|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 9 November 2005
doi: 10.1242/dev.02150
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 The University of Texas M.D. Anderson Cancer Center, Department of
Biochemistry and Molecular Biology, 1515 Holcombe Boulevard, Unit 1000,
Houston, TX 77030, USA
2 The Genes and Development Graduate Program
(http://www.mdanderson.org/genedev)
3 The University of Texas at Austin, Patterson labs 532, Section of Molecular
Cell and Developmental Biology, Institute for Cellular and Molecular Biology,
2401 W24th and Speedway, Austin, TX 78712, USA
Author for correspondence (e-mail:
abergman{at}mdanderson.org)
Accepted 5 October 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Mis-specification, Cell death, Transformation, Bicoid, Oskar, Hid, Drosophila
| Introduction |
|---|
|
|
|---|
During abnormal development, cell death is also a contributing factor to
the phenotypes of many mutants in Drosophila. This was first noted
more that 35 years ago for mutants affecting imaginal development
(Fristrom, 1968
;
Fristrom, 1969
) (reviewed by
Bonini and Fortini, 1999
), and
it was later also found in mutants affecting embryonic patterning, including
maternal-effect genes, gap genes, pair-rule genes and segment-polarity genes
(Lehmann et al., 1986
;
Tepass et al., 1994
;
Magrassi and Lawrence, 1988
;
Martinez-Arias and Ingham,
1985
; Perrimon and Mahowald,
1987
; Klingensmith et al.,
1989
; Bejsovec and Wieschaus,
1993
; Pazdera et al.,
1998
; Hughes and Krause,
2001
). In these mutants, entire regions of the developing organism
are deleted (Nüsslein-Volhard and
Wieschaus, 1980
). The underlying cause for cell death in these
mutants is unknown, but apparently cells are able to monitor their ability to
specify and differentiate correctly. If a cell fails to complete its normal
developmental program (from now on referred to as mis-specified cell), it
undergoes cell death.
However, it is not always the case that mis-specified cells die. Instead, a
transformation to adopt a different cell fate has often been observed. For
example, in embryos obtained from bicoid mutant females, the acron is
transformed to become a telson (see below). Other examples include
sevenless (sev) and bride of sevenless
(boss) mutations, which cause a transformation of the R7
photoreceptor to a cone cell during eye development in the fly
(Tomlinson and Ready, 1986
;
Reinke and Zipursky, 1988
).
The factors influencing the choice between cell death and cell fate
transformation in various mutants are not well understood. To address this
issue, we initiated an analysis of the cell death and transformation
phenotypes of the maternal effect mutants bicoid and oskar
during embryogenesis.
During Drosophila development, the wild-type embryo generates five
distinct regions along the anteroposterior axis that are visible in the larval
cuticle as acron, head, thorax, abdomen and telson
(Fig. 1A,D)
(Nüsslein-Volhard et al.,
1987
). The maternal effect mutants bicoid and
oskar severely disrupt anteroposterior patterning. bicoid
mutant females produce embryos (from now on referred to as bicoid
mutants) that lack head and thorax, and a duplicated telson replaces the acron
at the anterior tip of the embryo (Fig.
1B,E) (Frohnhöfer and
Nüsslein-Volhard, 1986
;
Frohnhöfer and Nüsslein-Volhard,
1987
). oskar mutant females produce embryos (referred to
as oskar mutants) that lack the entire abdomen, with the telson
intact (Fig. 1C,F)
(Lehmann and Nüsslein-Volhard,
1986
). Development of acron and telson is independent of
bicoid and oskar, and requires the torso signaling
pathway (Klingler et al.,
1988
; Schüpbach and
Wieschaus, 1986
). However, bicoid specifies acron versus
telson at the anterior tip of the embryo
(Fig. 1B)
(Frohnhöfer and
Nüsslein-Volhard, 1986
).
In wild-type, bicoid+ mRNA is maternally localized at
the anterior tip of the embryo (Berleth et
al., 1988
). After fertilization, Bicoid protein forms an
exponential concentration gradient along the anteroposterior axis with a
maximum at the anterior tip, the source of its translation
(Driever and Nüsslein-Volhard,
1988a
) (reviewed by Ephrussi
and St Johnston, 2004
). Bicoid, which is a homeodomain-containing
transcription factor, induces target gene expression in a dose-dependent
manner, which is required for proper specification of head and thorax
(Driever and Nüsslein-Volhard,
1988b
; Driever and
Nüsslein-Volhard, 1989
;
Struhl et al., 1989
). Thus,
loss of Bicoid results in failure to provide this specification, and the
mutant embryos do not develop head and thorax
(Fig. 1B,E). Similarly,
oskar mRNA is localized at the posterior tip of the embryo where it
is required to localize the posterior determinant nanos
(Ephrussi et al., 1991
;
Kim-Ha et al., 1991
). In the
absence of oskar function, posterior development is disturbed, and
the entire abdomen fails to develop (Fig.
