|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 26 October 2005
doi: 10.1242/dev.02100
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Genetics and Howard Hughes Medical Institute, Harvard Medical
School, 77 Avenue Louis Pasteur, Boston, MA 02115, USA
2 Department of Biology, Oberlin College, 119 Woodland Street, Oberlin, OH
44074-1097, USA
* Author for correspondence (email: cepko{at}genetics.med.harvard.edu)
Accepted 22 September 2005
| SUMMARY |
|---|
|
|
|---|
(DNhRAR
) was expressed in the chick retina to block RA activity. RA
signaling was found to play a role in regulating the expression of EphB2,
EphB3 and ephrin B2, three molecules whose graded expression in the retina
along the DV axis is important for establishing the correct retinotectal map.
Blocking RA signaling by misexpression of a RA degrading enzyme, Cyp26A1
recapitulated some but not all the effects of DNhRAR
. It also was found
that Vax, a ventrally expressed transcription factor that regulates the
expression of the EphB and ephrin B molecules, functions upstream of, or in
parallel to, RA. Expression of DNhRAR
led to increased levels of
RA-synthesizing enzymes and loss of RA-degrading enzymes. Activation of such
compensatory mechanisms when RA activity is blocked suggests that RA
homeostasis is very strictly regulated in the retina.
Key words: Retinoic acid, Dorsoventral, EphB, Ephrin B, Patterning, Retinotectal map
| Introduction |
|---|
|
|
|---|
In the neural retina, the early and patterned expression of genes such as
Vax, Tbx5, Bmp4 and Ventroptin provides spatial cues to the
retinal ganglion cells such that their axons project in an orderly fashion to
higher brain centers, e.g. the superior colliculus (SC) in mammals and the
optic tectum (OT) in birds (Crossland et
al., 1974
). Ganglion cells next to each other in the retina send
projections to neighboring regions in the SC/OT, giving rise to a topographic
map. Retinal ganglion cells originating in the dorsal retina project to the
lateral tectum and those from the ventral retina send projections to the
medial tectum. Similar order is maintained along the AP axis to give rise the
retinotectal map (reviewed by McLaughlin
et al., 2003a
).
Positional values must be assigned to ganglion cells in order for them to
form an accurate topographic map. In his chemoaffinity model, Sperry suggested
that this process is guided by AP and DV expression gradients of molecules
(Sperry, 1963
). These were
later found to be the Eph family of receptor tyrosine kinases in the retina,
and similar rostrocaudal and mediolateral expression gradients of their
ligands, the ephrins, have been found in the SC/OT
(Simon and O'Leary, 1992a
;
Simon and O'Leary, 1992b
;
Simon and O'Leary, 1992c
;
Wilkinson, 2001
). Members of
the EphA family of receptor tyrosine kinases in the retina and the ephrin A
family members expressed in the tectum
(Cheng et al., 1995
;
Drescher et al., 1995
)
determine retinotectal projections along the AP axis
(Feldheim et al., 2000
;
Sakurai et al., 2002
;
Yates et al., 2001
). The
receptors of EphB family, EphB2 and EphB3, are expressed asymmetrically in a
ventral-to-dorsal gradient in the retina
(Braisted et al., 1997
;
Connor et al., 1998
;
Holash and Pasquale, 1995
) and
the ligand ephrin B1 is expressed in a medial-to-lateral gradient in the optic
tectum (Braisted et al., 1997
).
Recent experiments using misexpression studies with ephrin B1 in the chick
optic tectum (McLaughlin et al.,
2003b
), and the study of Ephb2 and Ephb3 double
knockout mice (Hindges et al.,
2002
), have demonstrated the importance of these molecules for
correct DV mapping of the ganglion cells onto the SC/OT.
Very little is known about how the graded expression of the Eph receptors
and ephrin molecules are established within the retina. The early DV
patterning genes such as Vax and Tbx5 have been demonstrated
to play a role in regulating the DV expression gradient of the EphB receptors
and the ephrin B ligands (Barbieri et al.,
2002
; Mui et al.,
2002
; Schulte et al.,
1999
). The asymmetric distribution of RA activity along the DV
axis and the timeline of expression of the RA-synthesizing and -degrading
enzymes suggest that RA might also play a role in the regulation of the
expression gradient of the EphB receptors and the ephrin B ligands. The onset
of expression of patterning genes such as Vax and Tbx5 is at
HH stage 14 (Koshiba-Takeuchi et al.,
2000
; Schulte et al.,
1999
). The expression of ephrin B1 and ephrin B2 is detected at HH
stage 18-19 in the retina (Braisted et al.,
1997
; Peters and Cepko,
2002
), and the expression of EphB2 and EphB3 can be detected in
the ventral retina by HH stage 24 (Holash
and Pasquale, 1995
; Peters and
Cepko, 2002
). The timeline of expression of the RA-synthesizing
enzymes RALDH1 and RALDH3, and Cyp26A1, the RA-degrading enzyme, is as
follows. RALDH1 is faintly detected in the dorsal eye region at HH stage 14
and subsequently expression becomes stronger by HH stage 16
(Suzuki et al., 2000
). RALDH3
is first detected in the ventral eye region at HH stage 12, but only in the
surface ectoderm. By HH stage 14, strong expression could be seen in the
ventral eye in the presumptive neural retina, pigment epithelium and surface
ectoderm (Blentic et al., 2003
;
Suzuki et al., 2000
). Cyp26A1
expression is restricted to dorsal lens alone at HH stage 18 and then is
detected in a horizontal stripe across the retina at E6
(Blentic et al., 2003
).
However, another member of the family, Cyp26B1, is detected in a horizontal
stripe across the middle of the retina as early as HH stage 18
(Reijntjes et al., 2003
).
Thus, RA-synthesizing and -degrading enzymes are expressed at a time and place
that is consistent with RA signaling playing a role in regulating the DV
topographic guidance molecules.
Redundancy among the various receptor subtypes and the RA-synthesizing
enzymes has made it difficult to study the effects of loss of RA activity on
patterning in the retina by conventional loss of function studies. In this
study, some of these difficulties were surmounted by using a
replication-competent avian virus vector, RCAS, to express a dominant-negative
form of the human retinoic acid receptor
(DNhRAR
) in the chick
eye. This method of blocking RA activity in the retina allowed initial eye
development to progress to a certain degree, providing an opportunity to study
the role of RA in early eye development. It was observed that expression of
DNhRAR
led to loss of expression of the EphB2 and EphB3 receptor
tyrosine kinases in the ventral retina, and of ephrin B2, one of the dorsally
expressed EphB ligands. These data strongly suggest that RA signaling plays an
important role in regulating the expression of EphB/ephrin B molecules within
the retina. In addition to this, it was found that expression of Vax was
unchanged by loss of RA activity. However, misexpression of Vax in the retina
led to loss of expression of the dorsal RA-synthesizing enzyme, RALDH1, and
ectopic expression of the ventral RA-synthesizing enzyme, RALDH3, in the
dorsal retina. This indicates that Vax may regulate expression of EphB2/B3 and
ephrin B2 by acting in parallel to, or upstream of, RA activity in the
retina.
