|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 October 2005
doi: 10.1242/dev.02096
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Molecular Medicine Program, Ottawa Health Research Institute and University of
Ottawa Eye Institute, 501 Smyth Road, Ottawa, Ontario K1H 8L6, Canada
2 Department of Biochemistry, Microbiology and Immunology, University of Ottawa,
451 Smyth Road, Ottawa, Ontario K1H 8M5, Canada
* Author for correspondence (e-mail: vwallace{at}ohri.ca)
Accepted 20 September 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Retina, Proliferation, Differentiation, CyclinD1, Hedgehog, Mouse
| Introduction |
|---|
|
|
|---|
A prevailing model of retinal development that reconciles the evidence that
RPC are multipotential with the temporal control of cell type production is
the competence model, whereby RPC progress irreversibly through a series of
competence states where their developmental potential is restricted
(Livesey and Cepko, 2001
).
Cell mixing experiments and the comparison of RPC development in different
environments indicate that cell-cycle exit and cell diversification are
intrinsically determined, at least for late born retinal cell types
(Belliveau et al., 2000
;
Cayouette et al., 2003
;
Watanabe and Raff, 1990
). Cell
ablation experiments, however, indicate a role for neuron-derived signals in
the regulation of these processes (Mu et
al., 2005
; Negishi et al.,
1982
; Reh, 1987
;
Waid and McLoon, 1998
). RGC
development and RPC proliferation, for example, appear to be controlled by
signalling from RGCs (Mu et al.,
2005
; Waid and McLoon,
1998
). Two candidate RGC-derived signalling molecules that may
mediate these effects are Shh and Gdf11
(Kim et al., 2005
;
Mu et al., 2005
;
Zhang and Yang, 2001
).
Hedgehog (Hh) proteins are extracellular signalling molecules that control
patterning and growth of a number of tissues in the developing embryo
(reviewed by Ingham and McMahon,
2001
). Hh signalling has been implicated in retinal development in
several vertebrate species (reviewed by
Amato et al., 2004
); however,
there is considerable controversy regarding its role in this context. In the
zebrafish retina, Shh signalling from RGCs is required for RGC development
(Neumann and Nuesslein-Volhard,
2000
), whereas in the chick retina Shh inhibits RGC development
(Zhang and Yang, 2001
).
Although Shh is a mitogen for perinatal RPC in rodent and chick
(Jensen and Wallace, 1997
;
Levine et al., 1997
;
Moshiri et al., 2005
), it is
not clear whether it functions as a mitogen in the embryonic retina.
Differences in the source of Hh signals (extra-retinal versus intra-retinal)
or temporal aspects of Hh signalling, could account for some of these
discrepancies or they could reflect species-specific functions for this
pathway in retinal development.
Shh is expressed in RGCs in the murine retina and we showed that
it is required for the maintenance of Hh target gene expression in RPC in vivo
and in retinal explants, and that treatment with recombinant Shh protein could
promote normal lamination in retina explants from perinatal mice
(Jensen and Wallace, 1997
;
Wang et al., 2002
). To examine
the requirement for intra-retinal Shh expression on RPC proliferation
and cell diversification in the mouse embryonic retina in vivo, we used the
Cre-loxp system to target inactivation of the Shh gene to the
peripheral retina. Reduced Shh signalling is associated with precocious
cell-cycle exit during embryogenesis and a depletion of the RPC pool. These
changes are associated with a reduction in the expression of cyclin D1 and
Hes1, a negative regulator of differentiation, in RPC. The failure to
maintain RPC in cycle has profound consequences on histogenesis, as
differentiation of photoreceptors is accelerated and the production of late
born cell types, such as bipolar and Müller glia is reduced. In addition,
RGCs are overproduced in the peripheral retinas of the mutant mice because of
a sustained RPC bias towards RGC development. Thus, RGC-Shh signalling plays a
pivotal role in regulation of RPC proliferation, as well as the timing of RGC
development during embryonic retinal development.
| Materials and methods |
|---|
|
|
|---|
-Cre transgenic mice were obtained from P. Gruss
(Marquardt et al., 2001
-Cre;Shh+/ mice were
crossed to Shhc/c mice to generate
-Cre;Shh/c mice and were compared with
-Cre;Shh+/c littermates (referred to as wild type).
Genotyping for the
-Cre transgene, Shh null and
conditional alleles was performed by the PCR. To label cells in S phase in
vivo, time-mated females were given two intraperitoneal injections 2 hours
apart of BrdU at 0.1 mg/g body weight. Tissues were processed for
immunohistochemistry (see below) or in situ hybridization with
digoxigenin-labelled antisense riboprobes, as previously described
(Dakubo et al., 2003
Cell culture and immunohistochemistry
Embryonic retinal tissues were obtained from time mated C57Bl/6 mice, the
day of the vaginal plug was taken as day 0 of the pregnancy. Neural retinas
were dissected in MEM-HEPES (ICN) and cultured on 13 mm polycarbonate filters
(0.8 µm pore size, Nucleopore) (perinatal retinal explants) or submerged
(E12 explants) in 24-well plates in 1 ml of serum-free culture medium [1:1
DMEM-F12, supplemented with insulin (10 µg/ml), transferrin (100 mg/ml),
bovine serum albumin (BSA Fraction V: 100 mg/ml), progesterone (60 ng/ml),
putrescine (16 µg/ml), sodium selenite (40 ng/ml) and gentamycin (25
µg/ml)]. The cultures were supplemented with recombinant myristoylated
N-terminal fragment of Shh (Shh-N) at 2 µg/ml or Smoothened agonist (Hh
agonist) at 10 nM (Frank-Kamenetsky et
al., 2002
) (kind gifts from Curis), bFGF (50 ng/ml, Sigma), EGF
(100 ng/ml, Sigma) or purified anti-Hh [5E1
(Ericson et al., 1996
)] and
anti-LFA-3 (1E6) monoclonal antibodies at 30 µg/ml. The dose of growth
factors was determined to be optimal for RPC proliferation in vitro (data not
shown) and the medium and growth factors were refreshed every 3 days. To label
progenitor cells, explants were incubated in [3H]thymidine for 4
hours and audioradiographic analysis was performed as previously described
(Jensen and Wallace, 1997
). In
some experiments, BrdU (10 µM) was added for the last 6 hours of the
culture. At the end of the culture period, explants were dissociated into
single cells with trypsin or fixed in 4% paraformaldehyde in 0.1 M phosphate
buffer pH 7.4, cryoprotected in 30% sucrose/PBS, cut in half and sectioned
from the middle of the explant at 8 µm. Immunohistochemistry was performed,
as described previously (Jensen and
Wallace, 1997
), with the following antibodies: goat polyclonal
anti-Brn3b (Pou4f2 Mouse Genome Informatics) (Santa Cruz
Biotechnology, Santa Cruz, California, USA), rabbit polyclonal anti-CRALBP (a
gift from J. Saari), anti-cone arrestin [LUMIj
(Zhu et al., 2002
), a gift
from C. Craft and X. Zhu] and mouse monoclonal anti-rhodopsin [B630
(Rohlich et al., 1989
)],
anti-syntaxin (Sigma), anti-PKC (Pharmingen) and anti-BrdU (Becton Dickinson).