1C,F).
The mechanisms that cause loss of embryonic tissue in bicoid and
oskar mutants are unclear. In previous studies, these mutants were
examined from fertilization to gastrulation, when the wild-type functions of
bicoid and oskar are required for proper specification of
cell fates along the anteroposterior axis. Hence, little is known about the
events after gastrulation, when the bicoid and oskar mutant
phenotypes, which result in significant tissue loss, are established. In
principle, loss of tissue could result from decreased cell proliferation or
increased cell death. Because nuclear divisions and cellularization are normal
in bicoid and oskar mutants
(Frohnhöfer and
Nüsslein-Volhard, 1986
;
Frohnhöfer and Nüsslein-Volhard,
1987
; Lehmann and
Nüsslein-Volhard, 1986
), defects in cell proliferation are
unlikely to account for tissue loss observed in these mutants. Rather,
increased cell death is an attractive mechanism to explain the bicoid
and oskar mutant phenotypes.
Indeed, cell corpses in the abdomen of oskar mutants have been
observed previously (Lehmann and
Nüsslein-Volhard, 1986
); however, the underlying cause has
never been carefully examined. Here, we show that cell death is responsible
for the loss of tissue in bicoid and oskar mutant embryos.
Furthermore, our analysis implies that cellular mis-specification in these
mutants triggers cell death through an active gene-directed pathway leading to
expression of the cell death-inducing gene hid, resulting in
caspase-dependent cell death. However, our data also show that if cell death
is blocked either by removing hid or by providing a survival
signaling pathway, mis-specification is tolerated and transformation can
occur.
| Materials and methods |
|---|
|
|
|---|
For generation of UASp-P35 transgenic flies, primers
GAGCTTGCGGCCGCAAAATGTGTGTAATTTTTCCGG and TTAGGCTCTAGATTTTAACATTTATTTAATTGTG
were used to amplify the P35-coding region by PCR. The PCR product was treated
with NotI and XbaI, and cloned into
NotI/XbaI-treated pUASp vector
(Rørth, 1998
).
Transgenic flies were generated by P-element-mediated transformation.
Immunohistochemistry
TUNEL assays, immunohistochemistry, in situ hybridization and Acridine
Orange labeling of whole-mount embryos were performed in accordance with
standard procedures (Goyal et al.,
2000
; Patel, 1994
;
Tautz and Pfeifle, 1989
;
Abrams et al., 1993
). The CM1
antibody as well as monoclonal antibodies against Dlg (4F3), Abd-B (1A2E9) and
Antp (8C11) were used at 1:1,000, 1:300, 1:20 and 1:100 dilutions,
respectively. For cuticle preparations, differentiated embryos were embedded
in Hoyer's medium (van der Meer,
1977
).
| Results |
|---|
|
|
|---|
|
|
7 hours) (Abrams et al.,
1993
|
Cell death causes clearance of tissue in b aid and oskar mutants
CM1 labeling is present in the affected regions of the embryos until they
are shortened. We detected an interesting intermediate phenotype in
bicoid and oskar mutants, beginning at stage 14. Labeling
with the CM1 antibody revealed large areas with no staining signal surrounded
by immunopositive tissue (Fig.
2A,B, arrows). These areas also fail to give signals with
antibodies recognizing ubiquitously expressed proteins such as Tubulin and
Dronc, another Drosophila caspase (data not shown). We refer to these
areas as `areas of clearance'.
Areas of clearance are not observed in wild-type embryos and in
P35-expressing embryos (Fig.
1N,O), suggesting that they develop as a direct consequence of
cell death in bicoid and oskar embryos. Hence, we
characterized them in a time course using an antibody against the ubiquitously
expressed membrane-associated Discs large (Dlg) protein
(Parnas et al., 2001
).
Initially, in stage 14 bicoid embryos, beginning of clearance is
visible in two distinct zones similar to TUNEL labeling and caspase activation
(Fig. 2C). However, the two
zones fuse over the next few stages and the areas of clearance enlarge
significantly (Fig. 2D-F).
Later these areas collapse, and the final phenotype of bicoid mutants
is established. Similar data were obtained for oskar mutants (data
not shown). These areas also do not contain DNA
(Fig. 2G,H). Thus, DNA and
proteins are cleared as a result of the apoptotic events in these tissues.
Moreover, because Dlg is membrane associated, these data indicate that
de-cellularization, the end result of the apoptotic process, has occurred. In
Fig. 5 and Fig. S2 (see
supplementary material), we are using the areas of clearance as markers of
cell death in response to developmental mis-specification.
