|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 2 November 2005
doi: 10.1242/dev.02093
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biology, Box 35 1800, University of Washington, Seattle, WA
98195, USA
2 Drosophila Genetics and Epigenetics, Institut Pasteur, 25-28 rue du Docteur
Roux, 75724 Paris, France
* Author for correspondence (e-mail: margrit{at}u.washington.edu)
Accepted 19 September 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Ultraspiracle, Ecdysone receptor, Broad-complex, Timing of differentiation, Imaginal discs
| Introduction |
|---|
|
|
|---|
Although critically important in the steroid response of larval tissues,
the genes of the ecdysone cascade appear to have less impact in some imaginal
tissues (Kozlova and Thummel,
2002
). When the ecdysone receptor is non functional, as for
example in loss-of-function USP clones in the wing imaginal disc, activation
of early genes fails (Schubiger and
Truman, 2000
). But, surprisingly, the sensory neurons in the
margin actually differentiate precociously, and can even now differentiate in
the absence of 20E. Thus, in normal development USP represses sensory neuron
development and 20E acts to remove this repression. Based on our results we
proposed that there are two types of ecdysone response elements: inductive
ones, in which the liganded receptor strongly activates transcription of
target genes, and permissive ones, in which the unliganded ecdysone receptor
represses transcription until binding of 20E relieves the repression
(Cherbas and Cherbas, 1996
),
thereby allowing other factors at the promoter to regulate transcription. The
important difference between the inductive and permissive response elements is
that in the absence of a functional receptor there will be no activation of
the gene controlled by the inductive ecdysone response element, whereas in the
case of the permissive ecdysone response element, the repression is absent and
the gene is activated precociously and independent of the hormone. Its
activation is now dependent on the presence of other transcription factors
bound to regulatory regions of the gene.
The precocious sensory neuron differentiation found in loss-of-function USP
clones reveals a key node where the ecdysone pathway intersects the neurogenic
pathway in the imaginal discs. During the third instar, proneural genes are
expressed in clusters of cells that are competent to form sensory organ
precursors (SOPs) (Skeath and Carroll,
1991
; Cubas et al.,
1991
). As development progresses one or a few cell(s) of the
cluster are singled out to become the SOP. The selection of the SOP is under
the control of the Notch signaling pathway
(Kimble and Simpson, 1997
;
Artavanis-Tsakonas et al.,
1999
; Lai, 2004
).
Through the process of lateral inhibition, cells receiving the Notch ligand
Delta activate Enhancer of split [E(spl)] genes and are
inhibited from differentiating into a SOP. In the cell destined to form the
SOP the proneural genes accumulate and allow the cell to take on the neural
fate. Recently Nolo et al. (Nolo et al.,
2000
) and Jafar-Nejad et al.
(Jafar-Nejad et al., 2003
)
showed that senseless (sens; also known as Ly) is
also involved in SOP formation. The proneural genes are required to activate
sens that in turn activates the proneural genes and promotes the
accumulation of their gene products to high levels in the SOPs
(Nolo et al., 2000
). Nolo et
al. (Nolo et al., 2000
) also
demonstrated that sens is required and sufficient for sensory organ
differentiation. High levels of SENS activate the proneural genes but low
levels serve to repress these genes
(Jafar-Najad et al., 2003
),
leading these cells down the epidermal pathway. Thus both Notch-signaling and
sens function as switches to determine neural versus epidermal
fate.
We have used loss of function of USP or EcR to determine that both components of the ecdysone receptor complex are needed to repress differentiation of the sensory organs in the wing disc. This repression is indirect in the margin and is a consequence of de-repression of one of the ecdysone target genes, broad [br, formerly called broad-complex (Br-C)]. We show that BR is required for sens expression in the wing margin. Sensilla born during other developmental windows, such as the campaniform sensilla on the third vein, are also repressed by EcR/USP, but in this case the blockade is br independent and occurs after SOP maturation, blocking its divisions to form the cells of the sensory organ. We propose that 20E acts as a timer for the development of sensory neurons and that the correct timing is necessary for normal pathfinding of their axons.
