Medline]
Feldman, B., Poueymirou, W., Papaioannou, V. E., DeChiara, T. M.
and Goldfarb, M. (1995). Requirement of FGF-4 for
postimplantation mouse development. Science
267,246
-249.
Ferguson, C., Alpern, E., Miclau, T. and Helms, J. A.
(1999). Does adult fracture repair recapitulate embryonic
skeletal formation? Mech. Dev.
87, 57-66.[CrossRef][Medline]
Garcia-Garcia, M. J. and Anderson, K. V.
(2003). Essential role of glycosaminoglycans in Fgf signaling
during mouse gastrulation. Cell
114,727
-737.[CrossRef][Medline]
Han, C., Belenkaya, T. Y., Khodoun, M., Tauchi, M. and Lin,
X. (2004). Distinct and collaborative roles of Drosophila EXT
family proteins in morphogen signalling and gradient formation.
Development 131,1563
-1575.
Hecht, J. T., Hogue, D., Strong, L. C., Hansen, M. F., Blanton,
S. H. and Wagner, M. (1995). Hereditary multiple
exostosis and chondrosarcoma: linkage to chromosome II and loss of
heterozygosity for EXT-linked markers on chromosomes II and 8. Am.
J. Hum. Genet. 56,1125
-1131.[Medline]
Hefti, E., Trechsel, U., Rufenacht, H. and Fleisch, H.
(1980). Use of dermestid beetles for cleaning bones.
Calcif. Tissue Int. 31,45
-47.[CrossRef][Medline]
Hennekam, R. C. M. (1991). Hereditary multiple
exostosis. J. Med. Genet.
28,262
-266.
Hermesz, E., Mackem, S. and Mahon, K. A.
(1996). Rpx: a novel anterior-restricted homeobox gene
progressively activated in the prechordal plate, anterior neural plate and
Rathke's pouch of the mouse embryo. Development
122, 41-52.[Abstract]
Hilton, M. J., Gutierrez, L., Martinez, D. A. and Wells, D.
E. (2005). EXT1 regulates chondrocyte proliferation and
differentiation during endochondral bone development.
Bone 36,379
-386.[Medline]
Karsenty, G. and Wagner, E. F. (2002). Reaching
a genetic and molecular understanding of skeletal development. Dev.
Cell 2,389
-406.[CrossRef][Medline]
Kelly, O. G., Pinson, K. I. and Skarnes, W. C.
(2004). The Wnt co-receptors Lrp5 and Lrp6 are essential for
gastrulation in mice. Development
131,2803
-2815.
Kobayashi, T., Chung, U. I., Schipani, E., Starbuck, M.,
Karsenty, G., Katagiri, T., Goad, D. L., Lanske, B. and Kronenberg, H.
M. (2002). PTHrP and Indian hedgehog control differentiation
of growth plate chondrocytes at multiple steps.
Development 129,2977
-2986.
Koziel, L., Kunath, M., Kelly, O. G. and Vortkamp, A.
(2004). Ext1-dependent heparan sulfate regulates the range of Ihh
signaling during endochondral ossification. Dev. Cell
6, 801-813.[CrossRef][Medline]
Le Merrer, M., Legeai-Mallet, L., Jeannin, P. M., Horsthemke,
B., Schinzel, A., Plauchu, H., Toutain, A., Achard, F., Munnich, A. and
Maroteaux, P. (1994). A gene for hereditary multiple
exostoses maps to chromosome 19p. Hum. Mol. Genet.
3, 717-722.
Lee, J. S., von der Hardt, S., Rusch, M. A., Stringer, S. E.,
Stickney, H. L., Talbot, W. S., Geisler, R., Nusslein-Volhard, C.,
Selleck, S. B., Chien, C. B. et al. (2004). Axon sorting in
the optic tract requires HSPG synthesis by ext2 (dackel) and extl3 (boxer).
Neuron 44,947
-960.[CrossRef][Medline]
Lin, X. (2004). Functions of heparan sulfate
proteoglycans in cell signaling during development.
Development 131,6009
-6021.
Lin, X., Wei, G., Shi, Z., Dryer, L., Esko, J. D., Wells, D. E.
and Matzuk, M. M. (2000). Disruption of gastrulation
and heparan sulfate biosynthesis in EXT1-deficient mice. Dev.