| Materials and methods |
|---|
|
|
|---|
Retroviral constructs and the lacZ reporter construct
The insert from pRS-hRAR
, a gift from Ronald M. Evans
(Damm et al., 1993
) was
PCR-amplified using GCAGAAGACCCCATGGCCAGCAACAGCAGCTCCT as the 5' primer
and CCGGAATTCCAACATTTCCTGGATGAGAGGCGG as the 3' primer. The PCR product
was digested with BbsI and EcoRI, and subcloned into the
NcoI/EcoRI sites of pSlax21 to generate
pSlax21-DNhRAR
. The ClaI fragment of pSlax21-DNhRAR
was
further subcloned into the RCASBP(A) vector
(Morgan and Fekete, 1996
;
Petropoulos and Hughes, 1991
)
in order to generate RCAS-DNhRAR
. The insert from
pBS-cP450RAI(CYP26), a gift from Eric Swindell
(Swindell et al., 1999
), was
similarly cloned into RCASBP(B) to generate the RCAS-Cyp26A1 construct. The
DNcTRß2 was constructed by using site-directed mutagenesis (Stratagene)
to delete amino acid 245 in the ligand-binding domain of cTRß2, a gift
from B. Vennström (Sjoberg et al.,
1992
) following which the cTRß2
245 was cloned into
RCASBP(A) to generate the RCAS-DNcTRß2. The RARE-lacZ reporter
was a gift from M. Wagner (Wagner et al.,
1992
). The thyroid hormone reporter DR4-lacZ was a
generated by cloning a nuclear lacZ downstream of four DR4 repeats
and a minimal promoter. Retroviral stocks were generated as described
elsewhere (Ausubel, 1998). The titer for all viral stocks was
1x107 to 5x108. The viral stocks for
RCAS-DNhRAR
(titer, 1x108) was diluted 1:1 and
injected into the right eye at HH stage 17 in order to achieve incomplete
infection by E7 to analyze for EphB and ephrin B expression changes by
flat-mount in situ hybridization. The RCAS-DNcTRß2 viral stock (titer,
1x108), RCAS-Cyp26A1 (titer, 1x107) and the
RCAS-Vax (titer, 1x108) viral stocks were injected undiluted
into right and left optic vesicles at HH stage 10-11.
Cell transfection and ß-galactosidase assay
Cells from the chick embryonic fibroblast cell line, DF-1 (a gift from D.
Foster), were transfected with DNA for: (1) RARE-lacZ (2 µg DNA)
alone; (2) DNA for RARE-lacZ (2 µg) + DNA for RCAS-DNhRAR
(5 µg); (3) DNA for RARE-lacZ (2 µg) + DNA for RCAS-CYP26A1 (5
µg); (4) DNA for DR4-lacZ (2 µg) alone; or (5) DNA for
DR4-lacZ (2 µg) + DNA for RCAS-cDNTRß2 (5 µg) using the
Superfect Cell Transfection Reagent from QIAGEN. Transfected DF-1 cells were
cultured in culture medium [DMEM + 10% FCS + penicillin/streptomycin (100
U/ml)] with 1 µM All-trans-RA (Sigma-Aldrich) for detecting the RA-reporter
or in DMEM + 10% FCS + penicillin/streptomycin (100 U/ml) alone for the TH
reporter for 24 hours. The cells were fixed in 0.5% glutaraldehyde for 20
minutes on ice followed by four rinses with PBS containing 2 mM
MgCl2. Cells were incubated with the X-gal reaction buffer (35 mM
potassium ferrocyanide, 35 mM potassium ferricyanide, 2 mM MgCl2,
0.02% Nonidet P-40, 0.01% Na deoxycholate in PBS) containing 1 mg/ml X-gal
[5-bromo-4-choloro-3-indoyl-ß-D-galactoside (Research Organics)] for 2
hours in the dark at 37°C to allow for blue color to develop.
[3H] thymidine labeling of explanted chick retinae and retinal cell dissociation
RCAS-DNhRAR
-infected E7 chick retinae were dissected free of
surrounding tissues and placed on Nuclepore filters of 25 mm diameter
(Whatman) with DF10 [45% DME, 45% Ham's F12 Nutrient Mixture
(LifeTechnologies, Gaithersburg, MD), 10% FCS, penicillin/streptomycin (100
U/ml) containing 5 µCi [3H] thymidine/ml for 4 hours at
37°C]. Each retina was then dissociated into single cells with papain
(Blackshaw et al., 2004
) which
were plated on poly-D-lysine coated slides as previously described
(Morrow et al., 1998
). The
cells on the slides were fixed with 4% paraformaldehyde in PBS for 20 minutes
and dehydrated in 100% methanol.
Immunocytochemistry and autoradiography
Immunocytochemistry was performed on the dissociated cells with 3c2
monoclonal antibody at a dilution of (1:20) to detect virus-infected cells.
Slides were processed for autoradiography for detection of the [3H]
thymidine-labeled cells as described previously
(Alexiades and Cepko,
1996
).
RNA in situ hybridization
Flat-mount in situ hybridization was performed as described previously
(Bruhn and Cepko, 1996
) with
some modifications (Chen and Cepko,
2002
). Double in situ hybridization was carried out with
digoxigenin-labeled RNA probes for specific markers and the
fluorescein-labeled probe specific for RCAS to detect virally infected cells.
The probes labeled with digoxigenin were first detected with NBT/BCIP until
the desired purple signal developed. This was followed by incubation with
AP-conjugated anti-fluorescein antibody. The second in situ hybridization
signal was detected with BCIP alone until the desired blue color developed. In
some cases the second probe for RCAS was not used; instead, immunostaining was
performed with 3c2 mAb recognizing the viral Gag protein, based on the
protocol described previously (Chen and
Cepko, 2002
) to identify virus-infected regions of the
retinae.
| Results |
|---|
|
|
|---|
in chick embryonic DF-1 cells blocks RA signaling
was created by Damm et
al. (Damm et al., 1989
). Prior to injecting this virus in the chick eye, it was
necessary to determine if this human gene was capable of blocking RA signaling
in chick cells. Cells from the chick embryonic cell line DF-1 were
co-transfected with RCAS-DNhRAR
and RARE-lacZ, a reporter for
RA activity (Wagner et al.,
1992
did not turn blue (Fig.
1B).
Expression of DNhRAR
in the chick retina leads to reduction in eye size
Micropthalmia has been observed in mammalian embryos born from females fed
with a diet deficient in vitamin A (Hale,
1937
; Wilson, 1953). Thus, a reduction in eye size might occur
when RA activity is blocked by expression of DNhRAR
in the chick
retina. Such a phenotype would be an additional means of confirming that the
DNhRAR
functions in the chick retina. When the eyes of chick embryos
injected with RCAS-DNhRAR
at HH stage 17 were compared at E7, the
injected right eye was observed to be significantly smaller than the
uninjected left eye. This phenotype was observed in >20 injected embryos of
which one is shown in Fig. 2A.