Sections were analyzed on a Zeiss Axioplan microscope and digital images were
captured using an AxioVision 2.05 (Zeiss) camera and processed with
Adobe® Photoshop. To quantify cell types in mutant and
wild-type retinas, the number of marker+ cells in 300 µm (100
µm for E14) regions adjacent to the optic nerve and in the peripheral
retina was counted. The cell counts in the peripheral region of the
a-Cre;Shh/c retina corresponded to the region where
Gli1 expression was downregulated and the RGC layer was thicker.
After P6, the cell counts from the peripheral
-Cre;Shh/c retina were based on counting
cells in a 300 µm region proximal to the site of degenerative changes in
the outer nuclear layer. Cell counts were performed on at least three sections
at the level of the optic nerve head/mouse and, for most analyses, from three
mice/genotype. Data are presented as mean±s.d. and data sets were
compared with the Student's t-test. All P-values are based
on two-sided hypothesis testing.
RT-PCR analysis
RNA from pools of three explants per condition was isolated using Trizol
reagent (Sigma) and 2 µg of total RNA was reverse transcribed in a total
volume of 40 µl. Equal amounts of first strand cDNA were then amplified
using primer pairs specific for the following genes: Gli1F,
ggcgtctcagggaaggatgag; Gli1R, ggcgtctcagggaaggatgag; Hes1F,
cagccagtgtcaacacgacac; Hes1R, tcgttcatgcactcgctgaag; Hes 5F,
cgcatcaacagcagcatagag; Hes5R, tggaagtggtaaagcagcttc; GAPDHF,
caacgaccccttcattgacctc; GAPDHR, atccacgacggacacattgg; Ptc2F,
ggtctccgagtggctgtaat; Ptc2R, ccaggttggtccactggata. The cycling parameters used
were as follows: 94°C for 30 seconds; 58°C for 30 seconds; 72°C 45
seconds (Gapdh, Gli1, Hes5); 94°C for 30 seconds; 55°C for 30
seconds; 72°C for 45 seconds (Ptc2); 94°C for 30 seconds;
53°C for 30 seconds; 72°C for 45 seconds (Hes1) for 20-31
cycles. For semi-quantitative RT-PCR, 0.3 µl of 32P-dATP was
added to each reaction and PCR products were run on a native polyacrylamide
gel electrophoresis gel, which was then dried and exposed to film. The number
of cycles required to achieve linear amplification of PCR products was
determined for each primer pair.
| Results |
|---|
|
|
|---|
The local induction of Gli1 expression in the neuroblast layer by
Shh-expressing RGCs indicated that these first-born neurons are
imparting patterning information to the cells in the adjacent neuroblast
layer. To address the functional significance of this cell-cell interaction,
we generated mice with a retina-restricted conditional ablation of the
Shh gene by crossing
-Cre transgenic mice with Shh
conditional mutant mice to generate
-Cre;Shh/c mice (see Materials and methods).
Beginning at E10, Cre activity in
-Cre mice is restricted
primarily to RPC, RGCs and amacrine cells in the peripheral retina, although
there is a low level of Cre activity in the central retina
(Marquardt et al., 2001
) (see
Fig. S1A in the supplementary material). Inactivation of the Shh gene
in the peripheral retina of
-Cre;Shh/c mice
would, therefore, be expected to result in a loss of Hh target gene expression
in this region. Consistent with this prediction, Gli1 expression was
downregulated in the peripheral retina of
-Cre;Shh/c mice at E14 and P0
(Fig. 2A-D). Thus, based on the
absence of Gli1 expression, Hh pathway activation is reduced in the
peripheral retina of
-Cre;Shh/c mice from
E10 onwards. For simplicity, we will refer to the
Gli1 region of the retina as the region where the
Shh gene has been inactivated.
|
-Cre;Shh/c mutants at E14
(Fig. 2M, see Fig. S1B,C in the
supplementary material). TUNEL staining at several stages during embryogenesis
did not reveal any appreciable differences in cell death in the
-Cre;Shh/c retina (data not shown),
indicating that the reduction in proliferation was not secondary to changes in
cell survival. Several lines of evidence indicated that the reduction of
proliferation in the
-Cre;Shh/c mice was due
to precocious cell-cycle exit. We performed birth-dating analyses at E13 by
injecting BrdU and quantifying the number of heavily labelled cells in the
peripheral retina at P0. The heavily labelled cells were those that exited the
cell-cycle shortly after the BrdU pulse; cells that continued to divide
following the BrdU pulse would be expected to be lightly labelled or
unlabelled. We observed a greater than 1.5-fold increase in the number of
heavily labelled cells in the peripheral retinas of
-Cre;Shh/c mice compared with wild-type mice
(Fig. 2N). Tuj1 staining of
dissociated cells from the entire retina revealed that the proportion of
differentiated neurons was increased in the retinas of
-Cre;Shh/c mice at E14 compared with
wild-type (% Tuj1+ cells: wild type, 32.0±2.0; mutant
38.6±2.0; P<0.005). By P0, the RPC pool was reduced in size
in the
-Cre;Shh/c retina, as indicated by a
thinner domain of Rax expression, a RPC marker, in the peripheral
retina (Fig. 2, compare K with
L), a reduction in the proportion of S-phase cells (%
BrdU+ cells: wild type, 22.5±2.3; mutant, 15.4±0.7;
P<0.005) (see Fig. S1D,E in the supplementary material) and in
total cell number (wild type 3.4x106±0.7; mutant
2.3x106±0.1; P<0.05).