Biol. 224,299
-311.[CrossRef][Medline]
Lind, T., Tufaro, F., McCormick, C., Lindahl, U. and Lidholt,
K. (1998). The putative tumor suppressors EXT1 and EXT2 are
glycosyltransferases required for the biosynthesis of heparan sulfate.
J. Biol. Chem. 273,26265
-26268.
Maruoka, Y., Ohbayashi, N., Hoshikawa, M., Itoh, N., Hogan, B.
L. and Furuta, Y. (1998). Comparison of the expression
of three highly related genes, Fgf8, Fgf17 and Fgf18, in the mouse embryo.
Mech. Dev. 74,175
-177.[CrossRef][Medline]
McCormick, C., Leduc, Y., Martindale, D., Mattison, K., Esford,
L. E., Dyer, A. P. and Tufaro, F. (1998). The putative
tumour suppressor EXT1 alters the expression of cell-surface heparan sulfate.
Nat. Genet. 19,158
-161.[CrossRef][Medline]
McCormick, C., Duncan, G., Goutsos, K. T. and Tufaro, F.
(2000). The putative tumor suppressors EXT1 and EXT2 form a
stable complex that accumulates in the Golgi apparatus and catalyzes the
synthesis of heparan sulfate. Proc. Natl. Acad. Sci.
USA 97,668
-673.
McLeod, M. J. (1980). Differential staining of
cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S.
Teratology 22,299
-301.[CrossRef][Medline]
Minina, E., Wenzel, H. M., Kreschel, C., Karp, S., Gaffield, W.,
McMahon, A. P. and Vortkamp, A. (2001). BMP and
Ihh/PTHrP signaling interact to coordinate chondrocyte proliferation and
differentiation. Development
128,4523
-4534.
Minina, E., Kreschel, C., Naski, M. C., Ornitz, D. M. and
Vortkamp, A. (2002). Interaction of FGF, Ihh/Pthlh, and BMP
signaling integrates chondrocyte proliferation and hypertrophic
differentiation. Dev. Cell
3, 439-449.[CrossRef][Medline]
Morimoto, K., Shimizu, T., Furukawa, K., Morio, H., Kurosawa, H.
and Shirasawa, T. (2002). Transgenic expression of the
EXT2 gene in developing chondrocytes enhances the synthesis of heparan sulfate
and bone formation in mice. Biochem. Biophys. Res.
Commun. 292,999
-1009.[CrossRef][Medline]
Nakato, H. and Kimata, K. (2002). Heparan
sulfate fine structure and specificity of proteoglycan functions.
Biochim. Biophys. Acta
1573,312
-318.[Medline]
Naski, M. C. and Ornitz, D. M. (1998). FGF
signaling in skeletal development. Front. Biosci.
3,D781
-D794.
Nieto, M. A., Bennett, M. F., Sargent, M. G. and Wilkinson, D.
G. (1992). Cloning and developmental expression of Sna, a
murine homologue of the Drosophila snail gene.
Development 116,227
-237.[Abstract]
Ornitz, D. M. and Marie, P. J. (2002). FGF
signaling pathways in endochondral and intramembranous bone development and
human genetic disease. Genes Dev.
16,1446
-1465.
Poirier, F., Chan, C. T., Timmons, P. M., Robertson, E. J.,
Evans, M. J. and Rigby, P. W. (1991). The murine H19 gene is
activated during embryonic stem cell differentiation in vitro and at the time
of implantation in the developing embryo. Development
113,1105
-1114.[Abstract]
Senay, C., Lind, T., Muguruma, K., Tone, Y., Kitagawa, H.,
Sugahara, K., Lidholt, K., Lindahl, U. and Kusche-Gullberg, M.
(2000). The EXT1/EXT2 tumor suppressors: catalytic activities and
role in heparan sulfate biosynthesis. EMBO Rep.
1, 282-286.[CrossRef][Medline]
Shawlot, W. and Behringer, R. R. (1995).
Requirement for Lim1 in head-organizer function.
Nature 374,425
-430.[CrossRef][Medline]
Simeone, A., Acampora, D., Mallamaci, A., Stornaiuolo, A.,
D'Apice, M. R., Nigro, V. and Boncinelli, E. (1993). A
vertebrate gene related to orthodenticle contains a homeodomain of the bicoid
class and demarcates anterior neuroectoderm in the gastrulating mouse embryo.