In some animals, the injected eye size was as small as one half of the control
eye size. In addition, the ventral fissure (white arrowhead) appeared to be
wider and more distinct in the injected eye than in the contralateral
uninjected eye (Fig. 2A). This
smaller eye phenotype was apparent from E5 and the severity of the phenotype
correlated with the extent of viral infection in the retina as assayed by
staining with the 3c2 antibody against viral Gag protein. The small eye
phenotype as well as all other phenotypes observed when injecting the
RCAS-DNhRAR
virus were the same regardless of whether the stage of
injection was HH stage 10 or HH stage 17. The only difference was in the total
area of the retina that was infected, with a greater extent of infection in
those infected at HH stage 10. Thus, mostly retinae injected at HH stage 17
are shown in the figures in order to allow for a comparison of infected and
uninfected regions within the same retina.
|
|
. TUNEL-positive cells were not found in the infected or
uninfected regions of the retina (data not shown). This suggests that the size
reduction in the retina is not primarily due to increased cell death. In order
to discover if changes in cell proliferation might account for the smaller
eyes, explant cultures from nine different E7 retinae, R1 to R9, injected in
vivo at HH stage 10 with RCAS-DNhRAR
, were labeled with [3H]
thymidine for 4 hours. Retinal explants were then dissociated into single
cells and immunohistochemistry was performed with 3c2 antibody against the
viral Gag protein to identify infected cells
(Fig. 2B,D). The number of
[3H] thymidine-labeled cells (cells containing at least 10 grains
per cell) among the infected (3c2 positive) population as well as among the
uninfected (3c2 negative) population in each retina was counted
(Table 1). An average
9.4±2.25% of infected cells were labeled when compared with about
15.2±2.37% of the uninfected cells
(Table 1;
Fig. 2C, red and green bars).
As a control, the same was carried out with six retinae, G1 to G6, infected
with RCAS-GFP. In this case, 18.1±0.75% of the uninfected cell were
[3H] thymidine labeled and 18.8±1.15% of the infected cells
were labeled (Table 1 and
Fig. 2C, light-blue and
dark-blue bars). Thus, RCAS-DNhRAR
-infected cells were significantly
reduced in proliferation (P<0.0001). When several rounds of cell
division are taken into consideration, this difference is likely to be
sufficient for the observed reduction in eye size.
|
in the chick retina was
carried out to determine if the expression of genes that were asymmetrically
expressed along the DV axis might be RA dependent. Some of the candidate genes
examined for expression changes were the EphB family of tyrosine kinase
receptors and their ligands, the ephrin B molecules. The EphB family members,
EphB2 and EphB3, are expressed in a ventral high to dorsal low gradient
(Fig. 3A,E) in the retina in
both chick and mouse (Braisted et al.,
1997
, and allowed to develop to E7. The retinae from the right
eyes of injected animals were harvested, flat-mounted and in situ
hybridization was performed to detect expression changes in ephrin B1, ephrin
B2, EphB2 and EphB3. Expression of DNhRAR
led to an absence of
expression of ephrin B2 (Fig.
3J,K,L) in the dorsal retina. Ephrin B1, however, remained largely
unchanged (Fig. 3N,O), although
there appears to be a slight reduction in the expression of ephrin B1 in some
infected patches (Fig. 3N,O, arrows). However, this reduction in expression levels is very subtle,
particularly when compared with the dramatic reduction in expression of ephrin
B2. This indicates that RA signaling plays a significant role in regulating
the expression of ephrin B2, but not that of ephrin B1. In the ventral retina,
absence of expression of both EphB2 (Fig.
3B-D) and EphB3 (Fig.
3F-H) was observed within the infected areas
(Fig. 3D,H, blue signal).
|
|
might be produced by indirect effects on thyroid hormone (TH) signaling.
DNcTRß2 was constructed by deleting a single amino acid residue within
the ligand-binding domain. A similar mutation in the human thyroid hormone
receptor has been demonstrated to give rise to a dominant-negative form
(Baniahmad et al., 1992
RA signaling is mediated through heterodimers of RA receptor (RAR) and
retinoid X receptor (RXR), whereas TH signaling is mediated through
heterodimers of the thyroid hormone receptor (TR) and RXR
(Kliewer et al., 1992
). Thus,
there is a possibility that the DNhRAR
could block TH signaling by
sequestering all available RXR molecules in a cell. For example, when DF-1
cells were co-transfected with either RARE-lacZ (RA-reporter) +
RCAS-DNcTRß2 or with DR4-lacZ (TH-reporter) +
RCAS-DNhRAR
, it was observed that very few to none of the cells turned
blue (data not shown), indicating that both RA signaling and TH signaling can
be blocked by either construct.
In order to ascertain whether the effects on expression of EphB2, EphB3 and ephrin B2 could be mediated by blocking thyroid hormone signaling, RCAS-DNcTRß2 was introduced into the chick retina. Infection with RCAS-DNcTRß2 did not alter the expression patterns of EphB2 (Fig. 4A,B), EphB3 (Fig. 4C,D), ephrin B1 (Fig. 4E,F) or ephrin B2 (Fig. 4G,H). Infection with RCAS-DNcTRß2 also did not lead to alteration of expression of the two RA-synthesizing enzymes RALDH1 and RALDH3 (data not shown), indicating that there is no interaction between the RA signaling and TH pathway at this level.
Expression of a RA-degrading enzyme, CYP26A1, can reproduce some, but not all, of the effects of DNhRAR
In order to investigate the role of RA signaling in regulating the
expression of EphB2, EphB3 and ephrin B2 by an independent approach, RA
signaling was reduced by expression of a RA-degrading enzyme, Cyp26A1. Retinae
were harvested at E7 from chick embryos injected with RCAS-Cyp26A1 at HH stage
10. Infection with RCAS-Cyp26A1 in the ventral retina produced no change in
expression of EphB2 (Fig. 5C,G,
white arrowhead) or EphB3 (Fig.
5D,H, white arrowhead). However, in the dorsal retina loss of
expression of ephrin B2 (Fig.
5A, black arrow) was observed within RCAS-Cyp26A1-infected regions
(Fig. 5E, black arrow), but no
change in expression of ephrin B1 was observed
(Fig. 5B,F, white arrowhead).
The changes observed in the dorsal retina were very similar to the effects of
expression of DNhRAR
. The normal expression pattern of Cyp26A1 in the
chick retina is a midline stripe along the DV border
(Fig. 5K, between the white
arrows) with very low level expression outside this domain in the dorsal and
ventral retina. The differential effects of RCAS-Cyp26A1 on ephrin B1 and
ephrin B2 may be due to the fact that the ventral border of expression of
ephrin B1 extends further ventrally than that of ephrin B2 in the wild-type
retina (Fig. 5I,J, white
arrows) such that it overlaps with the expression domain of CYP26A1. In the
ventral retina, EphB2 and EphB3 expression was not affected by RCAS-Cyp26A1.
When DF-1 cells were co-transfected with either RARE-lacZ alone,
RARE-lacZ + RCAS-DNhRAR
or RARE-lacZ + RCAS-Cyp26A1
(Fig. 5L,M,N), DNhRAR
was able to completely block the reporter, although there were a few blue
cells (Fig. 5N) with Cyp26A1.