| Materials and methods |
|---|
|
|
|---|
Clones were induced with a 60-minute heat shock at 37°C in the progeny of the following crosses: (1) w1118 Ub-GFP RpS52 FRT18A/FM7a x usp2 (or usp3) hs-N-myc FRT18A/Y; P[usp+] Tb/MKRS, hs-FLP; (2) w1118 Ub-GFP RpS52 FRT18A/FM7a; A101/MKRS x usp2 hs-N-myc FRT18A/Y; P[usp+] Tb/MKRS, hs-FLP; (3) w1118 Ub-GFP RpS52 FRT18A/FM7a; ac-lacZ ry506 x usp2 hs-N-myc FRT18A/Y; P[usp+] Tb/MKRS, hs-FLP; (4) w1118 Ub-GFP RpS52 FRT18A/FM7a; Tb/MKRS, hs-FLP x y npr3 FRT18A/y2Y67g; (5) y npr3 FRT19A/FM7 GG x Tub-GAL80, hsFLP, FRT19A/Y; Tub-GAL4, UAS-mCD8::GFP/MKRS.
To misexpress genes we used the GAL4/UAS system
(Brand and Perrimon, 1993
) with
C96-GAL4 (from B. Edgar), en-GAL4, dpp-GAL4 and
MS1096-GAL4 drivers and UAS-GFP, UAS-br-Z isoforms (from X.
Zhou), UAS-IR-EcRcore (see below),
UAS-EcR-B1W650A (from L. Cherbas), UAS-sc
(scute: from H. Bellen), and UAS-sens (from H. Bellen)
responder lines. A101 (P[lArB]A101.1F3 ry503;
from the Bloomington Stock Center) and ac-lacZ (from P. Simpson) were
used to mark SOPs and proneural expression.
UAS-IR-EcR-core constructs
A cDNA fragment was PCR amplified using the pCA1
(Antoniewski et al., 1996
)
plasmid as a template and primers AAGAATTCGGTACCAGGATGGCTATGAG and
TTAGATCTCCTCGAGGAACTTG. The resulting PCR product corresponding to a 663 bp
fragment between positions 2354 and 3017 relative to the EcR-B1 cDNA sequence
(GenBank M74048) was cloned in the pUAST vector
(Brand and Perrimon, 1993
) in
two consecutive steps, first in a reverse orientation between BglII
and KpnI, then in a forward orientation between EcoRI and
BglII. Recombinant UAS-IR constructs were transformed at
30°C in Sure (Stratagene)-competent bacteria to minimize DNA recombination
and screened using appropriate restriction enzyme digestions. Transgenic flies
for the UAS-IR-EcR-core constructs were generated as previously
described using a w1118 strain as a recipient stock
(Rubin and Spradling,
1982
).
In vitro cultures
In vitro cultures were set up as described by Schubiger and Truman
(Schubiger and Truman, 2000
)
using Shield and Sang 3M medium (Sigma). The hormone 20-hydroxyecdysone
(Sigma) was added to the cultures at a concentration of 1 µg/ml. To ensure
that the correct stage of larvae were used, early wandering larvae were staged
by (1) collecting larvae 1-3 hours after the onset of wandering, (2) their
full gut and (3) the morphology of the wing disc at dissection; mid-wandering
larvae were selected by their half full guts.
Antibodies, immunohistochemistry and imaging
We used the following antibodies: guinea pig anti-SENS (1:1000, a gift from
H. Bellen), rabbit anti-ß-galactosidase (1:1000), mouse anti-EcR common
and mouse anti-EcR-B1 ascites (1:10000, a gift from C. Thummel), rabbit or
mouse anti-BR-Z1 (1:3000 and 1:100; gifts from J.-A. Lepesant and G. Guild,
respectively), mouse anti-Achaete (1:10; a gift from T. Orenic) and 22C10
(1:100, Developmental Studies Hybridoma Bank, Iowa City, IA, USA). We also
used Alexa (Molecular Probes) secondary antibodies against mouse and rabbit,
as well as Texas-Red- and FITC-conjugated antibodies from Jackson
ImmunoResearch. Images were collected on a BioRad 600 confocal microscope and
processed with Adobe Photoshop software.
| Results |
|---|
|
|
|---|
The reduction of EcR levels also induced precocious differentiation of
sensory neurons in the margin (in 27/27 discs, 0-4 hours APF; compare
Fig. 1D' and E') as
well as the sensilla on the third vein (compare
Fig. 1F and G) when
UAS-IR-EcR was driven either by C96-GAL4 or
dpp-GAL4. The EcR loss-of-function phenotypes were similar to those
observed in loss of function USP clones
(Schubiger and Truman, 2000
).