Hh signalling upregulates the expression of Mycn and D-type cyclins in a
number of tissues, and cyclin D1 expression is required for RPC proliferation
(Duman-Scheel et al., 2002
;
Kenney et al., 2003
;
Sicinski et al., 1995
). To
investigate the mechanism of the proliferative defect caused by the lack of
Shh signalling, we examined the expression of these genes in the
-Cre;Shh/c retina. Cyclin D1 expression was
markedly downregulated in the peripheral retina of
-Cre;Shh/c mice at E14 and P0 compared with
wild-type retinas (Fig. 2E-H).
Mycn mRNA levels, however, were not different in the
-Cre;Shh/c retinas compared with controls
and the levels of Mycn, Rlf (previously L-Myc) and Myc were
not changed in Shh-treated retinal explants compared with controls (see Fig.
S4 in the supplementary material; data not shown).
|
-Cre;Shh/c mice. RGCs differentiated in the
peripheral region of the
-Cre;Shh/c retina,
as indicated by the presence of Brn3b+ cells and the induction of
Shh expression (from the mutant allele) in the RGC layer
(Fig. 3A,C; data not shown).
However, the RGC layer in peripheral region of the
-Cre;Shh/c retina was thicker, disorganized
and contained more RGCs (Fig.
3A,C,E). These RGC abnormalities were restricted to the peripheral
region of the retina where Gli1 expression is downregulated, as RGC
number and organization were normal in the central retina of
-Cre;Shh/c mice
(Fig. 3E; data not shown).
In the chick, increased Shh signalling was associated with reduced cell
survival in the RGC layer (Spence et al.,
2004
). We did not observe a change in cell survival in the
-Cre;Shh/c retina or in Shh-treated retinal
explants and RGC development was initiated at the normal time in mutant and
wild-type retinas, as judged by the pattern of Brn3b staining at E12 (data not
shown). Thus, the increase in RGC number in the mutant retina was probably due
to an overproduction of these cells during the period when RGCs are normally
produced. To further test this conclusion, we examined the development of RGCs
in vivo. RPC undergo mitosis and cytokinesis at the apical side of the retina
neuroepithelium, and postmitotic RGCs differentiate immediately and express
Brn3b as they migrate away from the apical surface towards the RGC layer
(Xiang, 1998
). To identify
newly generated RGCs, we labelled RPC at E16 with BrdU, harvested the retinas
24 hours later, and stained frozen sections for Brn3b and BrdU. Cells in the
neuroblast layer that stain for both markers must have exited the cell-cycle
after incorporating BrdU and initiated RGC differentiation. We found that
there was an increase in newly generated RGCs in the neuroblast layer in the
peripheral retinas of the
-Cre;Shh/c mice
compared with wild-type littermates (Fig.
3A-D).
|
-Cre;Shh/c mice compared with wild-type
retinas and this increase was not observed in the central retina, indicating
the localized effect of Shh inactivation on RGC development
(Fig. 3F, see Fig. S2A in the
supplementary material). The lack of Shh signalling did not extend the period
of RGC development, as we did not observe a persistence of Brn3b+
cells in the neuroblast layer of
-Cre;Shh/c
mice at P0, which corresponds to the end of the normal period of RGC
development (data not shown).
To determine whether Shh inactivation affected the development of
other early-born cells types, such as cones, amacrine cells and horizontal
cells, we injected BrdU at E13 and compared the distribution of heavily
labelled cells in the retina of P0 mice, assigning the cells to one of three
layers: the outer region of the outer nuclear layer (ONL) (presumptive cone
photoreceptors); the inner region of the inner nuclear layer (INL)
(presumptive amacrine cells); or the RGC layer (RGCs and displaced amacrine
cells). In the peripheral retina, the proportion of heavily labelled cells was
increased in the RGC layer, reduced in the inner neuroblast layer and
unchanged in the outer neuroblast layer of
-Cre;Shh/c mice compared with wild-type mice
(see Fig. S2B in the supplementary material). Moreover, the proportion of RGCs
among the heavily labelled cohort at E13 was increased in the peripheral
retina of
-Cre;Shh/c mice compared with
wild-type mice (Fig. 3G). Taken
together, these data suggest that, in the absence of Shh signalling, there is
a bias towards the production of RGCs at the expense of cells destined for the
inner nuclear layer, presumably mostly amacrine cells.
Shh signalling inhibits RGC development in explants
The disproportionate increase in RGC development at E13 in the
-Cre;Shh/c mutant suggested that Shh might
also antagonize RGC development. To test this suggestion, we asked whether
short exposure to Shh signalling in retinal explants would inhibit RGC
development. We treated explants from E12 wild-type mice, a stage in
development when RGC development is maximal, with either recombinant
N-terminal fragment of Shh (Shh-N) or anti-Hh antibodies, for 48 hours. RGCs
normally die by apoptosis within 24-48 hours of culture in explants, but,
because they differentiate rapidly following terminal mitosis, we could follow
the development of newly formed RGCs by limiting the culture time to 48 hours.
To ensure that we were following newly differentiated RGCs, we labelled RPC
with [3H]thymidine at the beginning of the culture and quantified
the proportion of RGCs among the labelled cohort. Shh-N treatment reduced RGC
development in the explant cultures, whereas anti-Hh treatment had the
opposite effect (Fig. 4A-E).
Shh-N-treatment also increased the proportion of dividing cells in the
explants, which raised the possibility that it decreased RGC development by
delaying RPC cell-cycle exit (Fig.
4F). We reasoned that, if this were the case, then the
differentiation of other cell types would also be reduced in Shh-N-treated
explants. To test this possibility, we stained dissociated cells from explants
with Tuj1, an anti-ßIII-tubulin antibody, which detects both RGCs and
amacrine cells, another cell type that is generated at this stage of retinal
development. The proportion of amacrine cells
(Tuj1+-Brn3b+) was not significantly different in the
Shh-N or anti-Hh treated explants (Fig.