As this experiment was carried out in vitro, in the presence of RA levels in
excess of that in the retina, it suggests that Cyp26A1 may not be as efficient
at blocking RA signaling as DNhRAR
.
|

may lead to activation of
homeostatic mechanisms to restore RA levels. Thus, the expression of the two
RA-synthesizing enzymes and Cyp26A1 were assayed following infection with
RCAS-DNhRAR
. Upregulation of RALDH1 within virus-infected areas in the
dorsal retina (Fig. 6A,D,G,J)
and upregulation of RALDH3 within virus-infected areas in the ventral retina
(Fig. 6B,E,H,K) were observed.
The upregulation of RALDH1 was restricted to its normal domain of expression
in the dorsal retina (Fig.
6A,D, arrowhead), even if there was viral infection in the ventral
retina (Fig. 6D, arrow). The
upregulation of RALDH3 was similarly restricted to its normal ventral domain
(Fig. 6B,E, arrowhead;
Fig. 6E, arrow). Cyp26A1 is
expressed at high levels in an equatorial stripe running across the DV border
in the retina with very low levels of expression outside this central domain.
Cyp26A1 expression was downregulated in virus-infected areas
(Fig. 6C,F,I,L) both within its
normal central domain of expression as well as in other regions of the retina
where there was virus infection.
Vax regulates the expression of RA-synthesizing enzymes, but RA activity is not required for expression of Vax
In the chick retina, the homeodomain-containing transcription factor Vax is
expressed at HH stage 14 in the ventral retina. Misexpression of Vax in the
chick retina has been demonstrated to cause loss of expression of both ephrin
B1 and ephrin B2 in the dorsal retina, and lead to ectopic expression of EphB2
and EphB3 in the dorsal retina (Schulte et
al., 1999
). In order to understand the epistatic relationship
between Vax and RA with respect to regulation of EphB and ephrin B, the
expression of Vax and another early patterning gene, Tbx5, was examined
following expression of DNhRAR
. The ventral retinal expression of Vax
(Fig. 7A,B), as well as the
dorsal retinal expression of Tbx5 (Fig.
7C,D) appeared to be unchanged within regions of virus
infection.
In order to examine the possibility that Vax regulates the expression of the ephrin B and EphB molecules in the chick retina through RA, the effects of misexpression of Vax on the expression of RALDH1 and RALDH3 were determined. E6 retinae were harvested from chick embryos injected with RCAS-Vax at HH stage 10, and in situ hybridization was performed for RALDH1 and RALDH3. Vax misexpression led to downregulation of the dorsal RA-synthesizing enzyme RALDH1, (Fig. 7I,J) and ectopic expression of the RALDH3 enzyme in the dorsal retina within the virus-infected areas (Fig. 7E-H).
|
| Discussion |
|---|
|
|
|---|
primarily to the retina and presumably blocked RA signaling by
any RAR, providing a means to overcome lethality and/or redundancy problems
encountered by previous gene targeting studies in mice. This approach
permitted successful identification of later functions of RA in the
retina.
Signaling through RA receptors was shown to be required for the expression
of the EphB2 and EphB3 receptor tyrosine kinases in the ventral retina, and
also for ephrin-B2 in the dorsal retina. The fact that EphB-ephrin B signaling
specifies retinotopic mapping along the DV axis has been demonstrated by
several studies. Recent studies with mice carrying mutations in both
Ephb2 and Ephb3 receptors have shown that EphB forward
signaling controls topographic mapping of the retinal DV axis along the
lateromedial axis of the superior colliculus
(Hindges et al., 2002
). Other
studies in Xenopus have also shown that EphB-ephrin B interactions
are responsible for retinotopic mapping. However, in this case, ephrin B
reverse signaling is dominant (Mann et
al., 2002
). It is postulated that such signaling may also
contribute to retinotopic mapping in higher vertebrates, especially for the
dorsal RGC axons. A retina completely infected with DNhRAR
has almost
no, or extremely low, expression of EphB2, EphB3 and ephrin B2 (data not
shown). This is not unlike the double mutant mice for EphB2 and EphB3, and
therefore would be expected to have a similar phenotype with respect to
mapping DV retinal projections along the lateromedial axis of the tectum.
Thus, RA signaling is important for establishment of the DV retinotopic map
through regulating the expression of the EphB2, EphB3 and ephrin B2.
|
. With RCAS-Cyp26A1,
there was no change in the expression of EphB2 and EphB3. This difference
might be explained by the existence of lower levels of RA in the dorsal retina
when compared with the ventral retina, as determined by HPLC
(Mey et al., 1997
is demonstrated by the inability of
RCAS-Cyp26A1 to completely turn off the RA-reporter in DF-1 cells in the
presence of excess RA.
Perturbations of RA activity in the retina lead to activation of homeostatic mechanisms to maintain RA levels
Retinoic acid is required for the morphogenesis, organogenesis and
differentiation of many tissues during development
(Kalter and Warkany, 1959
). In
order to achieve this, it is likely that appropriate levels of RA need to be
strictly maintained, with adjustments in RA levels made according to local
requirements. Given the fact that both deficiency of, and excess of, RA have
profound effects on development, it might be predicted that compensatory
mechanisms are active in the developing embryo to regulate RA levels. We found
that when there is a significant block in RA signaling by expression of the
DNhRAR
receptor, upregulation of the RA-synthesizing enzymes RALDH1 and
RALDH3 occurred. The domains of upregulation of each enzyme were within their
normal field of expression, suggesting that there are other spatially
restricted factors that regulate the expression of RALDH1 and RALDH3. In
addition, expression of DNhRAR
led to downregulation of Cyp26A1, the
RA-degrading enzyme. This is not surprising because the studies that first
identified Cyp26A1 showed that its expression was increased by RA
(Ray et al., 1997
;
White et al., 2000
). The
expression of Cyp26B1, another member of this family, is also regulated by RA
(Reijntjes et al., 2003
).
Expression of DNhRAR
leads to conditions that are somewhat different
when compared with deficiency of vitamin A. In the case of RA deficiency, the
ligand is missing. By contrast, DNhRAR
blocks transcription through
formation of inactive RAR-RXR heterodimers that cannot activate target genes.
Thus, even if compensatory mechanisms are recruited to increase the levels of
RA, the block in transcription of target genes will not be overcome. Yet,
compensatory mechanisms appear to be activated to try to maintain optimal RA
signaling. This underscores the importance of RA homeostasis in developing and
mature tissues.
Relationship of RA activity to other DV patterning genes in the retina
The patterning of the AP and DV axes of the retina and retinotectal
topographic mapping are intrinsically linked to each other. Some of the
transcription factors expressed asymmetrically in the retina to define its
axial polarity, such as Vax and Tbx5, have been implicated in the regulation
of expression of topographic guidance molecules, e.g. EphB and ephrin B family
members. In the Vax2 knockout mouse, the expression of ephrin B1 and
ephrin B2 are expanded into the ventral retina, while there is loss of
expression of EphB2 and EphB3 in the ventral retina
(Barbieri et al., 2002
;
Mui et al., 2002
).