Expression of hid in bicoid and oskar embryos
During Drosophila embryogenesis, the genes reaper, hid
and grim are essential for cell death through activation of caspases
(White et al., 1994
;
White et al., 1996
;
Grether et al., 1995
;
Chen et al., 1996
). We
determined whether they are involved in the cell death response of
bicoid and oskar mutants. Compared with wild-type embryos,
hid expression is significantly elevated in those parts of
bicoid and oskar embryos that showed high levels of
TUNEL-positive cell death and activated DrICE
(Fig. 3A-C). hid
expression is not detectable in the presumptive telson regions. Expression of
reaper and grim was not upregulated (data not shown). The
increased expression of hid is first visible in stage 9 embryos,
preceding cell death by
1-2 hours, suggesting that transcriptional
induction of hid triggers cell death in bicoid and
oskar mutants. Expression of the caspase inhibitor P35 did not affect
expression of hid (data not shown), demonstrating that caspase
activation occurs downstream of hid. This is consistent with the
proposed role of hid as caspase activator
(Grether et al., 1995
).
Interestingly, hid expression in the affected parts of
bicoid and oskar mutants is maintained for less than 2
hours, and then downregulated.
To determine whether cell death in bicoid mutants requires hid, embryos double mutant for hid and bicoid (see Materials and methods) were analyzed by TUNEL and Acridine Orange labeling. Cell death was not detectable in stage 10 hid bicoid double mutant embryos (Fig. 4B,D), suggesting that hid is genetically required for increased cell death in bicoid embryos. In summary, this analysis highlights the fact that cells in the affected regions of bicoid and oskar mutants do not simply die by a passive mechanism because of a lack of appropriate developmental information. Instead, these cells induce a transcriptional response leading to expression of hid. Thus, they die by an active gene-directed process.
|
Rescued mis-specified cells in hid bicoid double mutants have posterior identity
It has previously been proposed that mis-specified cells have at least two
options: they either die or they survive and are transformed to adopt a
different fate (reviewed by Bonini and
Fortini, 1999
). The underlying cause for this distinction is
unclear. The bicoid mutant phenotype combines both transformation of
tissue (acron to telson, Fig.
1B) and cell death in the presumptive head and thorax region
(Fig. 1H). Thus, we asked why
some mis-specified cells in bicoid mutants die, while others survive.
To address this, we closely examined the identity of the expanded first
abdominal segment in hid bicoid double mutants. Interestingly, the
polarity of the denticles and the width of the segment resemble segment A8,
the posterior-most segment (Fig.
1A), suggesting that anterior tissue may have been transformed
toward a posterior identity in bicoid mutants. As mentioned above,
transformation of acron into telson in bicoid mutants has previously
been reported (Frohnhöfer and
Nüsslein-Volhard, 1986
)
(Fig. 1B). However, the hid
bicoid double mutant analysis revealed that the transformation of
anterior tissue into posterior identity expands beyond the telson, and that
this expansion undergoes hid-induced cell death in bicoid
single mutants.
To verify this interpretation, we analyzed the posterior identity of
anterior tissue in more detail using an antibody raised against the
Abdominal-B (Abd-B) protein as posterior marker. In wild-type embryos, Abd-B
protein is present in the posterior part of the embryo
(Fig. 5A,C)
(Celniker et al., 1989
).
However, in bicoid mutants it is found in both posterior and anterior
poles of the embryo (Fig.
5B,D), consistent with our morphological observation. Thus, in
bicoid mutants, anterior cells are incorrectly specified because they
receive a developmental signal that in wild-type embryos is present only
posteriorly.
To determine whether mis-specified cells induce hid expression and cell death in bicoid mutants, we analyzed Abd-B protein distribution in wild-type, bicoid single and hid bicoid double mutant embryos. In stage 15 wild-type embryos, Abd-B protein is detectable in two populations of cells at the posterior pole, a dorsally located component that gives rise to the telson (Fig. 5C, bracket), and a ventrally located component which specifies segment A8 (Fig. 5C, red arrow). In bicoid mutants, Abd-B protein distribution is mirror-imaged at the anterior pole (Fig. 5D). Significantly, however, part of the Abd-B-expressing ventral tissue in bicoid mutants is cleared as a consequence of cell death (Fig. 5D, open arrow; compare with Fig. 2). Consistently, in hid bicoid double mutants, tissue clearance does not occur and Abd-B protein persists (Fig. 5E, red arrow). Thus, the mis-specified ventral tissue expressing Abd-B survives in the double mutant. Similar data were obtained using a different abdominal marker, abd-A (see Fig. S1 in the supplementary material). Taken together, these findings suggest that mis-specified cells in bicoid mutants can induce hid expression and undergo cell death. Furthermore, the red arrows in Fig. 5C-E indicate the highest expression levels of Abd-B specifying abdominal segment A8 in wild-type, bicoid mutants and hid bicoid double mutants. Thus, the rescued cells in hid bicoid double mutants experience highest levels of Abd-B and develop into a segment with A8 identity (Fig. 4F). We also determined that cell death in oskar mutants largely affects mis-specified tissue, and that hid oskar double mutants rescue this tissue (see Fig. S2 in the supplementary material). Thus, similar to bicoid, mis-specified cells in oskar mutants induce hid to undergo cell death.