4F), indicating that the effect of increased Shh signalling was
specific to RGCs, at least at this stage. Finally, treatment with other RPC
mitogens, Egf and basic Fgf, did not reduce RGC development in explants (data
not shown).
|
-Cre;Shh/c retina at P3, but not in
wild-type retinas (Fig. 5A,B;
data not shown). The number of photoreceptors was also increased in the
peripheral retina of
-Cre;Shh/c mice at P1
(rods) and P6 (cones), and these cells appeared to be more differentiated in
the mutant compared with the control retinas, based on the increased intensity
of cone-arrestin and rhodopsin staining
(Fig. 5C-E; data not shown). As
we did not observe an increase in the number of birth-dated photoreceptors at
E13 (Fig. S2B), the increase in photoreceptors in the perinatal
-Cre;Shh/c retina probably reflects an
acceleration of their differentiation program, rather than an increase in
their production.
We encountered two problems when we attempted to quantify late born cell
types, such as Muller glia and bipolar cells, in the
-Cre;Shh/c retina. First, the markers for
these cells are not expressed until late in the postnatal period, and, at this
stage, we could not rely on the absence of Gli1 expression to
delineate the mutant region of the retina, as Gli1 expression is
downregulated at this stage. Second, at late stages of development, there were
considerable degenerative changes in the peripheral retina of
-Cre;Shh/c mice, especially in the nasal
quadrant, which made quantification unreliable
(Fig. 5H,L; data not shown).
For these reasons, we adopted a different counting strategy for the late
peripheral retina by comparing cell counts in a region 300 µm proximal to
the start of degeneration. The numbers of Müller cells
(CRALBP+) and bipolar cells (PKC+) were reduced in the
peripheral region of the
-Cre;Shh/c retina
compared with wild-type mice (Fig.
5E). We also counted the total cell number in a 100 µm region
of the central and peripheral retina and calculated the proportion of cells in
the different layers (Fig. 5F).
The proportion of INL cells was reduced in the peripheral retina of the
-Cre;Shh/c mice
(Fig. 5F), indicating that
Müller and bipolar cells are also reduced as a proportion. The reduction
in Müller cells in the central retina probably reflects a partial
reduction in Shh signalling in this region, as we have noted a low level of
Cre activity in the central region of the
-Cre retina and a
reduction in the intensity of Gli1 expression in the central region
of some
-Cre;Shh/c mice (data not shown). As
it is possible that our counting strategy for the peripheral retina at these
late stages could have included Shh+ regions of the retina, we also
examined the development of these cell types in the peripheral-most
degenerating regions of the retina. Whereas Müller cells were present in
these regions, bipolar cells were almost completely absent; the few that were
present were severely disorganized (Fig. 5,
compare I with J).
As early as P1, the peripheral nasal retina of
-Cre;Shh/c mice exhibited abnormalities in
the outer nuclear layer, which included photoreceptor rosettes and gaps in
rhodopsin staining that were readily apparent by P6
(Fig. 5K-P; data not shown).
Staining with anti-CRALBP antibodies revealed that these gaps contained cells
from the INL, including Müller glia
(Fig. 5P). Ultimately, the
degeneration progressed to the point where the entire outer nuclear layer was
lost and the remaining inner and RGC layers were markedly disorganized (data
not shown).
Ectopic Hh pathway activation restores bipolar cell development in
-Cre;Shh/c retinas
The defects in late cell development and degeneration that we observed in
the
-Cre;Shh/c perinatal stages could be
indirect consequences of Shh inactivation during embryogenesis. We
found, however, that blockade of Hh signalling in perinatal retinal explants
and reaggregate cultures reduced BrdU incorporation and the proportions of
Müller glia and bipolar cells (see Fig. S3 in the supplementary
material), suggesting that sustained Hh pathway activation is required at late
stages for RPC proliferation and the development of late born cell types. To
explore this possibility further, we determined whether Hh pathway activation
could restore proliferation and the development of late born cell types in
peripheral regions of the postnatal
-Cre;Shh/c retina. We treated retinal
explants from P1 mutant and wild-type mice with a Hh agonist and examined the
expression of cell-cycle genes, Hh target genes and RPC markers, after 2 days,
and late cell type markers after 9 days. Treatment with the Hh agonist
increased the expression of Gli1, cyclin D1 and Chx10 in
peripheral regions of retinal explants from
-Cre;Shh/c and wild-type mice
(Fig. 6A-L). Treatment with the
Hh agonist also increased the development of Muller glia and bipolar cells in
the peripheral regions of explants from
-Cre;Shh/c and control mice
(Fig. 6M-T). Hh agonist
treatment at this stage appeared to be more specific for promoting Müller
and bipolar cell development, as it had little effect amacrine cell
development (Fig. 6U-X). The
restoration of proliferation and late cell type development appeared to be
specific to Hh pathway activation, as EGF and bFGF, two other RPC mitogens,
had no effect on cyclin D1 expression and bipolar cell development (see Fig.
S4 in the supplementary material).
|
-Cre;Shh/c retina was similar to the
retinal phenotype of Hes1/mice
(Takatsuka et al., 2004
-Cre;Shh/c retina at P0 and found that
Hes1 expression was reduced in the peripheral retina at these ages
compared with control retinas (Fig.
7A,B). To determine whether altering the level of Hh signalling in
retinal explants could affect Hes gene expression, we performed
semi-quantitative RT-PCR analysis on E18 retinal explants that were cultured
in the presence of Shh-N, anti-Hh antibodies or control conditions
(Fig. 7C). Consistent with our
previous published observations, the expression of Gli1 and
Ptch2, Hh target genes, is downregulated in control explants because
of the rapid loss of RGC in these cultures
(Fig. 7C). Hes1 and
Hes5 expression was reduced in control and anti-Hh-treated explants
at 1 and 3 days compared with the levels in the E18 retina
(Fig. 7C), and treatment with
Shh-N restored Hes gene expression in explants. This effect appeared to be
specific to Hh signalling, as EGF treatment had little effect on Hes1 and Hes5
expression (Fig. 7C).
|
| Discussion |
|---|
|
|
|---|
3 weeks) in mouse.