EMBO J. 12,2735
-2747.[Medline]
Smith, D. E., Franco del Amo, F. and Gridley, T.
(1992). Isolation of Sna, a mouse gene homologous to the
Drosophila genes snail and escargot: its expression pattern suggests multiple
roles during postimplantation development. Development
116,1033
-1039.[Abstract]
Soegiarto, D. W., Kiachopoulos, S., Schipani, E., Juppner, H.,
Erben, R. G. and Lanske, B. (2001). Partial rescue of
PTH/PTHrP receptor knockout mice by targeted expression of the Jansen
transgene. Endocrinology
142,5303
-5310.
Solomon, L. (1963). Hereditary multiple
exostosis. J. Bone Joint Surg.
45,292
-304.
St-Jacques, B., Hammerschmidt, M. and McMahon, A. P.
(1999). Indian hedgehog signaling regulates proliferation and
differentiation of chondrocytes and is essential for bone formation.
Genes Dev. 13,2072
-2086.
Stickens, D., Clines, G., Burbee, D., Ramos, P., Thomas, S.,
Hogue, D., Hecht, J. T., Lovett, M. and Evans, G. A.
(1996). The EXT2 multiple exostoses gene defines a family of
putative tumour suppressor genes. Nat. Genet.
14, 25-32.[CrossRef][Medline]
Takei, Y., Ozawa, Y., Sato, M., Watanabe, A. and Tabata, T.
(2004). Three Drosophila EXT genes shape morphogen gradients
through synthesis of heparan sulfate proteoglycans.
Development 131,73
-82.
Tanaka, S., Kunath, T., Hadjantonakis, A. K., Nagy, A. and
Rossant, J. (1998). Promotion of trophoblast stem cell
proliferation by FGF4. Science
282,2072
-2075.
Thomas, P. and Beddington, R. (1996). Anterior
primitive endoderm may be responsible for patterning the anterior neural plate
in the mouse embryo. Curr. Biol.
6,1487
-1496.[CrossRef][Medline]
Wei, G., Bai, X., Gabb, M. M., Bame, K. J., Koshy, T. I., Spear,
P. G. and Esko, J. D. (2000). Location of the
glucuronosyltransferase domain in the heparan sulfate copolymerase EXT1 by
analysis of Chinese hamster ovary cell mutants. J. Biol.
Chem. 275,27733
-27740.
Wilkinson, D. G., Bhatt, S. and Herrmann, B. G.
(1990). Expression pattern of the mouse T gene and its role in
mesoderm formation. Nature
343,657
-659.[CrossRef][Medline]
Winnier, G., Blessing, M., Labosky, P. A. and Hogan, B. L.
(1995). Bone morphogenetic protein-4 is required for mesoderm
formation and patterning in the mouse. Genes Dev.
9,2105
-2116.
Wu, Y., Heutink, P., De Vries, B. B. A., Sandkuijl, L. A., Van
den Ouweland, A. M. W., Niermeijer, M. F., Galjaard, H., Reyniers, E.,
Willems, P. J. and Halley, D. J. J. (1994). Assignment of a
second locus for multiple exostoses to the pericentromeric region of
chromosome 11. Hum. Mol. Genet.
3, 167-171.
Wuyts, W. and Van Hul, W. (2000). Molecular
basis of multiple exostoses: mutations in the EXT1 and EXT2 genes.
Hum. Mutat. 15,220
-227.[CrossRef][Medline]
Yoshikawa, Y., Fujimori, T., McMahon, A. P. and Takada, S.
(1997). Evidence that absence of Wnt-3a signaling promotes
neuralization instead of paraxial mesoderm development in the mouse.
Dev. Biol. 183,234
-242.[CrossRef][Medline]
Zak, B. M., Crawford, B. E. and Esko, J. D.