|
Expression of hid in segmentation mutants
Because hid is transcriptionally upregulated in dying
mis-specified cells of bicoid and oskar mutants, we
determined whether induction of hid expression represents a broader
mechanism that also applies to mis-specified cells in other developmental
mutants. We analyzed mutants of gap genes [knirps (kni)],
pair-rule genes [odd-skipped (odd)] and segment-polarity
genes [wingless (wg)]. These mutants are characterized by
loss of tissue (Nüsslein-Volhard and
Wieschaus, 1980
), and ectopic cell death has been reported for
these mutants (Tepass et al.,
1994
; Perrimon and Mahowald,
1987
; Klingensmith et al.,
1989
; Bejsovec and Wieschaus,
1993
; Pazdera et al.,
1998
; Hughes and Krause,
2001
). As in the case of bicoid and oskar
mutants, hid expression is upregulated during stage 9 of
embryogenesis in the regions of the mutant embryos that are later deleted in
the larvae (Fig. 6). This is
most evident for odd, which lacks every other segment in the larvae.
Correspondingly, we detected upregulation of hid in every other
segment (Fig. 6C, arrowheads).
In kni mutants, upregulation of hid is detectable in the
posterior part of the embryo (Fig.
6B), where kni+ function is required
(Nauber et al., 1988
;
Pankratz et al., 1992
). In
wg mutants, hid expression is detectable in every segment
(Fig. 6D), consistent with the
notion that the segment polarity phenotype is the result of regional
mis-specification and subsequently cell death
(Klingensmith et al., 1989
;
Perrimon and Mahowald, 1987
).
Similar data were also obtained for additional mutants, including
hunchback, Krüppel, fushi-tarazu, hedgehog and
engrailed (data not shown). Thus, these data support the notion that
upregulation of hid in mis-specified cells is a common feature in
many developmental mutants.
| Discussion |
|---|
|
|
|---|
Interestingly, it takes approximately 6 hours from caspase activation (stage 10; 7 hours of age) to the onset of cellular clearance (stage 14; 13 hours of age). During this time, the contents of the affected cells, including protein and DNA, are completely degraded and the cells are removed. This analysis highlights that developmental cell death occurs very rapidly, and that the bicoid and oskar mutants provide a convenient model with which to analyze the individual events of cell death with high temporal and spatial resolution because many cells die almost synchronously in these mutants.
|
|
| Mis-specified cells in patterning mutants induce hid expression |
|---|
|
|
|---|
Furthermore, mutations affecting imaginal disc development result in loss
of the adult appendage due to inappropriate cell death
(Fristrom, 1968
;
Fristrom, 1969
) (reviewed by
Bonini and Fortini, 1999
). We
are currently determining whether these mutants also require hid
expression to develop the final phenotypes. Moreover, many gene disruptions in
mice result in inappropriate cell death in the tissue that requires the
function of the disrupted gene (Rossel and
Capecchi, 1999
; McKay et al.,
1994
; Swiatek and Gridley,
1993
), suggesting that similar mechanisms might exist in mammalian
development. Finally, cell death may be an important contributing factor to
human congenital birth defects. Thus, an understanding of the underlying
mechanisms is of general interest.
Interestingly, not all segment polarity mutants analyzed induce hid expression and cell death. Embryos mutant for patched, which encodes the hedgehog receptor, were not found to express hid and do not contain increased cell death (data not shown), although hedgehog mutants both upregulate hid and contain increased amounts of cell death. The reasons for these differences are not known, but partial redundancy might account for lack of hid expression in patched mutants. The Drosophila genome encodes another patched homolog, patched-related, which might provide the survival requirement for mis-specified cells in patched mutants.
Mis-specified cells in bicoid and oskar mutants induce
expression of hid. We did not observe increased reaper or
grim expression in these mutants. However, expression of
reaper has been reported in crumbs mutants, which affect
epithelial integrity (Nordstrom et al.,
1996
). X-ray-treated embryos also preferentially respond by
upregulation of reaper (Nordstrom
et al., 1996
; Brodsky et al.,
2000
; Ollmann et al.,
2000
), rather than hid (M. E. Grether, PhD thesis, MIT,
1994). Although we have not analyzed crumbs mutants for hid
expression, it appears that cells contain several developmental checkpoints,
which activate different cell death-inducing regulators depending on the type
of abnormal cellular development.