Thus, in the zebrafish retina, the need to induce cell cycle exit from a pool
of rapidly dividing progenitors might take precedence over the need to
maintain those cells in cycle, whereas in the mouse retina, the opposite might
be the case, where maintenance of proliferation takes precedence over cell
cycle exit.
|
The effects of Shh on proliferation are probably mediated, in part, through
cyclin D1 and Hes1. The retinas of cyclin D1, Hes1 and
-Cre;Shh/c mutant mice exhibit a remarkable
degree of phenotypic similarity that includes reduced proliferation and
retinal degeneration (cyclin D1) (Ma et
al., 1998
; Sicinski et al.,
1995
), RGC overproduction and accelerated photoreceptor
differentiation (Hes1) (Takatsuka
et al., 2004
; Tomita et al.,
1996
) and we show here that Hh signalling modulates the expression
of these genes in RPC. Shh-induced proliferation in the hair follicle and
cerebellum is driven by Gli1-dependent transcription control of cyclin D1 and
Mycn and stabilization of Mycn protein
(Kenney et al., 2004
;
Mill et al., 2005
). By
contrast, Myc genes do not appear to be transcriptional targets of Hh
signalling in the retina; however, it remains to be seen whether Hh signalling
is required for stabilization of Myc protein in RPC. Hh signalling promotes
Hes1 expression in cerebellar granule neuron precursors
(Solecki et al., 2001
) and
this has been shown to be Notch dependent in granule neuron-derived tumours
(Hallahan et al., 2004
). The
reduction in Hes1 expression in the
-Cre;Shh/c retina is, however, not
associated with a change in the expression of Notch receptors, Notch ligands
or the Notch effector protein RBPJ
(data not shown).
Shh signalling and effects on cell diversification and retinal degeneration
The loss of Shh signalling in vivo is associated with increased RGC
production and decreased late-born cell type production, such as Müller
glia and bipolar cells. Given the proliferation defects in the
-Cre;Shh/c retina, the simplest
interpretation of these findings is that as more RPC exit the cell cycle
precociously, they adopt the fate that is appropriate for their stage of
retinal development, in this case, RGCs; precocious cell-cycle exit also
depletes the RPC pool so that too few RPC remain to produce appropriate
numbers of late-born cell types. This interpretation is consistent with other
studies in which forced cell-cycle exit and premature differentiation of RPC
results in an increase in RGC development
(Austin et al., 1995
;
Ohnuma et al., 2002
;
Takatsuka et al., 2004
) and
with our evidence that ectopic Hh signalling can restore cell-cycle gene
expression and Müller, and bipolar cell development in explants from
-Cre;Shh/c mice. Alternatively, these late
cell types may develop from a Hh-dependent RPC pool, which would be consistent
with our observation that EGF and bFGF do not elicit a significant
proliferative response or promote bipolar cell development in perinatal
retinal explants.
Previously, we have shown that maintenance of Shh signalling in retinal
explants promoted the development of normal lamination
(Wang et al., 2002
). In this
study, we were able to follow the mutant retinas until adulthood and showed
that Shh inactivation is associated with retinal degeneration.
Because of the timing of Shh inactivation in this system it is
possible that these degenerative changes could be indirect. However, blockade
of Hh signalling in perinatal retinal explants results in severe lamination
defects (Wang et al., 2002
)
(data not shown), consistent with a role for Shh signalling at late stages of
retinal development for normal retinal organization.
Shh and timing of RPC competence to generate RGCs
Several lines of evidence indicate that some of the effect of Shh on RGC
development is cell cycle independent. The birthdating analyses presented in
this study indicate that RPC in the peripheral region of the
-Cre;Shh/c retina are biased towards RGC
production at the expense of amacrine cells, which are normally generated at
the same time. If all of the effects of Shh signalling were mediated through
the cell cycle, we would have expected that the proportions of early born cell
types would remain the same among the birthdated cohort. Hh-mediated
inhibition of RGC development in the chick retina is not associated with
increased RPC proliferation (Zhang and
Yang, 2001
), and we have found that as little as 4 hours of Shh
treatment inhibits RGC development in mouse retinal explants (data not shown).
Given that RGC production remains increased in the peripheral retina of
-Cre;Shh/c mice at E16, we suggest that Shh
signalling is required to control the timing of RPC competence to generate
RGCs. Gdf11 is also expressed in RGCs and is a negative regulator of RGC
development, as evidenced by an overproduction of RGC at the expense of
amacrine cells and photoreceptors in the retinas of
Gdf11/ mice
(Kim et al., 2005
). In
contrast to our findings in the
-Cre;Shh/c
mouse, loss of Gdf11 does not affect RPC proliferation and increases RGC
development at later stages (Kim et al.,
2005
). Thus, Shh signalling might act at an earlier stage to
control progenitor competence to generate RGCs, which is consistent with our
observation that its expression is delayed until after Brn3b+ cells
have completed their migration to the RGC layer; earlier induction of
Shh expression might result in insufficient RGC production. The
alterations in RPC competence in the Gdf11/
retina were associated with prolonged expression of Math5, a bHLH
transcription factor that is required for RGC production
(Brown et al., 2001
;
Wang et al., 2001
), and
changes in the timing of expression of other bHLH genes, such as
Mash1 (Ascl1 Mouse Genome Informatics) and
Neurod1 (Kim et al.,
2005
). Consistent with these observations, Math5
expression is marginally increased in the
-Cre;Shh/c retina (data not shown).