This similarity suggests that in normal development the repression is indeed
due to the unliganded EcR/USP dimer.
|
|
|
|
From these results we predicted that loss of function of BR-Z1 should
repress sens expression. To test this we made
npr3 clones in the wild type or in a Minute
background using the FRT/FLP system. npr3 clones eliminate
the function of the entire br complex
(Kiss et al., 1988
). Since
Bayer et al. (Bayer et al.,
1997
) showed that some BR isoforms can compensate for the function
of other BR isoforms, we chose to use the br null allele
npr3 to avoid functional redundancy and any interactions
between the BR isoforms. We observed that in clones lacking br
function both the high accumulation of SENS in the SOPs and the low levels of
SENS expression in the posterior margin failed to occur
(Fig. 4A,A'; 16/16
clones). As a consequence the marginal sensory neurons failed to
differentiate. The loss of the marginal neurons was permanent since we never
observed chemosensory bristles in adult wings with npr3
clones encompassing the wing margin (data not shown). Other SOPs situated on
the third vein however, were insensitive to loss of br and expressed
SENS (Fig. 4A; see below).
sens expression occurs in two steps with a low level seen prior to BR-Z1 expression followed by the high accumulation of SENS in the SOPs. Thus we asked if BR-Z2, -Z3 or -Z4 could induce low levels of sens expression. We used dpp-GAL4 to drive the different br isoforms along the presumptive third vein and tested for SENS protein at the intersection of the dpp expression domain with the wing margin (Fig. 4B-F). As expected, BR-Z1 expression led to ectopic SENS expression with several cells showing high accumulation typical for SOPs. This ectopic accumulation happened before SENS accumulation in the SOPs along the anterior margin (Fig. 4C). BR-Z2 expression resulted in early larval lethality so we raised the animals at 18°C until the beginning of the third instar and then transferred them to room temperature. In such animals the misexpression of BR-Z2 induced ectopic SENS at the intersection of the dpp domain with the margin in about 50% of the discs analyzed, but we never observed precocious high accumulation in the SOPs (Fig. 4D). Misexpression of BR-Z3 also led to a widening of the SENS expression domain, but also without precocious high accumulation (Fig. 4E). Expressing BR-Z4 did not induce ectopic SENS expression (Fig. 4F).
These results from loss and gain of function of br show that it is required to activate sens in the margin, but is not required for sens activation in the early born SOPs on the third vein.
Differentiation of early born neurons is also controlled by EcR/USP
From our data on loss-of-function npr3 clones, it was
obvious that sens activation that is required for the sensilla
campaniformia along the third vein was not dependent on BR function
(Fig. 4A,A') and raised
the question of how ecdysone controls the differentiation of these sensilla.
We expressed the UAS-IR-EcR construct along the third vein by using
the dpp-GAL4 driver to knockdown EcR levels.
Fig. 1F and G show wing discs
at 0 hours APF. Precocious differentiation of the third vein sensilla was
induced by the loss of EcR function. Similarly in loss-of-function USP clones
the third vein sensilla differentiated early (data not shown). In contrast to
the later birth of the chemosensory precursors, the SOPs of some of the third
vein sensilla are born 20-30 hours before pupariation
(Huang et al., 1991
) at a time
when the ecdysone levels are very low. Thus it is unlikely that the unliganded
receptor blocks the same step in neurogenesis as we saw for the margin
SOPs.