Cell death versus cell fate transformation
Mis-specified cells can survive if an alternative survival pathway is
provided. The example presented here is the acron into telson transformation
in bicoid mutants, which is mediated by the torso signaling
pathway. Although the cells giving rise to telson structures at the anterior
tip are mis-specified based on Abd-B-labeling experiments, they survive
because they receive a survival signal from the torso signaling
system. In this case, transformation rather than cell death is favored. It has
previously been shown that activation of the Ras/Mapk pathway protects cells
from hid-induced apoptosis, both by transcriptional repression of
hid (Kurada and White,
1998
) and by phosphorylation of Hid protein by Mapk
(Bergmann et al., 1998
).
Because Torso, which encodes a receptor tyrosine kinase (RTK)
(Sprenger et al., 1989
), is
known to activate Ras and Mapk (Ghiglione
et al., 1999
; Gabay et al.,
1997
), we tested whether manipulation of active Mapk levels using
a gain-of-function allele, MapkSem, can suppress
hid expression and cell death in bicoid mutants. However,
this was found not to be the case (data not shown). Thus, torso
appears to protect mis-specified cells independently of Mapk activation.
The hid bicoid double mutant analysis reveals that the transformation of anterior into posterior identity expands beyond the telson, and that this expansion undergoes hid-induced cell death in bicoid single mutants. The rescued cells secrete larval cuticle elements, suggesting that mis-specified cells have the developmental capacity to terminally differentiate. However, in hid+ background, they instead die, presumably because equivalent survival signals are lacking. We propose that mis-specified cells undergo cell death if no alternative survival pathway is provided to protect them.
An alternative survival mechanism might also operate in other developmental
mutants where transformation rather than cell death occurs. Mutations in the
sev RTK and its ligand boss result in transformation of the
R7 photoreceptor cell into a non-neuronal cone cell
(Tomlinson and Ready, 1986
;
Reinke and Zipursky, 1988
).
Survival of this cell could be mediated by the Drosophila Egf
receptor (Egfr), another RTK, which is required to maintain cell survival in
the developing eye disk (Baker and Yu,
2001
). Accordingly, activation of the Ras/Mapk pathway by Egfr
would inhibit hid expression and support survival of the presumptive
R7 photoreceptor cell. This interpretation is also consistent with
observations that egfr- clones are small and undergo cell
death (Diaz-Benjumea and Garcia-Bellido,
1990
; Xu and Rubin,
1993
), and that this death can be suppressed in hid
mutants (Yu et al., 2002
).
Thus, transformation of the R7 photoreceptor to a cone cell rather than R7
cell death in sev and boss mutants could occur because of
survival signaling by the Egfr.
Why do mis-specified cells die?
The hid bicoid double mutant analysis suggests that mis-specified
cells can continue to develop and differentiate. Yet, they die. Presumably,
this cell death protects the organism from potentially dangerous cells. For
example, it is conceivable that in mammals, surviving mis-specified cells
might lie dormant in the host organism for years. During this time, they might
acquire additional genetic alterations that could drive the progressive
transformation of these cells into malignant cancer. In wild-type embryos,
mis-specification probably occurs in cells in isolation, and elimination of
these cells does not interfere with development and survival of the organism.
Only in extreme situations, such as the patterning mutants analyzed here, is
the mis-specification caused by aberrant development so severe that the
affected organism dies.
What is the nature of the mechanism that recognizes mis-specified cells?
The cause of mis-specification in each segmentation mutant is different.
Usually, the expression of other segmentation genes is shifted and expanded,
resulting in flattened gradients (e.g.
Rivera-Pomar and Jäckle,
1996
; Mullen and DiNardo,
1995
). Yet, irrespective of the cause of mis-specification, most
of these mutants have in common that they induce hid expression. It
is currently unknown how the mis-specified fate of cells is recognized, and
how hid expression is induced. One possibility might be that the
protein gradients established by bicoid+ and
oskar+, as well as other segmentation genes
(Driever and Nüsslein-Volhard,
1988a
; Ephrussi et al.,
1991
; Dahanukar and Wharton,
1996
; Rivera-Pomar and
Jäckle, 1996
; Mullen and
DiNardo, 1995
) are used as readout for proper cellular
specification. The steepness of protein gradients as a means to determine life
or death decisions has recently been proposed
(Moreno and Basler, 2004
;
de la Cova et al., 2004
). Such
a model would imply that cells are able to determine their position in a
graded field and compare this readout with their neighbors. Because in
bicoid and oskar mutants these gradients do not form, the
concentration difference between neighboring cells would be zero. If the
concentration difference between two neighboring cells is below a crucial
threshold, they induce the expression of hid and undergo cell death.