Similarity with mutants lacking RGCs
This study highlights the important role for a RGC-derived signal on
retinal histogenesis and several aspects of
-Cre;Shh/c retinal phenotype are similar to
other RGC-deficient mouse mutants. In Math5 mutant mice, for example,
the retina and, in particular, the INL are reduced in thickness and bipolar
cells are reduced in number (Brown et al.,
2001
; Brzezinski et al.,
2005
; Wang et al.,
2001
). In another mouse model in which RGCs are selectively
ablated by targeted expression of diphtheria toxin (Brn3b-DTA), RPC
proliferation is reduced and this effect was associated with a reduction in
Shh, Gli1 and cyclin D1 expression
(Mu et al., 2005
), which is in
good agreement with the findings presented here. Despite the reduction in Shh
signalling in the Brn3b-DTA mouse model, however, the proportion of
late-born cell types is normal and the retina does not degenerate
(Mu et al., 2005
). A major
difference between the
-Cre;Shh/c and
Brn3b-DTA models is the presence of RGCs in the former, which raises
the possibility that some of the retinal phenotype in the
-Cre;Shh/c mouse could be due to unmasking
the effects of other RGC-derived signals, such as myostatin/Gdf8
(Mu et al., 2004
).
Alternatively, differences in these retinal phenotypes could be due to
imbalances created by the juxtaposition of mutant and wild-type tissue in the
-Cre;Shh/c retina.
Our results highlight a crucial role for Shh signalling in the local control of RPC proliferation and differentiation by RGCs. RGC-derived Shh signalling acts to maintain RPC proliferation, and thereby helps to establish the proper balance between the production of early and late retinal cell types. In this way, RGCs help control the synaptic input they receive.
We thank Drs A. Joyner, R. Kageyama, A. McMahon, J. Saari, R. Evans, G. Weinmaster, C. Cepko and P. Gruss for antibodies, probes and transgenic mice; D. Chen for Myc gene analysis; Drs N. Brown and T. Glaser for helpful discussion; and Drs R. Bremner and M. Raff for critical reading of the manuscript. Recombinant Shh-N and the Hedgehog agonist were kind gifts from Curis and the anti-cone arrestin antibody was a kind gift from Drs C. Craft and X. Zhu. This work was supported by funding from the National Cancer Institute of Canada, Canadian Institutes of Health Research and the Stem Cell Network of Canada. G.D.D. is a recipient of an M. S. Society Postdoctoral Fellowship and V.A.W. is the recipient of a CIHR New Investigator Award.
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/22/5103/DC1
| REFERENCES |
|---|
|
|
|---|
Amato, M. A., Boy, S. and Perron, M. (2004). Hedgehog signaling in vertebrate eye development: a growing puzzle. Cell Mol. Life Sci. 61,899 -910.[CrossRef][Medline]
Austin, C. P., Feldman, D. E., Ida, J. A. and Cepko, C. L. (1995). Vertebrate retinal ganglion cells are selected from competent progenitors by the action of Notch. Development 121,3637 -3650.[Abstract]
Belliveau, M. J., Young, T. L. and Cepko, C. L.
(2000). Late retinal progenitor cells show intrinsic limitations
in the production of cell types and the kinetics of opsin synthesis.
J. Neurosci. 20,2247
-2254.
Brown, N. L., Patel, S., Brzezinski, J. and Glaser, T.
(2001). Math5 is required for retinal ganglion cell and optic
nerve formation. Development
128,2497
-2508.
Brzezinski, J. A. T., Brown, N. L., Tanikawa, A., Bush, R. A.,
Sieving, P. A., Vitaterna, M. H., Takahashi, J. S. and Glaser, T.
(2005). Loss of circadian photoentrainment and abnormal retinal
electrophysiology in Math5 mutant mice. Invest. Ophthalmol. Vis.
Sci. 46,2540
-2551.
Cayouette, M., Barres, B. A. and Raff, M. (2003). Importance of intrinsic mechanisms in cell fate decisions in the developing rat retina. Neuron 40,897 -904.[CrossRef][Medline]
Dakubo, G. D., Wang, Y. P., Mazerolle, C., Campsall, K.,
McMahon, A. P. and Wallace, V. A. (2003). Retinal ganglion
cell-derived sonic hedgehog signaling is required for optic disc and stalk
neuroepithelial cell development. Development
130,2967
-2980.
Duman-Scheel, M., Weng, L., Xin, S. and Du, W. (2002). Hedgehog regulates cell growth and proliferation by inducing Cyclin D and Cyclin E. Nature 417,299 -304.[CrossRef][Medline]
Dyer, M. A. and Cepko, C. L. (2001). Regulating proliferation during retinal development. Nat. Rev. Neurosci. 2,333 -342.[Medline]
Ericson, J., Morton, S., Kawakami, A., Roelink, H. and Jessell, T. M. (1996). Two critical periods of Sonic Hedgehog signaling required for the specification of motor neuron identity. Cell 87,661 -673.[CrossRef][Medline]
Frank-Kamenetsky, M., Zhang, X. M., Bottega, S., Guicherit, O., Wichterle, H., Dudek, H., Bumcrot, D., Wang, F. Y., Jones, S., Shulok, J. et al. (2002). Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists. J. Biol. 1, 10.[CrossRef][Medline]
Goodrich, L. V. and Scott, M. P. (1998). Hedgehog and patched in neural development and disease. Neuron 21,1243 -1257.[CrossRef][Medline]
Hallahan, A. R., Pritchard, J. I., Hansen, S., Benson, M.,
Stoeck, J., Hatton, B. A., Russell, T. L., Ellenbogen, R. G.,
Bernstein, I. D., Beachy, P. A. et al. (2004). The SmoA1
mouse model reveals that notch signaling is critical for the growth and
survival of sonic hedgehog-induced medulloblastomas. Cancer
Res. 64,7794
-7800.
Holt, C. E., Bertsch, T. W., Ellis, H. M. and Harris, W. A. (1988). Cellular determination in the xenopus retina is independent of lineage and birth date. Neuron 1, 15-26.[CrossRef][Medline]
Ingham, P. W. and McMahon, A. P. (2001).
Hedgehog signaling in animal development: paradigms and principles.
Genes Dev. 15,3059
-3087.
Jensen, A. M. and Wallace, V. A. (1997). Expression of Sonic hedgehog and its putative role as a precursor cell mitogen in the developing mouse retina. Development 124,363 -371.[Abstract]
Kenney, A. M., Cole, M. D. and Rowitch, D. H.
(2003). Nmyc upregulation by sonic hedgehog signaling promotes
proliferation in developing cerebellar granule neuron precursors.
Development 130,15
-28.
Kenney, A. M., Widlund, H. R. and Rowitch, D. H.