(2002). Hereditary multiple exostoses and heparan sulfate
polymerization. Biochim. Biophys. Acta
1573,346
-355.[Medline]
Zhao, G. Q. (2003). Consequences of knocking
out BMP signaling in the mouse. Genesis
35, 43-56.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
E. Elimova, R. Kisilevsky, and J. B. Ancsin Heparan sulfate promotes the aggregation of HDL-associated serum amyloid A: evidence for a proamyloidogenic histidine molecular switch FASEB J, October 1, 2009; 23(10): 3436 - 3448. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Sandell Multiple Hereditary Exostosis, EXT Genes, and Skeletal Development J. Bone Joint Surg. Am., July 1, 2009; 91(Supplement_4): 58 - 62. [Full Text] [PDF] |
||||
![]() |
S. Nadanaka and H. Kitagawa Heparan Sulphate Biosynthesis and Disease J. Biochem., July 1, 2008; 144(1): 7 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K. Deirmengian, N. M. Hebela, M. O'Connell, D. L. Glaser, E. M. Shore, and F. S. Kaplan Proximal Tibial Osteochondromas in Patients with Fibrodysplasia Ossificans Progressiva J. Bone Joint Surg. Am., February 1, 2008; 90(2): 366 - 374. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Busse, A. Feta, J. Presto, M. Wilen, M. Gronning, L. Kjellen, and M. Kusche-Gullberg Contribution of EXT1, EXT2, and EXTL3 to Heparan Sulfate Chain Elongation J. Biol. Chem., November 9, 2007; 282(45): 32802 - 32810. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kobayashi, H. Habuchi, K. Tamura, H. Ide, and K. Kimata Essential Role of Heparan Sulfate 2-O-Sulfotransferase in Chick Limb Bud Patterning and Development J. Biol. Chem., July 6, 2007; 282(27): 19589 - 19597. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Koyama, B. Young, M. Nagayama, Y. Shibukawa, M. Enomoto-Iwamoto, M. Iwamoto, Y. Maeda, B. Lanske, B. Song, R. Serra, et al. Conditional Kif3a ablation causes abnormal hedgehog signaling topography, growth plate dysfunction, and excessive bone and cartilage formation during mouse skeletogenesis Development, June 1, 2007; 134(11): 2159 - 2169. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Habuchi, N. Nagai, N. Sugaya, F. Atsumi, R. L. Stevens, and K. Kimata Mice Deficient in Heparan Sulfate 6-O-Sulfotransferase-1 Exhibit Defective Heparan Sulfate Biosynthesis, Abnormal Placentation, and Late Embryonic Lethality J. Biol. Chem., May 25, 2007; 282(21): 15578 - 15588. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Fuster, L. Wang, J. Castagnola, L. Sikora, K. Reddi, P. H.A. Lee, K. A. Radek, M. Schuksz, J. R. Bishop, R. L. Gallo, et al. Genetic alteration of endothelial heparan sulfate selectively inhibits tumor angiogenesis J. Cell Biol., May 7, 2007; 177(3): 539 - 549. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kitagawa, T. Izumikawa, S. Mizuguchi, K. Dejima, K. H. Nomura, N. Egusa, F. Taniguchi, J.-i. Tamura, K. Gengyo-Ando, S. Mitani, et al. Expression of rib-1, a Caenorhabditis elegans Homolog of the Human Tumor Suppressor EXT Genes, Is Indispensable for Heparan Sulfate Synthesis and Embryonic Morphogenesis J. Biol. Chem., March 16, 2007; 282(11): 8533 - 8544. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Voglmeir, R. Voglauer, and I. B. H. Wilson XT-II, the Second Isoform of Human Peptide-O-xylosyltransferase, Displays Enzymatic Activity J. Biol. Chem., March 2, 2007; 282(9): 5984 - 5990. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Lum, J. Tan, S. D. Rosen, and Z. Werb Gene Trap Disruption of the Mouse Heparan Sulfate 6-O-Endosulfatase Gene, Sulf2 Mol. Cell. Biol., January 15, 2007; 27(2): 678 - 688. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pan, A. Woodbury, J. D. Esko, K. Grobe, and X. Zhang Heparan sulfate biosynthetic gene Ndst1 is required for FGF signaling in early lens development Development, December 15, 2006; 133(24): 4933 - 4944. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. McDowell, B. A. Frazier, D. R. Studelska, K. Giljum, J. Chen, J. Liu, K. Yu, D. M. Ornitz, and L. Zhang Inhibition or Activation of Apert Syndrome FGFR2 (S252W) Signaling by Specific Glycosaminoglycans J. Biol. Chem., March 17, 2006; 281(11): 6924 - 6930. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Izumikawa, N. Egusa, F. Taniguchi, K. Sugahara, and H. Kitagawa Heparan Sulfate Polymerization in Drosophila J. Biol. Chem., January 27, 2006; 281(4): 1929 - 1934. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||