This model could also explain embryonic pattern repair, which was described in
embryos that express six copies of the bicoid gene
(Namba et al., 1997
). In these
embryos, the head and thorax primordia are expanded because of the presence of
six copies of bicoid. However, this expansion is corrected for by
induction of cell death, and relatively normal larvae develop
(Namba et al., 1997
). In this
case, the Bicoid protein gradient does form, but would be flatter compared
with wild type. Thus, the concentration difference between neighboring cells
would be below a critical threshold, sufficient to induce
hid-dependent cell death. However, it is largely unknown how cells
compare their position in a graded field with those of their neighbors. It has
been proposed that short-range cell interactions mediated via the cell-surface
proteins Capricious and Tartan provide cues that support cell survival during
wing development (Milan et al.,
2002
). Cells unable to participate in these interactions are
eliminated by cell death. It is unclear, however, whether short-range
interactions are sufficient to explain the cell death phenotype in
bicoid and oskar mutants.
Irrespective of the underlying mechanism for sensing mis-specification, our results highlight the role of an active gene-directed process that removes mis-specified cells during development. However, if a survival mechanism is provided, mis-specified cells can survive and adopt a different fate. In wild-type embryos, mis-specification probably occurs in cells in isolation, and hence is difficult to study. However, in bicoid and oskar mutants, large regions of neighboring cells are mis-specified and undergo cell death simultaneously, providing a unique opportunity to clarify the signals that initiate cell death in situations where cells are developmentally mis-specified.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/132/24/5343/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Abrams, J. M., White, K., Fessler, L. I. and Steller, H. (1993). Programmed cell death during Drosophila embryogenesis. Development 117, 29-43.[Abstract]
Avery, L. and Horvitz, H. R. (1987). A cell that dies during wild-type C. elegans development can function as a neuron in a ced-3 mutant. Cell 51,1071 -1078.[CrossRef][Medline]
Baehrecke, E. H. (2002). How death shapes life during development. Nat. Rev. Mol. Cell. Biol. 3, 779-787.[CrossRef][Medline]
Baker, N. E. and Yu, S. Y. (2001). The EGF receptor defines domains of cell cycle progression and survival to regulate cell number in the developing Drosophila eye. Cell 104,699 -708.[CrossRef][Medline]
Bejsovec, A. and Wieschaus, E. (1993). Segment polarity gene interactions modulate epidermal patterning in Drosophila embryos. Development 119,501 -517.[Abstract]
Bergmann, A., Agapite, J., McCall, K. A. and Steller, H. (1998). The Drosophila gene hid is a direct molecular target of Ras-dependent survival signaling. Cell 95,331 -341.[CrossRef][Medline]
Berleth, T., Burri, M., Thoma, G., Bopp, D., Richstein, S., Frigerio, G., Noll, M. and Nüsslein-Volhard, C. (1988). The role of localization of bicoid RNA in organizing the anterior pattern of the Drosophila embryo. EMBO J. 7,1749 -1756.[Medline]
Bonini, N. M. and Fortini, M. E. (1999). Surviving Drosophila eye development: integrating cell death with differentiation during formation of a neural structure. BioEssays 21,991 -1003.[CrossRef][Medline]
Brodsky, M. H., Nordstrom, W., Tsang, G., Kwan, E., Rubin, G. M. and Abrams, J. M. (2000). Drosophila p53 binds a damage response element at the reaper locus. Cell 101,103 -113.[CrossRef][Medline]
Celniker, S. E., Keelan, D. J. and Lewis, E. B.
(1989). The molecular genetics of the bithorax complex
of Drosophila: characterization of the products of the Abdominal-B
domain. Genes Dev. 3,1424
-1436.
Chen, P., Nordstrom, W., Gish, B. and Abrams, J. M.
(1996). grim, a novel cell death gene in
Drosophila. Genes Dev.
10,1773
-1782.
Condie, J. M., Mustard, J. A. and Brower, D. L. (1990). Generation of anti-Antennapedia monoclonal antibodies and Antennapedia protein expression in imaginal discs. Dros. Inf. Service 70,52 -54.
Cox, R. T., McEwen, D. G., Myster, D. L., Duronio, R. J.,
Loureiro, J. and Peifer, M. (2000). A screen for mutations
that suppress the phenotype of Drosophila armadillo, the beta-catenin
homolog. Genetics 155,1725
-1740.
Dahanukar, A. and Wharton, R. P. (1996). The
Nanos gradient in Drosophila embryos is generated by translational
regulation. Genes Dev.