|
The timing of production of the cells that make up the giant sensillum on the radius (GSR) and the anterior cross vein (ACV) sensillum were examined (Fig. 6). For the GSR, in discs of early wandering larvae, we observed either one or two A101-positive nuclei, indicating that at this stage the SOP of the GSR is about to or has just divided for the first time. After 24 hours in culture without 20E about half of the GSRs remained at the SOP stage, whereas the other half had progressed through the subsequent divisions to produce the four cells of the sensory organ (Fig. 6A). When the in vitro cultures were started with discs from mid-wandering larvae, at which stage the GSR had consistently gone through the first division, we observed that in the absence of 20E the second division occurred in the majority of cases (Fig. 6B). The few cases that did not undergo the second division were presumably placed in culture prior to the first division of the GSR. For the SOP of the ACV sensillum that develops slightly later than the GSR-SOP we found a similar pattern (Fig. 6C,D). From these data, we suggest that the early born SOPs have an ecdysone-dependent `gate' just prior to their first division, and that after that time ecdysone is no longer required for the subsequent divisions.
Our in vitro cultures also gave us further insight into the differentiation
of the chemosensory neurons on the margin. SENS is normally expressed in two
broad bands along the margin (Fig.
5D). In late third instar discs the SOPs in the anterior margin
have accumulated SENS to high levels, whereas non-SOP cells expressed SENS
weakly (Fig. 5E). When we
initiated the in vitro cultures with A101 discs, ß-gal was
expressed in the SOPs, whereas SENS was still only expressed at its early low
level. Interestingly, after in vitro culture without ecdysone
(Fig. 5C-C'') A101
expression remained but SENS did not accumulate in the SOPs, indicating that
the SOPs had formed but were not fully mature. This is in agreement with Nolo
et al. (Nolo et al., 2000
) who
found that in sens mutant clones a SOP is nevertheless selected and
initially accumulates AC/SC. Here, we furthermore demonstrate that the failure
to accumulate SENS in the SOPs is dependent on a functional ecdysone receptor
(Fig. 5F). When a wing disc
expressing UAS-IR-EcR under the control of dpp-GAL4 was
cultured in vitro without ecdysone, SENS accumulated in the margin only at the
intersection with the dpp domain.
|
| Discussion |
|---|
|
|
|---|
Ecdysone control of sensory organ differentiation in the margin
In our previous work (Schubiger and
Truman, 2000
) we found that adult chemosensory neurons on the wing
margin underwent precocious differentiation in loss-of-USP clones. To
understand which step is repressed by the EcR/USP complex we analyzed the
early expression patterns of a set of genes involved in neuron differentiation
in such mutant clones. In the absence of USP function the early pattern of
Achaete (AC) expression in the margin is unaffected. In contrast, both NEUR
(as visualized by A101) and SENS are expressed in usp mutant cells
before they are detected in the surrounding wild-type tissue
(Fig. 2). Our in vitro
experiments revealed that A101 expression that is already on at the time we
set up the cultures, remains on through the culture period, but that there is
a block by EcR/USP at the level of sens expression that prevents the
maturation of the SOPs of the chemosensory neurons in the wing margin. The
block is released once the hormone titers rise.
The repressive function of the unliganded receptor does not act directly on
the genes we tested. We have shown that the block of SOP differentiation is
controlled through BR-Z1, and that br function is required for the
activation of sens, a gene necessary and sufficient for sensory organ
differentiation (Nolo et al.,
2000
). Thus expressing BR-Z1 or SENS early in the margin allows
the inhibition from the unliganded ecdysone receptor to be by-passed and the
sensory neurons in the margin to differentiate precociously. When SENS is
misexpressed we found that clusters of extra neurons differentiate in the
region of high driver expression (Fig.
3B'). This is in agreement with reports from Nolo et al.
(Nolo et al., 2000
) and
Jafar-Nejad et al. (Jafar-Nejad et al.,
2003
) who showed that high levels of SENS activate the proneural
genes and promote the formation of SOPs. By contrast, when BR-Z1 is
misexpressed in the margin we observed a more normal pattern of sensory neuron
arrangement (Fig. 3D')
that was very similar to what we observed in loss-of-function USP or EcR cells
(Fig. 1E). This indicates that
BR-Z1 does not induce the formation of SOPs but rather causes the
up-regulation of SENS in cells that have already committed to the SOP fate.