(2004). Hedgehog and PI-3 kinase signaling converge on Nmyc1 to
promote cell cycle progression in cerebellar neuronal precursors.
Development 131,217
-228.
Kim, J., Wu, H. H., Lander, A. D., Lyons, K. M., Matzuk, M. M.
and Calof, A. L. (2005). GDF11 controls the timing of
progenitor cell competence in developing retina.
Science 308,1927
-1930.
Levine, E. M., Roelink, H., Turner, J. and Reh, T. A.
(1997). Sonic hedgehog promotes rod photoreceptor differentiation
in mammalian retinal cells in vitro. J. Neurosci.
17,6277
-6288.
Lewis, P. M., Dunn, M. P., McMahon, J. A., Logan, M., Martin, J. F., St-Jacques, B. and McMahon, A. P. (2001). Cholesterol modification of sonic hedgehog is required for long-range signaling activity and effective modulation of signaling by Ptc1. Cell 105,599 -612.[CrossRef][Medline]
Livesey, F. J. and Cepko, C. L. (2001). Vertebrate neural cell-fate determination: lessons from the retina. Nat. Rev. Neurosci. 2,109 -118.[CrossRef][Medline]
Ma, C., Papermaster, D. and Cepko, C. L.
(1998). A unique pattern of photoreceptor degeneration in cyclin
D1 mutant mice. Proc. Natl. Acad. Sci. USA
95,9938
-9943.
Marquardt, T., Ashery-Padan, R., Andrejewski, N., Scardigli, R., Guillemot, F. and Gruss, P. (2001). Pax6 is required for the multipotent state of retinal progenitor cells. Cell 105,43 -55.[CrossRef][Medline]
Mill, P., Mo, R., Hu, M. C., Dagnino, L., Rosenblum, N. D. and Hui, C. C. (2005). Shh Controls Epithelial Proliferation via Independent Pathways that Converge on N-Myc. Dev. Cell 9, 293-303.[CrossRef][Medline]
Moshiri, A., McGuire, C. R. and Reh, T. A. (2005). Sonic hedgehog regulates proliferation of the retinal ciliary marginal zone in posthatch chicks. Dev. Dyn. 233, 66-75.[CrossRef][Medline]
Mu, X., Beremand, P. D., Zhao, S., Pershad, R., Sun, H., Scarpa,
A., Liang, S., Thomas, T. L. and Klein, W. H. (2004).
Discrete gene sets depend on POU domain transcription factor
Brn3b/Brn-3.2/POU4f2 for their expression in the mouse embryonic retina.
Development 131,1197
-1210.
Mu, X., Fu, X., Sun, H., Liang, S., Maeda, H., Frishman, L. J. and Klein, W. H. (2005). Ganglion cells are required for normal progenitor-cell proliferation but not cell-fate determination or patterning in the developing mouse retina. Curr. Biol. 15,525 -530.[CrossRef][Medline]
Negishi, K., Teranishi, T. and Kato, S. (1982).
New dopaminergic and indoleamine-accumulating cells in the growth zone of
goldfish retinas after neurotoxic destruction. Science
216,747
-749.
Neumann, C. J. and Nuesslein-Volhard, C.
(2000). Patterning of the zebrafish retina by a wave of sonic
hedgehog activity. Science
289,2137
-2139.
Ohnuma, S., Hopper, S., Wang, K. C., Philpott, A. and Harris, W. A. (2002). Co-ordinating retinal histogenesis: early cell cycle exit enhances early cell fate determination in the Xenopus retina. Development 129,2435 -2446.
Reh, T. (1987). Cell-specific regulation of neuronal production in the larval frog retina. J. Neurosci. 7,3317 -3324.[Abstract]
Rohlich, P., Adamus, G., McDowell, J. H. and Hargrave, P. A. (1989). Binding pattern of anti-rhodopsin monoclonal antibodies to photoreceptor cells: an immunocytochemical study. Exp. Eye Res. 49,999 -1013.[CrossRef][Medline]
Shkumatava, A. and Neumann, C. J. (2005). Shh directs cell-cycle exit by activating p57Kip2 in the zebrafish retina. EMBO Rep. 6,563 -569.[CrossRef][Medline]
Shkumatava, A., Fischer, S., Muller, F., Strahle, U. and
Neumann, C. J. (2004). Sonic hedgehog, secreted by amacrine
cells, acts as a short-range signal to direct differentiation and lamination
in the zebrafish retina. Development
131,3849
-3858.
Sicinski, P., Donaher, J. L., Parker, S. B., Li, T., Fazeli, A., Gardner, H., Haslam, S. Z., Bronson, R. T., Elledge, S. J. and Weinberg, R. A. (1995). Cyclin D1 provides a link between development and oncogenesis in the retina and breast. Cell 82,621 -630.[CrossRef][Medline]
Solecki, D. J., Liu, X. L., Tomoda, T., Fang, Y. and Hatten, M. E. (2001). Activated Notch2 signaling inhibits differentiation of cerebellar granule neuron precursors by maintaining proliferation. Neuron 31,557 -568.[CrossRef][Medline]
Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71.[CrossRef][Medline]
Spence, J. R., Madhavan, M., Ewing, J. D., Jones, D. K., Lehman,
B. M. and Del Rio-Tsonis, K. (2004). The hedgehog pathway is
a modulator of retina regeneration. Development
131,4607
-4621.
Stenkamp, D. L. and Frey, R. A. (2003). Extraretinal and retinal hedgehog signaling sequentially regulate retinal differentiation in zebrafish. Dev. Biol. 258,349 -363.[CrossRef][Medline]
Takatsuka, K., Hatakeyama, J., Bessho, Y. and Kageyama, R. (2004). Roles of the bHLH gene Hes1 in retinal morphogenesis. Brain Res. 1004,148 -155.[CrossRef][Medline]
Tomita, K., Ishibashi, M., Nakahara, K., Ang, S. L., Nakanishi, S., Guillemot, F. and Kageyama, R. (1996). Mammalian hairy and Enhancer of split homolog 1 regulates differentiation of retinal neurons and is essential for eye morphogenesis. Neuron 16,723 -734.[CrossRef][Medline]
Turner, D. and Cepko, C. (1987). A common progenitor for neurons and glia persists in rat retina late in development. Nature 328,131 -136.[CrossRef][Medline]
Waid, D. K. and McLoon, S. C. (1998). Ganglion cells influence the fate of dividing retinal cells in culture. Development 125,1059 -1066.[Abstract]
Wallace, V. A. and Raff, M. C. (1999). A role for Sonic hedgehog in axon-to-astrocyte signalling in the rodent optic nerve. Development 126,2901 -2909.[Abstract]
Wang, S. W., Kim, B. S., Ding, K., Wang, H., Sun, D., Johnson,
R. L., Klein, W. H. and Gan, L. (2001). Requirement
for math5 in the development of retinal ganglion cells. Genes
Dev. 15,24
-29.