Observations made after blocking RA signaling in the retina indicate that RA also plays an important role in regulating the expression of some of these guidance molecules. Thus, Vax may function either upstream of or in parallel to RA signaling to regulate the expression of ephrin B2, EphB2 and EphB3. The epistatic relationship between RA activity and some of the early DV axis determining genes in the retina was investigated in this study. Blocking RA activity in the retina did not alter the dorsal expression of Tbx5 or the ventral expression of Vax. This might have been predicted given that Vax and Tbx5 are expressed prior to RALDH1, RALDH3 and Cyp26 in the retina. However, misexpression of Vax in the retina alters the expression of the RA-synthesizing enzymes RALDH1 and RALDH3. Vax misexpression downregulates the expression of RALDH1 in the dorsal retina and leads to ectopic expression of the ventral enzyme RALDH3 in the dorsal retina. These observations could be consistent with the two models described below.
Model 1
The transcription factors Vax and Tbx5 function through RA to regulate the
expression of EphB2, EphB3 and ephrin B2 in the retina. According to this
model, Vax regulates the expression of EphB3 and EphB2 in the ventral retina
by turning on the expression of RALDH3, which produces RA that is involved
directly or indirectly in the transcriptional activation of EphB2 and EphB3
(Fig. 8A). In the dorsal
retina, Tbx5 might lead directly or indirectly to expression of RALDH1, the
source for RA, that positively regulates the expression of ephrin B2.
Misexpression of Vax in the dorsal retina leads to loss of expression of
RALDH1. This could be due to a direct inhibition of RALDH1 by Vax or it could
act through downregulation of Tbx5, which has previously been reported
(Schulte et al., 1999
). Thus,
Vax misexpression leads to loss of ephrin B2 expression because there is no
RALDH1 in the dorsal retina.
Model 2
Vax regulates the expression of EphB2 and EphB3 in the ventral retina and
Tbx5 regulates ephrin B2 in the dorsal retina, by acting in parallel to RA.
According to this model, both Vax and RA activity are required in the ventral
retina for expression of EphB2 and EphB3. Thus, in the absence of either Vax
or RA activity, EphB2 and EphB3 are not expressed. This would be possible
because both Vax and RA independently exerted positive effects on the
enhancers for these genes (Fig.
8B). In the dorsal retina, RA activity and Tbx5 would act
independently to positively regulate the expression of ephrin B2. Missing
either factor would lead to loss of ephrin B2 expression. When Vax is
misexpressed in the dorsal retina, it downregulates ephrin B2 expression
through downregulating Tbx5 and/or RALDH1.
|
Two facts argue against the use of 9-cis RA binding to RXR-RXR homodimer to
regulate the expression of ephrin B2: (1) when the levels of the various forms
of RA, all-trans RA, 9-cis RA and 13-cis RA, were measured by HPLC at various
stages of development in the chick retina, no significant levels of 9 cis-RA
were detected at any stage (Mey et al.,
1997
); and (2) if the first model were to be true then
mis-expression of RALDH1 in the ventral retina may be sufficient to turn on
the expression of ephrin B2 ectopically. Experiments carried out to misexpress
RALDH1 in the ventral retina failed to turn on ephrin B2 ectopically in that
location (see Fig. S1 in the supplementary material). The other major
difference between RALDH1 and RALDH3 is that RALDH3 is much more efficient
than RALDH1 and therefore can act faster and at lower concentrations of the
substrate. This difference could account for a large difference in gene
expression.
Although we cannot completely discount Model 1, Model 2 most probably describes the mechanism by which EphB2, EphB3 and ephrin B2 are regulated. The enhancer regions of EphB2 and EphB3 may have sites that are regulated positively by Vax and also possibly have other sites positively regulated by RA either directly or indirectly. The presence of Vax, as well as RA activity, is required to activate transcription of EphB2 and EphB3, which does not happen in the absence of either factor. In the case of ephrin B2, the enhancer region may contain sites that are positively regulated by Tbx5 and other sites positively regulated by RA; the presence of both would be necessary to express ephrin B2. Further characterization of the enhancer regions of these guidance molecules to identify factors that directly bind to their enhancer regions and regulate their expression should shed more light on this. This could possibly resolve the intricate web of interactions between the early patterning genes such as Vax, Tbx5 and RA and any downstream factors that may mediate their function by regulating the expression of the topographic guidance molecules.
Potential role of RA in other aspects of retinal patterning and development
The functional significance of the different ventral borders of expression
of the two ephrin B molecules expressed in the dorsal retina is completely
unknown. Our study reveals the strong dependence of expression of ephrin B2 on
RA activity. The regulation of expression of ephrin B1 in the dorsal retina is
either independent of RA signaling or only mildly dependent on it. Its
expression is primarily determined by as yet unidentified upstream factors
whose ventral border of expression must extend beyond the ventral border of
Tbx5/RALDH1. Misexpression of Cyp26A1 led to loss of ephrin B2 without
affecting the expression of ephrin B1, EphB2 or EphB3. This provides a unique
situation to study the function of ephrin B2 in the developing retina. Reverse
signaling through the ephrin B molecules may be involved in intra-retinal
targeting of RGC axons to the optic disc
(Birgbauer et al., 2000
). One
could glean more information about the function of the ephrin B molecules in
the retina using RCAS-DNhRAR
and RCAS-Cyp26A1 as tools.
| ACKNOWLEDGMENTS |
|---|
construct, Eric Swindell for
Cyp26A1 cDNA and B. Vennström for providing
cTRß2 cDNA. We are grateful to the members of the Cepko
and Tabin laboratories for critical discussion of the manuscript. This work
was supported by Howard Hughes Medical Institute to C.L.C.; C.L.C. and J.S.
are supported by HHMI. | Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/23/5147/DC1
| REFERENCES |
|---|
|
|
|---|
Abu-Abed, S., MacLean, G., Fraulob, V., Chambon, P., Petkovich,
M. and Dolle, P. (2002). Differential expression of the
retinoic acid-metabolizing enzymes CYP26A1 and CYP26B1 during murine
organogenesis. Mech. Dev.
110,173
-177.[CrossRef][Medline]
Alexiades, M. R. and Cepko, C. (1996).
Quantitative analysis of proliferation and cell cycle length during
development of the rat retina. Dev. Dyn.
205,293
-307.[CrossRef][Medline]
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D.,
Seidman, J. G., Smith, J. A. and Struhl, K. (1998).
Current Protocols in Molecular Biology. New York:
Wiley Publishing.
Baniahmad, A., Tsai, S. Y., O'Malley, B. W. and Tsai, M. J.
(1992). Kindred S thyroid hormone receptor is an active and
constitutive silencer and a repressor for thyroid hormone and retinoic acid
responses. Proc. Natl. Acad. Sci. USA
89,10633
-10637.
Barbieri, A. M., Broccoli, V., Bovolenta, P., Alfano, G.,
Marchitiello, A., Mocchetti, C., Crippa, L., Bulfone, A., Marigo, V.,
Ballabio, A. et al. (2002). Vax2 inactivation in mouse
determines alteration of the eye dorsal-ventral axis, misrouting of the optic
fibres and eye coloboma. Development
129,805
-813.