Occasionally expressing BR-Z1 in the margin led to the differentiation of a
sensory neuron in the posterior margin, normally devoid of neurons. It is
possible that in such a situation BR-Z1 misexpression can at times lead to
sufficiently high expression of SENS to cause SOP differentiation.
Loss-of-function of BR demonstrated the requirement for BR to activate the high levels of SENS in the SOPs, as well as the low levels in the posterior margin, but without molecular data we do not know if br is directly activating sens. Since BR-Z1 normally appears later than the initial low expression of SENS, we propose (Fig. 7) that early SENS expression is most probably controlled by BR-Z2. It is expressed shortly after the molt to the third instar (J.W.T., unpublished) and we have shown that ectopic BR-Z2 expression induces low levels of SENS (Fig. 4D). BR-Z3 that also induces SENS when ectopically expressed (Fig. 4E) may induce low levels of SENS as well, but since BR-Z3 is normally expressed at very low levels in the wing disc, we think it plays a minor role. BR-Z1 then is needed for the accumulation of SENS in the mature SOPs.
|
Sensory neuron differentiation is controlled by a steroid-dependent gate
The SOPs are born in a specific temporal sequence in the wing disc
(Huang et al., 1991
). The
first SOPs arise in the third instar, 20-30 hours before pupariation; they
include GSR, ACV and L3-2 along the third vein
(Fig. 4A). The SOPs of the
margin arise later, at 10-12 hours before pupariation, so they are at a very
different stage from that of the early born SOPs at the time metamorphosis
begins. Since the unliganded receptor is acting as a repressor we postulate
that the block must be occurring at different times during the progression of
sensory organ differentiation for these two groups of sensilla
(Fig. 7). Based on our genetic
studies, the ecdysone-sensitive arrest for the chemosensory sensilla of the
margin occurs in the up-regulation of SENS as the SOP is undergoing
maturation. For the early born sensilla, however, SENS levels are already
elevated before the rise in 20E and are not dependent on BR function. For
these early born sensilla the ecdysone-sensitive arrest occurs after high SENS
expression but prior to the division of the SOP
(Fig. 7). We think that for
different sets of sensilla the imposition of an ecdysone-sensitive arrest at
different points in development is important to coordinate the differentiation
of the sensilla. Such a mechanism would ensure that the outgrowing axons begin
to elongate in a choreographed manner leading to the correct axon pathways and
to their finding of the correct targets in the CNS according to their
physiological function (Palka et al.,
1986
). This idea is supported by the observation that the axons of
sensilla forced to differentiate precociously by the absence of a functional
ecdysone receptor or by early expression of BR-Z1 or SENS often take abnormal
routes (for example, Fig.
3D').
A recent study by Niwa et al. (Niwa et
al., 2004
) demonstrated that ecdysone is also acting as a timer
for the formation of the chordotonal and Johnston's organ as well as for the
initiation of the morphogenetic furrow. These structures arise early in the
third instar (80 hours after egg laying) and appear to be under the control of
the small ecdysone peak at that time
(Andres et al., 1993
). In the
case of the leg chordotonal organ, ecdysone appears to be controlling the
proneural gene atonal (ato). We do not know yet if this
control also occurs via de-repression as we see for the wing.
The subsequent progression of the morphogenetic furrow is also dependent on
ecdysone (Brennan et al.,
1998
). This action of ecdysone has been proposed not to occur via
EcR (Brennan et al., 2001
).
However, Zelhof et al. (Zelhof et al.,
1997
) showed that loss of USP leads to an advancement of the
furrow and precocious differentiation of the photoreceptors. Bateman and
McNeill (Bateman and McNeill,
2004
) recently reported that the progression of the morphogenetic
furrow, as well as the timing of differentiation of the chordotonal organs in
the leg, are controlled by the insulin receptor (InR)/Tor pathway, with
increased InR signaling leading to precocious differentiation. In the wing
margin, by contrast, increasing or decreasing InR signaling did not affect the
timing of differentiation of the chemosensory neurons (M.S., unpublished).