Wang, Y. P., Dakubo, G., Howley, P., Campsall, K. D., Mazarolle, C. J., Shiga, S. A., Lewis, P. M., McMahon, A. P. and Wallace, V. A. (2002). Development of normal retinal organization depends on Sonic hedgehog signaling from ganglion cells. Nat. Neurosci. 5,831 -832.[Medline]
Watanabe, T. and Raff, M. (1990). Rod photoreceptor development in vitro: intrinsic properties of proliferating neuroepithelial cells change as development proceeds in the rat retina. Neuron 2,461 -467.
Wetts, R. and Fraser, S. (1988). Multipotent
precursors can give rise to almost all major cell types of the frog retina.
Science 239,1142
-1145.
Xiang, M. (1998). Requirement for Brn-3b in early differentiation of postmitotic retinal ganglion cell precursors. Dev. Biol. 197,155 -169.[CrossRef][Medline]
Young, R. W. (1985). Cell differentiation in the retina of the mouse. Anat. Rec. 212,199 -205.[CrossRef][Medline]
Zhang, X. M. and Yang, X. J. (2001). Regulation of retinal ganglion cell production by Sonic hedgehog. Development 128,943 -957.[Abstract]
Zhu, X., Li, A., Brown, B., Weiss, E. R., Osawa, S. and Craft, C. M. (2002). Mouse cone arrestin expression pattern: light induced translocation in cone photoreceptors. Mol. Vis. 8,462 -471.[Medline]
This article has been cited by other articles:
![]() |
K. Sakagami, L. Gan, and X.-J. Yang Distinct Effects of Hedgehog Signaling on Neuronal Fate Specification and Cell Cycle Progression in the Embryonic Mouse Retina J. Neurosci., May 27, 2009; 29(21): 6932 - 6944. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yu, J. Gipp, J. W. Yoon, P. Iannaccone, D. Walterhouse, and W. Bushman Sonic Hedgehog-responsive Genes in the Fetal Prostate J. Biol. Chem., February 27, 2009; 284(9): 5620 - 5629. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Wall, A. J. Mears, B. McNeill, C. Mazerolle, S. Thurig, Y. Wang, R. Kageyama, and V. A. Wallace Progenitor cell proliferation in the retina is dependent on Notch-independent Sonic hedgehog/Hes1 activity J. Cell Biol., January 12, 2009; 184(1): 101 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sanchez-Camacho and P. Bovolenta Autonomous and non-autonomous Shh signalling mediate the in vivo growth and guidance of mouse retinal ganglion cell axons Development, November 1, 2008; 135(21): 3531 - 3541. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Denayer, M. Locker, C. Borday, T. Deroo, S. Janssens, A. Hecht, F. van Roy, M. Perron, and K. Vleminckx Canonical Wnt Signaling Controls Proliferation of Retinal Stem/Progenitor Cells in Postembryonic Xenopus Eyes Stem Cells, August 1, 2008; 26(8): 2063 - 2074. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Pan, M. Deng, X. Xie, and L. Gan ISL1 and BRN3B co-regulate the differentiation of murine retinal ganglion cells Development, June 1, 2008; 135(11): 1981 - 1990. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Mu, X. Fu, P. D. Beremand, T. L. Thomas, and W. H. Klein Gene-regulation logic in retinal ganglion cell development: Isl1 defines a critical branch distinct from but overlapping with Pou4f2 PNAS, May 13, 2008; 105(19): 6942 - 6947. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Heine, E. Dohle, K. Bumsted-O'Brien, D. Engelkamp, and D. Schulte Evidence for an evolutionary conserved role of homothorax/Meis1/2 during vertebrate retina development Development, March 1, 2008; 135(5): 805 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Elshatory, D. Everhart, M. Deng, X. Xie, R. B. Barlow, and L. Gan Islet-1 Controls the Differentiation of Retinal Bipolar and Cholinergic Amacrine Cells J. Neurosci., November 14, 2007; 27(46): 12707 - 12720. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. B. Nickerson, J. G. Emsley, T. Myers, and D. B. Clarke Proliferation and Expression of Progenitor and Mature Retinal Phenotypes in the Adult Mammalian Ciliary Body after Retinal Ganglion Cell Injury Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 5266 - 5275. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Bassett, G. F. Pontoriero, W. Feng, T. Marquardt, M. E. Fini, T. Williams, and J. A. West-Mays Conditional Deletion of Activating Protein 2{alpha} (AP-2{alpha}) in the Developing Retina Demonstrates Non-Cell-Autonomous Roles for AP-2{alpha} in Optic Cup Development Mol. Cell. Biol., November 1, 2007; 27(21): 7497 - 7510. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Baye and B. A. Link Interkinetic Nuclear Migration and the Selection of Neurogenic Cell Divisions during Vertebrate Retinogenesis J. Neurosci., September 19, 2007; 27(38): 10143 - 10152. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Locker, M. Agathocleous, M. A. Amato, K. Parain, W. A. Harris, and M. Perron Hedgehog signaling and the retina: insights into the mechanisms controlling the proliferative properties of neural precursors. Genes & Dev., November 1, 2006; 20(21): 3036 - 3048. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hashimoto, X.-M. Zhang, B. Y.-k. Chen, and X.-J. Yang VEGF activates divergent intracellular signaling components to regulate retinal progenitor cell proliferation and neuronal differentiation Development, June 1, 2006; 133(11): 2201 - 2210. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||