Birgbauer, E., Cowan, C. A., Sretavan, D. W. and Henkemeyer,
M. (2000). Kinase independent function of EphB receptors in
retinal axon pathfinding to the optic disc from dorsal but not ventral retina.
Development 127,1231
-1241.[Abstract]
Blackshaw, S., Harpavat, S., Trimarchi, J., Cai, L., Huang, H.,
Kuo, W. P., Weber, G., Lee, K., Fraioli, R. E., Cho, S. H. et al.
(2004). Genomic analysis of mouse retinal development.
PLoS Biol. 2,E247
.[CrossRef][Medline]
Blentic, A., Gale, E. and Maden, M. (2003).
Retinoic acid signalling centres in the avian embryo identified by sites of
expression of synthesising and catabolising enzymes. Dev.
Dyn. 227,114
-127.[CrossRef][Medline]
Braisted, J. E., McLaughlin, T., Wang, H. U., Friedman, G. C.,
Anderson, D. J. and O'Leary, D, D. (1997). Graded and
lamina-specific distributions of ligands of EphB receptor tyrosine kinases in
the developing retinotectal system. Dev. Biol.
191, 14-28.[CrossRef][Medline]
Bruhn, S. L. and Cepko, C. L. (1996).
Development of the pattern of photoreceptors in the chick retina.
J. Neurosci. 16,1430
-1439.
Chen, C. M. and Cepko, C. L. (2002). The
chicken RaxL gene plays a role in the initiation of photoreceptor
differentiation. Development
129,5363
-5375.
Cheng, H. J., Nakamoto, M., Bergemann, A. D. and Flanagan, J.
G. (1995). Complementary gradients in expression and binding
of ELF-1 and Mek4 in development of the topographic retinotectal projection
map. Cell 82,371
-381.[CrossRef][Medline]
Connor, R. J., Menzel, P. and Pasquale, E. B.
(1998). Expression and tyrosine phosphorylation of Eph receptors
suggest multiple mechanisms in patterning of the visual system.
Dev. Biol. 193,21
-35.[CrossRef][Medline]
Crossland, W. J., Cowan, W. M., Rogers, L. A. and Kelly, J.
P. (1974). The specification of the retino-tectal projection
in the chick. J. Comp. Neurol.
155,127
-164.[CrossRef][Medline]
Damm, K., Thompson, C. C. and Evans, R. M.
(1989). Protein encoded by v-erbA functions as a thyroid-hormone
receptor antagonist. Nature
339,593
-597.[CrossRef][Medline]
Damm, K., Heyman, R. A., Umesono, K. and Evans, R. M.
(1993). Functional inhibition of retinoic acid response by
dominant negative retinoic acid receptor mutants. Proc. Natl. Acad.
Sci. USA 90,2989
-2993.
Drescher, U., Kremoser, C., Handwerker, C., Loschinger, J.,
Noda, M. and Bonhoeffer, F. (1995). In vitro guidance of
retinal ganglion cell axons by RAGS, a 25 kDa tectal protein related to
ligands for Eph receptor tyrosine kinases. Cell
82,359
-370.[CrossRef][Medline]
Dupe, V., Matt, N., Garnier, J. M., Chambon, P., Mark, M. and
Ghyselinck, N. B. (2003). A newborn lethal defect due to
inactivation of retinaldehyde dehydrogenase type 3 is prevented by maternal
retinoic acid treatment. Proc. Natl. Acad. Sci. USA
100,14036
-14041.
Fan, X., Molotkov, A., Manabe, S., Donmoyer, C. M., Deltour, L.,
Foglio, M. H., Cuenca, A. E., Blaner, W. S., Lipton, S. A. and Duester, G.
(2003). Targeted disruption of Aldh1a1 (Raldh1) provides evidence
for a complex mechanism of retinoic acid synthesis in the developing retina.
Mol. Cell. Biol. 23,4637
-4648.
Feldheim, D. A., Kim, Y. I., Bergemann, A. D., Frisen, J.,
Barbacid, M. and Flanagan, J. G. (2000). Genetic analysis of
ephrin-A2 and ephrin-A5 shows their requirement in multiple aspects of
retinocollicular mapping. Neuron
25,563
-574.[CrossRef][Medline]
Fujii, H., Sato, T., Kaneko, S., Gotoh, O., Fujii-Kuriyama, Y.,
Osawa, K., Kato, S. and Hamada, H. (1997). Metabolic
inactivation of retinoic acid by a novel P450 differentially expressed in
developing mouse embryos. EMBO J.
16,4163
-4173.[CrossRef][Medline]
Grondona, J. M., Kastner, P., Gansmuller, A., Decimo, D.,
Chambon, P. and Mark, M. (1996). Retinal dysplasia and
degeneration in RARbeta2/RARgamma2 compound mutant mice.
Development 122,2173
-2188.[Abstract]
Grun, F., Hirose, Y., Kawauchi, S., Ogura, T. and Umesono,
K. (2000). Aldehyde dehydrogenase 6, a cytosolic
retinaldehyde dehydrogenase prominently expressed in sensory neuroepithelia
during development. J. Biol. Chem.
275,41210
-41218.
Hale, F. (1937). The relation of maternal
vitamin A deficiency to micropthalmia in pigs. Tex. State J.
Med. 33,228
-232.
Hamburger, V. and Hamilton, H. (1951). A series
of normal stages in the development of the chick embryo. J.
Morphol. 88,35
-46.
Hindges, R., McLaughlin, T., Genoud, N., Henkemeyer, M. and
O'Leary, D. D. (2002). EphB forward signaling controls
directional branch extension and arborization required for dorsal-ventral
retinotopic mapping. Neuron
35,475
-487.[CrossRef][Medline]
Holash, J. A. and Pasquale, E. B. (1995).
Polarized expression of the receptor protein tyrosine kinase Cek5 in the
developing avian visual system. Dev. Biol.
172,683
-693.[CrossRef][Medline]
Hyatt, G. A. and Dowling, J. E. (1997).
Retinoic acid. A key molecule for eye and photoreceptor development.
Invest. Ophthalmol. Vis. Sci.
38,1471
-1475.
Hyatt, G. A., Schmitt, E. A., Fadool, J. M. and Dowling, J.
E. (1996a). Retinoic acid alters photoreceptor development in
vivo. Proc. Natl. Acad. Sci. USA
93,13298
-13303.
Hyatt, G. A., Schmitt, E. A., Marsh-Armstrong, N., McCaffery,
P., Drager, U. C. and Dowling, J. E. (1996b). Retinoic acid
establishes ventral retinal characteristics.
Development 122,195
-204.[Abstract]
Kalter, H. and Warkany, J. (1959). Experimental
production of congenital maiformations in mammals by metabolic procedure.
Physiol. Rev. 39,69
-115.
Kastner, P., Mark, M., Ghyselinck, N., Krezel, W., Dupe, V.,
Grondona, J. M. and Chambon, P. (1997). Genetic evidence that
the retinoid signal is transduced by heterodimeric RXR/RAR functional units
during mouse development. Development
124,313
-326.[Abstract]
Kliewer, S. A., Umesono, K., Mangelsdorf, D. J. and Evans, R.