10,2610
-2620.
Danial, N. N. and Korsmeyer, S. J. (2004). Cell death: critical control points. Cell 116,205 -219.[CrossRef][Medline]
de la Cova, C., Abril, M., Bellosta, P., Gallant, P. and Johnston, L. A. (2004). Drosophila myc regulates organ size by inducing cell competition. Cell 117,107 -116.[CrossRef][Medline]
Diaz-Benjumea, F. J. and Garcia-Bellido, A. (1990). Behaviour of cells mutant for an EGF receptor homologue of Drosophila in genetic mosaics. Proc. Biol. Sci. 242,36 -44.
Driever, W. and Nüsslein-Volhard, C. (1988a). A gradient of bicoid protein in Drosophila embryos. Cell 54, 83-93.[CrossRef][Medline]
Driever, W. and Nüsslein-Volhard, C. (1988b). The bicoid protein determines position in the Drosophila embryo in a concentration-dependent manner. Cell 54,95 -104.[CrossRef][Medline]
Driever, W. and Nüsslein-Volhard, C. (1989). The bicoid protein is a positive regulator of hunchback transcription in the early Drosophila embryo. Nature 337,138 -143.[CrossRef][Medline]
Ephrussi, A. and St Johnston, D. (2004). Seeing is believing: the bicoid morphogen gradient matures. Cell 116,143 -152.[CrossRef][Medline]
Ephrussi, A., Dickinson, L. K. and Lehmann, R. (1991). Oskar organizes the germ plasm and directs localization of the posterior determinant nanos. Cell 66, 37-50.[CrossRef][Medline]
Fristrom, D. (1968). Cellular degeneration in
wing development of the mutant vestigial of Drosophila
melanogaster. J. Cell Biol.
39,488
-491.
Fristrom, D. (1969). Cellular degeneration in the production of some mutant phenotypes in Drosophila melanogaster. Mol. Gen. Genet. 103,363 -379.[CrossRef][Medline]
Frohnhöfer, H. G. and Nüsslein-Volhard, C. (1986). Organization of anterior pattern in the Drosophila embryo by the maternal gene bicoid. Nature 324,120 -125.[CrossRef]
Frohnhöfer, H. G. and Nüsslein-Volhard, C.
(1987). Maternal genes required for the anterior localization of
bicoid activity in the embryo of Drosophila.
Genes Dev. 1,880
-890.
Gabay, L., Seger, R. and Shilo, B. Z. (1997). MAP kinase in situ activation atlas during Drosophila embryogenesis. Development 124,3535 -3541.[Abstract]
Gavrieli, Y., Sherman, Y. and Ben-Sasson, S. A.
(1992). Identification of programmed cell death in situ via
specific labeling of nuclear DNA fragmentation. J. Cell
Biol. 119,493
-501.
Ghiglione, C., Perrimon, N. and Perkins, L. A. (1999). Quantitative variations in the level of MAPK activity control patterning of the embryonic termini in Drosophila. Dev. Biol. 205,181 -193.[CrossRef][Medline]
Goyal, L., McCall, K., Agapite, J., Hartwieg, E. and Steller, H. (2000). Induction of apoptosis by Drosophila reaper, hid and grim through inhibition of IAP function. EMBO J. 19,589 -597.[CrossRef][Medline]
Grether, M. E., Abrams, J. M., Agapite, J., White, K. and
Steller, H. (1995). The head involution defective
gene of Drosophila melanogaster functions in Programmed Cell Death.
Genes Dev. 9,1694
-1708.
Hay, B. A., Wolff, T. and Rubin, G. M. (1993). Expression of baculovirus P35 prevents cell death in Drosophila. Development 120,2121 -2129.
Hughes, S. C. and Krause, H. M. (2001). Establishment and maintenance of parasegmental compartments. Development 128,1109 -1118.[Abstract]
Karch, F., Bender, W. and Weiffenbach, B.
(1990). abdA expression in Drosophila embryos.
Genes Dev. 4,1573
-1587.
Kim-Ha, J., Smith, J. L. and Macdonald, P. M. (1991). oskar mRNA is localized to the posterior pole of the Drosophila oocyte. Cell 66, 23-35.[CrossRef][Medline]
Klingensmith, J., Noll, E. and Perrimon, N. (1989). The segment polarity phenotype of Drosophila involves differential tendencies toward transformation and cell death. Dev. Biol. 134,130 -145.[CrossRef][Medline]
Klingler, M., Erdelyi, M., Szabad, J. and Nüsslein-Volhard, C. (1988). Function of torso in determining the terminal anlagen of the Drosophila embryo. Nature 335,275 -277.[CrossRef][Medline]
Kurada, P. and White, K. (1998). Ras promotes cell survival in Drosophila by downregulating hid expression. Cell 95,319 -329.[CrossRef][Medline]
Lehmann, R. and Nüsslein-Volhard, C. (1986). Abdominal segmentation, pole cell formation, and embryonic polarity require the localized activity of oskar, a maternal gene in Drosophila. Cell 47,141 -152.[CrossRef][Medline]
Macias, A., Casanova, J. and Morata, G. (1990).