Thus there must be multiple temporal control mechanisms for sensory
structures. Our results have demonstrated repression of sensory organs by the
unliganded ecdysone receptor at the end of the third instar, but do not rule
out additional steps controlled by ecdysone or other factors. It remains to be
elucidated which timer(s) is used when, and for which sensory structures.
In holometabolous insects functional larval tissues are replaced by the
differentiating imaginal ones. The endocrine system is acting on larval
tissues composed of differentiated cells that are thus in an equivalent state
to initiate programs such as cell death and neuronal remodeling. Here
EcR/USP's role is activational (Yin and
Thummel, 2005
; Lee et al.,
2000
; Schubiger et al.,
1998
). For the differentiation of the imaginal tissues the
endocrine system faces a varied cellular landscape where some cells may still
be dividing while other have begun to differentiate. In these tissues the
unliganded receptor acts as a repressor to interrupt the sequence of
differentiation at different points in order to coordinate the response to the
rising 20E titers. Release of repression by 20E may therefore function as a
`gate' at the onset of metamorphosis and thus would enable development of
imaginal tissues to be coordinated and tightly controlled by the rising
ecdysone titers. In metamorphosing amphibians we see a similar situation with
functional larval tissues such as the tail and the gills dying and adult limbs
and lungs developing in response to thyroid hormone. We would not be surprised
to find that the thyroid hormone receptor is activational in the larval
tissues but that the forming adult tissues are controlled through
de-repression.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Andres, A. J., Fletcher, J. C., Karim, F. D. and Thummel, C. S. (1993). Molecular analysis of the initiation of insect metamorphosis: a comparative study of Drosophila ecdysteroid-regulated transcription. Dev. Biol. 160,388 -404.[CrossRef][Medline]
Antoniewski, C., Mugat, B., Delbac, F. and Lepesant, J. A. (1996). Direct repeats bind the EcR/USP receptor and mediate ecdysteroid responses in Drosophila melanogaster. Mol. Cell. Biol. 16,2977 -2986.[Abstract]
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Ashburner, M., Chihara, C., Meltzer, P. and Richards, G.
(1974). Temporal control of puffing activity in polytene
chromosomes. Cold Spring Harb. Symp. Quant. Biol.
38,655
-662.
Bateman, J. M. and McNeill, H. (2004). Temporal control of differentiation by the insulin receptor/Tor pathway in Drosophila. Cell 119,87 -96.[CrossRef][Medline]
Bayer, C. A., von Kalm, L. and Fristrom, J. W. (1997). Relationships between protein isoforms and genetic functions demonstrate functional redundancy at the Broad-Complex during Drosophila metamorphosis. Dev. Biol. 187,267 -282.[CrossRef][Medline]
Bellen, H. J., O'Kane, C. J., Wilson, C., Grossniklaus, U.,
Pearson, R. K. and Gehring, W. J. (1989). P-element-mediated
enhancer detection: a versatile method to study development in Drosophila.Genes Dev. 3,1288
-1300.
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Brennan, C. A., Ashburner, M. and Moses, K. (1998). Ecdysone pathway is required for furrow progression in the developing Drosophila eye. Development 125,2653 -2664.[Abstract]
Brennan, C. A., Li, T. R., Bender, M., Hsiung, F. and Moses, K. (2001). Broad-complex, but not ecdysone receptor, is required for progression of the morphogenetic furrow in the Drosophila eye. Development, 128,1 -11.[Abstract]
Cherbas, L., Hu, X., Zhimulev, I., Belyaeva, E. and Cherbas,
P. (2003). EcR isoforms in Drosophila: testing
tissue-specific requirements by targeted blockade and rescue.
Development 130,271
-284.
Cherbas, P. and Cherbas, L. (1996). Molecular aspects of ecdysteroid hormone action. In Metamorphosis (ed. L. I. Gilbert, J. R. Tata and B. G. Atkinson), pp. 175-221. New York: Academic Press.
Cubas, P., de Celis, J. F., Campuzano, S. and Modolell, J.
(1991). Proneural clusters of achaete-scute expression and the
generation of sensory organs in the Drosophila imaginal wing disc.