M. (1992). Retinoid X receptor interacts with nuclear
receptors in retinoic acid, thyroid hormone and vitamin D3 signalling.
Nature 355,446
-449.[CrossRef][Medline]
Koshiba-Takeuchi, K., Takeuchi, J. K., Matsumoto, K., Momose,
T., Uno, K., Hoepker, V., Ogura, K., Takahashi, N., Nakamura, H., Yasuda, K.
et al. (2000). Tbx5 and the retinotectum projection.
Science 287,134
-137.
Labrecque, J., Dumas, F., Lacroix, A. and Bhat, P. V.
(1995). A novel isoenzyme of aldehyde dehydrogenase specifically
involved in the biosynthesis of 9-cis and all-trans retinoic acid.
Biochem. J. 305,681
-684.
Lee, M. O., Manthey, C. L. and Sladek, N. E.
(1991). Identification of mouse liver aldehyde dehydrogenases
that catalyze the oxidation of retinaldehyde to retinoic acid.
Biochem. Pharmacol. 42,1279
-1285.[CrossRef][Medline]
Li, H., Wagner, E., McCaffery, P., Smith, D., Andreadis, A. and
Drager, U. C. (2000). A retinoic acid synthesizing enzyme in
ventral retina and telencephalon of the embryonic mouse. Mech.
Dev. 95,283
-289.[CrossRef][Medline]
Lin, M., Zhang, M., Abraham, M., Smith, S. M. and Napoli, J.
L. (2003). Mouse retinal dehydrogenase 4 (RALDH4), molecular
cloning, cellular expression, and activity in 9-cis-retinoic acid biosynthesis
in intact cells. J. Biol. Chem.
278,9856
-9861.
MacLean, G., Abu-Abed, S., Dolle, P., Tahayato, A., Chambon, P.
and Petkovich, M. (2001). Cloning of a novel retinoic-acid
metabolizing cytochrome P450, Cyp26B1, and comparative expression analysis
with Cyp26A1 during early murine development. Mech.
Dev. 107,195
-201.[CrossRef][Medline]
Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P.,
Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P. et
al. (1995). The nuclear receptor superfamily: the second
decade. Cell 83,835
-839.[CrossRef][Medline]
Mann, F., Ray, S., Harris, W. and Holt, C.
(2002). Topographic mapping in dorsoventral axis of the Xenopus
retinotectal system depends on signaling through ephrin-B ligands.
Neuron 35,461
-473.[CrossRef][Medline]
Mark, M. and Chambon, P. (2003). Functions of
RARs and RXRs in vivo: genetic dissection of the retinoid signaling pathway.
Pure Appl. Chem. 75,1709
-1732.
Marsh-Armstrong, N., McCaffery, P., Gilbert, W., Dowling, J. E.
and Drager, U. C. (1994). Retinoic acid is necessary for
development of the ventral retina in zebrafish. Proc. Natl. Acad.
Sci. USA 91,7286
-7290.
McCaffery, P., Tempst, P., Lara, G. and Drager, U. C.
(1991). Aldehyde dehydrogenase is a positional marker in the
retina. Development 112,693
-702.[Abstract]
McCaffery, P., Lee, M. O., Wagner, M. A., Sladek, N. E. and
Drager, U. C. (1992). Asymmetrical retinoic acid synthesis in
the dorsoventral axis of the retina. Development
115,371
-382.[Abstract]
McCaffery, P., Wagner, E., O'Neil, J., Petkovich, M. and Drager,
U. C. (1999). Dorsal and ventral rentinoic territories
defined by retinoic acid synthesis, break-down and nuclear receptor
expression. Mech. Dev.
85,203
-214.[CrossRef][Medline]
McLaughlin, T., Hindges, R. and O'Leary, D. D.
(2003a). Regulation of axial patterning of the retina and its
topographic mapping in the brain. Curr. Opin.
Neurobiol. 13,57
-69.[CrossRef][Medline]
McLaughlin, T., Hindges, R., Yates, P. A. and O'Leary, D. D.
(2003b). Bifunctional action of ephrin-B1 as a repellent and
attractant to control bidirectional branch extension in dorsal-ventral
retinotopic mapping. Development
130,2407
-2418.
Mey, J., McCaffery, P. and Drager, U. C.
(1997). Retinoic acid synthesis in the developing chick retina.
J. Neurosci. 17,7441
-7449.
Mey, J., McCaffery, P. and Klemeit, M. (2001).
Sources and sink of retinoic acid in the embryonic chick retina: distribution
of aldehyde dehydrogenase activities, CRABP-I, and sites of retinoic acid
inactivation. Brain Res. Dev. Brain Res.
127,135
-148.[CrossRef][Medline]
Mic, F. A., Molotkov, A., Fan, X., Cuenca, A. E. and Duester,
G. (2000). RALDH3, a retinaldehyde dehydrogenase that
generates retinoic acid, is expressed in the ventral retina, otic vesicle and
olfactory pit during mouse development. Mech. Dev.
97,227
-230.[CrossRef][Medline]
Morgan, B. A. and Fekete, D. M. (1996).
Manipulating gene expression with replication-competent retroviruses.
Methods Cell Biol. 51,185
-218.[Medline]
Morrow, E. M., Belliveau, M. J. and Cepko, C. L.
(1998). Two phases of rod photoreceptor differentiation during
rat retinal development. J. Neurosci.
18,3738
-3748.
Mui, S. H., Hindges, R., O'Leary, D. D., Lemke, G. and Bertuzzi,
S. (2002). The homeodomain protein Vax2 patterns the
dorsoventral and nasotemporal axes of the eye.
Development 129,797
-804.
Peters, M. A. and Cepko, C. L. (2002). The
dorsal-ventral axis of the neural retina is divided into multiple domains of
restricted gene expression which exhibit features of lineage compartments.
Dev. Biol. 251,59
-73.[CrossRef][Medline]
Petropoulos, C. J. and Hughes, S. H. (1991).
Replication-competent retrovirus vectors for the transfer and expression of
gene cassettes in avian cells. J. Virol.
65,3728
-3737.
Ray, W. J., Bain, G., Yao, M. and Gottlieb, D. I.
(1997). CYP26, a novel mammalian cytochrome P450, is induced by
retinoic acid and defines a new family. J. Biol. Chem.
272,18702
-18708.
Reijntjes, S., Gale, E. and Maden, M. (2003).
Expression of the retinoic acid catabolising enzyme CYP26B1 in the chick
embryo and its regulation by retinoic acid. Gene Expr.
Patterns 3,621
-627.[CrossRef][Medline]
Reijntjes, S., Gale, E. and Maden, M. (2004).
Generating gradients of retinoic acid in the chick embryo: Cyp26C1 expression
and a comparative analysis of the Cyp26 enzymes. Dev.
Dyn. 230,509
-517.[CrossRef][Medline]
Sakurai, T., Wong, E., Drescher, U., Tanaka, H. and Jay, D.