Expression and regulation of the abd-A gene of Drosophila.
Development 110,1197
-1207.
Magrassi, L. and Lawrence, P. A. (1988). The
pattern of cell death in fushi tarazu, a segmentation gene of Drosophila.
Development 104,447
-451.
Martinez-Arias, A. and Ingham, P. W. (1985). The origin of pattern duplications in segment polarity mutants of Drosophila melanogaster. J. Embryol. Exp. Morphol. 87,129 -135.[Medline]
McKay, I. J., Muchamore, I., Krumlauf, R., Maden, M., Lumsden, A. and Lewis, J. (1994). The kreisler mouse: a hindbrain segmentation mutant that lacks two rhombomeres. Development 120,2199 -2211.[Abstract]
Milan, M., Perez, L. and Cohen, S. M. (2002). Short-range cell interactions and cell survival in the Drosophila wing. Dev. Cell 2,797 -805.[CrossRef][Medline]
Moreno, E. and Basler, K. (2004). dMyc transforms cells into super-competitors. Cell 117,117 -129.[CrossRef][Medline]
Mullen, J. R. and DiNardo, S. (1995). Establishing parasegments in Drosophila embryos: roles of the odd-skipped and naked genes. Dev. Biol. 169,295 -308.[CrossRef][Medline]
Namba, R., Pazdera, T. M., Cerrone, R. and Minden, J. S. (1997). Drosophila embryonic pattern repair: how embryos respond to bicoid dosage alteration. Development 124,1393 -1403.[Abstract]
Nauber, U., Pankratz, M. J., Kienlin, A., Seifert, E., Klemm, U. and Jäckle, H. (1988). Abdominal segmentation of the Drosophila embryo requires a hormone receptor-like protein encoded by the gap gene knirps. Nature 336,489 -492.[CrossRef][Medline]
Nordstrom, W., Chen, P., Steller, H. and Abrams, J. M. (1996). Activation of the reaper gene during ectopic cell killing in Drosophila. Dev. Biol. 180,213 -226.[CrossRef][Medline]
Nüsslein-Volhard, C. and Wieschaus, E. (1980). Mutations affecting segment number and polarity in Drosophila. Nature 287,795 -801.[CrossRef][Medline]
Nüsslein-Volhard, C., Frohnhöfer, H. G. and Lehmann,
R. (1987). Determination of anteroposterior polarity in
Drosophila. Science
238,1675
-1681.
Ollmann, M., Young, L. M., Di Como, C. J., Karim, F., Belvin, M., Robertson, S., Whittaker, K., Demsky, M., Fisher, W. W., Buchman, A. et al. (2000). Drosophila p53 is a structural and functional homolog of the tumor suppressor p53. Cell 101,91 -101.[CrossRef][Medline]
Pankratz, M. J., Busch, M., Hoch, M., Seifert, E. and
Jäckle, H. (1992). Spatial control of the gap gene
knirps in the Drosophila embryo by posterior morphogen
system. Science 255,986
-989.
Parnas, D. A., Haghighi, P., Fetter, R. D., Kim, S. W. and Goodman, C. S. (2001). Regulation of postsynaptic structure and protein localization by the Rho-Type guanine nucleotide exchange factor dPix. Neuron 32,415 -424.[CrossRef][Medline]
Patel, N. H. (1994). Imaging neuronal subsets and other cell types in whole-mount Drosophila embryos and larvae using antibody probes. Methods Cell Biol. 44,445 -487.[Medline]
Pazdera, T. M., Janardhan, P. and Minden, J. S. (1998). Patterned epidermal cell death in wild-type and segment polarity mutant Drosophila embryos. Development 125,3427 -3436.[Abstract]
Perrimon, N. and Mahowald, A. P. (1987). Multiple functions of segment polarity genes in Drosophila. Dev. Biol. 119,587 -600.[CrossRef][Medline]
Reinke, R. and Zipursky, S. L. (1988). Cell-cell interaction in the Drosophila retina: the bride of sevenless gene is required in photoreceptor cell R8 for R7 cell development. Cell 55,321 -330.[CrossRef][Medline]
Rivera-Pomar, R. and Jäckle, H. (1996). From gradients to stripes in Drosophila embryogenesis: filling in the gaps. Trends Genet. 12,478 -483.