Genes Dev. 5,996
-1008.
Ghbeish, N., Tsai, C. C., Schubiger, M., Zhou, J. Y., Evans, R.
M. and McKeown, M. (2001). The dual role of ultraspiracle,
the Drosophila retinoid X receptor, in the ecdysone response.
Proc. Natl. Acad. Sci. USA
98,3867
-3872.
Giangrande, A. (1995). Proneural genes influence gliogenesis in Drosophila. Development 121,429 -438.[Abstract]
Gibbs, S. M. and Truman, J. W. (1998). Nitric oxide and cyclic GMP regulate retinal patterning in the optic lobe of Drosophila. Neuron 20,83 -93.[CrossRef][Medline]
Gustafson, K. and Boulianne, G. L. (1996). Distinct expression patterns detected within individual tissues by the GAL4 enhancer trap technique. Genome 39,174 -182.[Medline]
Henrich, V. C., Szekely, A. A., Kim, S. J., Brown, N. E., Antoniewski, C., Hayden, M. A., Lepesant, J. A. and Gilbert, L. I. (1994). Expression and function of the ultraspiracle (usp) gene during development of Drosophila melanogaster. Dev. Biol. 165,38 -52.[CrossRef][Medline]
Henrich, V. C., Rybczynski, R. and Gilbert, L. I. (1999). Peptide hormones, steroid hormones, and puffs: mechanisms and models in insect development. Vitam. Horm. 55, 73-125.[Medline]
Huang, F., Dambly-Chaudiere, C. and Ghysen, A.
(1991). The emergence of sense organs in the wing disc of
Drosophila. Development
111,1087
-1095.
Jafar-Nejad, H., Acar, M., Nolo, R., Lacin, H., Pan, H.,
Parkhurst, S. M. and Bellen, H. J. (2003). Senseless acts as
a binary switch during sensory organ precursor selection. Genes
Dev. 17,2966
-2978.
Kimble, J. and Simpson, P. (1997). The LIN-12/Notch signaling pathway and its regulation. Annu. Rev. Cell Dev. Biol. 13,333 -361.[CrossRef][Medline]
Kiss, I., Beaton, A. H., Tardiff, J., Fristrom, D. and Fristrom,
J. W. (1988). Interactions and developmental effects of
mutations in the Broad-Complex of Drosophila melanogaster.Genetics 118,247
-259.
Koelle, M. R., Talbot, W. S., Segraves, W. A., Bender, M. T., Cherbas, P. and Hogness. D. S. (1991). The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily. Cell 67, 59-77.[CrossRef][Medline]
Kozlova, T. and Thummel, C. S. (2002). Spatial
patterns of ecdysteroid receptor activation during the onset of
Drosophila metamorphosis. Development
129,1739
-1750.
Lai, E. C. (2004), Notch signaling: control of cell communication and cell fate. Development 31,965 -973.
Lee, T. and Luo, L. (1999). Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron 22,451 -461.[CrossRef][Medline]
Lee, T., Marticke, S., Sung, C., Robinow, S. and Luo, L. (2000). Cell-autonomous requirement of the USP/EcR-B ecdysone receptor for mushroom body neuronal remodeling in Drosophila. Neuron 28,807 -818.[CrossRef][Medline]
Murray, M. A., Schubiger, M. and Palka, J. (1984). Neuron differentiation and axon growth in the developing wing of Drosophila melanogaster. Dev. Biol. 104,259 -273.[CrossRef][Medline]
Niwa, N., Hiromi, Y. and Okabe, M. (2004). A conserved developmental program for sensory organ formation in Drosophila melanogaster. Nat. Genet. 36,293 -297.[CrossRef][Medline]
Nolo, R., Abbott, L. A. and Bellen, H. J. (2000). Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila.Cell 102,349 -362.[CrossRef][Medline]
Oro, A. E., McKeown, M. and Evans, R. M. (1990). Relationship between the product of the Drosophila ultraspiracle locus and the vertebrate retinoid X receptor. Nature 347,298 -301.[CrossRef][Medline]
Oro, A. E., McKeown, M. and Evans, R. M. (1992). The Drosophila retinoid X receptor homolog ultraspiracle functions in both female reproduction and eye morphogenesis. Development 115,449 -462.[Abstract]
Palka, J., Malone, M., Ellison, R. L. and Wigston, D. J. (1986). Central projections of identified Drosophila sensory neurons in relation to their time of development. J. Neurosci. 6,1822 -1830.[Abstract]
Riddiford, L. M. (1993). Hormones and Drosophila development. In The Development of Drosophila melanogaster (ed. M. Bate and A. Martinez-Arias), pp.899 -939. New York: Cold Spring Harbor Laboratory Press.