G. (2002). Ephrin-A5 restricts topographically specific
arborization in the chick retinotectal projection in vivo. Proc.
Natl. Acad. Sci. USA 99,10795
-10800.
Sakuta, H., Suzuki, R., Takahashi, H., Kato, A., Shintani, T.,
Iemura, S., Yamamoto, T. S., Ueno, N. and Noda, M. (2001).
Ventroptin: a BMP-4 antagonist expressed in a double-gradient pattern in the
retina. Science 293,111
-115.
Schulte, D., Furukawa, T., Peters, M. A., Kozak, C. A. and
Cepko, C. L. (1999). Misexpression of the Emx-related
homeobox genes cVax and mVax2 ventralizes the retina and perturbs the
retinotectal map. Neuron
24,541
-553.[CrossRef][Medline]
Simon, D. K. and O'Leary, D. D. (1992a).
Development of topographic order in the mammalian retinocollicular projection.
J. Neurosci. 12,1212
-1232.[Abstract]
Simon, D. K. and O'Leary, D. D. (1992b).
Influence of position along the medial-lateral axis of the superior colliculus
on the topographic targeting and survival of retinal axons. Brain
Res. Dev. Brain Res. 69,167
-172.[CrossRef][Medline]
Simon, D. K. and O'Leary, D. D. (1992c).
Responses of retinal axons in vivo and in vitro to position-encoding molecules
in the embryonic superior colliculus. Neuron
9, 977-989.[CrossRef][Medline]
Sjoberg, M., Vennstrom, B. and Forrest, D.
(1992). Thyroid hormone receptors in chick retinal development:
differential expression of mRNAs for alpha and N-terminal variant beta
receptors. Development
114, 39-47.[Abstract]
Sperry, R. W. (1963). Chemoaffinity in the
orderly growth of nerve fiber patterns and connections. Proc. Natl.
Acad. Sci. USA 50,703
-710.
Suzuki, R., Shintani, T., Sakuta, H., Kato, A., Ohkawara, T.,
Osumi, N. and Noda, M. (2000). Identification of RALDH-3, a
novel retinaldehyde dehydrogenase, expressed in the ventral region of the
retina. Mech. Dev. 98,37
-50.[CrossRef][Medline]
Swindell, E. C., Thaller, C., Sockanathan, S., Petkovich, M.,
Jessell, T. M. and Eichele, G. (1999). Complementary domains
of retinoic acid production and degradation in the early chick embryo.
Dev. Biol. 216,282
-296.[CrossRef][Medline]
Tahayato, A., Dolle, P. and Petkovich, M.
(2003). Cyp26C1 encodes a novel retinoic acid-metabolizing enzyme
expressed in the hindbrain, inner ear, first branchial arch and tooth buds
during murine development. Gene Expr. Patterns
3, 449-454.[CrossRef][Medline]
Taimi, M., Helvig, C., Wisniewski, J., Ramshaw, H., White, J.,
Amad, M., Korczak, B. and Petkovich, M. (2004). A novel human
cytochrome P450, CYP26C1, involved in metabolism of 9-cis and all-trans
isomers of retinoic acid. J. Biol. Chem.
279, 77-85.
Umesono, K., Murakami, K. K., Thompson, C. C. and Evans, R.
M. (1991). Direct repeats as selective response elements for
the thyroid hormone, retinoic acid, and vitamin D3 receptors.
Cell 65,1255
-1266.[CrossRef][Medline]
Usala, S. J., Menke, J. B., Watson, T. L., Wondisford, F. E.,
Weintraub, B. D., Berard, J., Bradley, W. E., Ono, S., Mueller, O. T. and
Bercu, B. B. (1991). A homozygous deletion in the c-erbA beta
thyroid hormone receptor gene in a patient with generalized thyroid hormone
resistance: isolation and characterization of the mutant receptor.
Mol. Endocrinol. 5,327
-335.
Wagner, M., Han, B. and Jessell, T. M. (1992).
Regional differences in retinoid release from embryonic neural tissue detected
by an in vitro reporter assay. Development
116, 55-66.[Abstract]
White, J. A., Ramshaw, H., Taimi, M., Stangle, W., Zhang, A.,
Everingham, S., Creighton, S., Tam, S. P., Jones, G. and Petkovich, M.
(2000). Identification of the human cytochrome P450, P450RAI-2,
which is predominantly expressed in the adult cerebellum and is responsible
for all-trans-retinoic acid metabolism. Proc. Natl. Acad. Sci.
USA 97,6403
-6408.
Wilkinson, D. G. (2001). Multiple roles of EPH
receptors and ephrins in neural development. Nat. Rev.
Neurosci. 2,155
-164.[Medline]
Wilson, J. G., Roth, C. B. and Warkany, J.
(1953). An analysis of the syndrome of malformations induced by
maternal vitamin A deficiency. Effects of restoration of vitamin A at various
times during gestation. Am. J. Anat.
92,189
-217.[CrossRef][Medline]
Yates, P. A., Roskies, A. L., McLaughlin, T. and O'Leary, D.
D. (2001). Topographic-specific axon branching controlled by
ephrin-As is the critical event in retinotectal map development. J.
Neurosci. 21,8548
-8563.
Yoshida, A., Rzhetsky, A., Hsu, L. C. and Chang, C.
(1998). Human aldehyde dehydrogenase gene family. Eur.
J. Biochem. 251,549
-557.[Medline]
Zenke, M., Munoz, A., Sap, J., Vennstrom, B. and Beug, H.
(1990). v-erbA oncogene activation entails the loss of
hormone-dependent regulator activity of c-erbA. Cell
61,1035
-1049.[CrossRef][Medline]
Zhao, D., McCaffery, P., Ivins, K. J., Neve, R. L., Hogan, P.,
Chin, W. W. and Drager, U. C. (1996). Molecular
identification of a major retinoic-acid-synthesizing enzyme, a
retinaldehyde-specific dehydrogenase. Eur. J. Biochem.
240, 15-22.[Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
J. T. Wang, N. J. Kunzevitzky, J. C. Dugas, M. Cameron, B. A. Barres, and J. L. Goldberg Disease Gene Candidates Revealed by Expression Profiling of Retinal Ganglion Cell Development J. Neurosci., August 8, 2007; 27(32): 8593 - 8603. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Corbo, C. A. Myers, K. A. Lawrence, A. P. Jadhav, and C. L. Cepko A typology of photoreceptor gene expression patterns in the mouse PNAS, July 17, 2007; 104(29): 12069 - 12074. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N. Shelton, I. T. Sandoval, A. Eisinger, S. Chidester, A. Ratnayake, C. M. Ireland, and D. A. Jones Up-regulation of CYP26A1 in Adenomatous Polyposis Coli-Deficient Vertebrates via a WNT-Dependent Mechanism: Implications for Intestinal Cell Differentiation and Colon Tumor Development. Cancer Res., August 1, 2006; 66(15): 7571 - 7577. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Molotkov, N. Molotkova, and G. Duester Retinoic acid guides eye morphogenetic movements via paracrine signaling but is unnecessary for retinal dorsoventral patterning Development, May 15, 2006; 133(10): 1901 - 1910. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||