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element
vectors. Science 218,348
-353.
Schubiger, M. and Truman, J. W. (2000). The RXR ortholog USP suppresses early metamorphic processes in Drosophila in the absence of ecdysteroids. Development 127,1151 -1159.[Abstract]
Schubiger, M., Wade, A. A., Carney, G. E., Truman, J. W. and Bender, M. (1998). Drosophila EcR-B ecdysone receptor isoforms are required for larval molting and for neuron remodeling during metamorphosis. Development 125,2053 -2062.[Abstract]
Skeath, J, B. and Carroll, S. B. (1991).
Regulation of achaete-scute gene expression and sensory organ pattern
formation in the Drosophila wing. Genes Dev.
5, 984-995.
Sutherland, J. D., Kozlova, T., Tzertzinis, G. and Kafatos, F.
C. (1995). Drosophila hormone receptor 38, a second partner
for Drosophila USP suggests an unexpected role for nuclear receptors
of the nerve growth factor-induced protein B type. Proc. Natl.
Acad. Sci. USA 92,7966
-7970.
Thomas, H. E., Stunnenberg, H. G. and Stewart, A. F. (1993). Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle. Nature 362,471 -475.[CrossRef][Medline]
Thummel, C. S. (1996). Files on steroids - Drosophila metamorphosis and the mechanisms of steroid hormone action. Trends Genet. 12,306 -310.[CrossRef][Medline]
Xu, T. and Rubin, G. M. (1993). Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117,1223 -1237.[Abstract]
Yao, T. P., Forman, B. M., Jiang, Z., Cherbas, L., Chen, J. D., McKeown, M., Cherbas, P. and Evans, R. M. (1993). Functional ecdysone receptor is the product of EcR and ultraspiracle genes. Nature 366,476 -479.[CrossRef][Medline]
Yin, V. P. and Thummel, C. S. (2005). Mechanisms of steroid-triggered programmed cell death in Drosophila.Semin. Cell Dev. Biol. 16,237 -243.[CrossRef][Medline]
Zelhof, A. C., Ghbeish, N., Tsai, C., Evans, R. M. and McKeown, M. (1997). A role for ultraspiracle, the Drosophila RXR, in morphogenetic furrow movement and photoreceptor cluster formation. Development 124,2499 -2506.[Abstract]
Zhou, X., Zhou, B., Truman, J. W. and Riddiford, L. M.
(2004). Overexpression of broad: a new insight into its role in
the Drosophila prothoracic gland cells. J. Exp.
Biol. 207,1151
-1161.
This article has been cited by other articles:
![]() |
C. K. Mirth, J. W. Truman, and L. M. Riddiford The Ecdysone receptor controls the post-critical weight switch to nutrition-independent differentiation in Drosophila wing imaginal discs Development, July 15, 2009; 136(14): 2345 - 2353. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ninov, D. A. Chiarelli, and E. Martin-Blanco Extrinsic and intrinsic mechanisms directing epithelial cell sheet replacement during Drosophila metamorphosis Development, January 15, 2007; 134(2): 367 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Flatt, L. L. Moroz, M. Tatar, and A. Heyland Comparing thyroid and insect hormone signaling Integr. Comp. Biol., December 1, 2006; 46(6): 777 - 794. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. D. Brown, L. Cherbas, P. Cherbas, and J. W. Truman Use of time-lapse imaging and dominant negative receptors to dissect the steroid receptor control of neuronal remodeling in Drosophila Development, January 15, 2006; 133(2): 275 - 285. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||