|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 November 2005
doi: 10.1242/dev.02148
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Cancer Research UK London Research Institute, PO Box 123, 44 Lincolns Inn
Fields, London WC2A 3PX, UK
2 National Centre for Biological Sciences, UAS-GKVK Campus, Bellary Road,
Bangalore 560 065, India
3 Department of Genetics, Howard Hughes Medical Institute, Duke University
Medical Center, Durham, NC 27710, USA
* Author for correspondence (e-mail: sally.leevers{at}cancer.org.uk)
Accepted 4 October 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Cell growth, Ribosomal proteins, Drosophila
| Introduction |
|---|
|
|
|---|
The Drosophila imaginal disc represents an ideal model system with
which to study the regulation of tissue growth. Imaginal discs are epithelial
sacs that develop during larval life to give rise to most of the adult
structures (Cohen, 1993
).
Growth during larval life is the major determinant of adult size. Intrinsic
mechanisms allow discs to grow to their normal final size even in the presence
of ample nutrients; for example, when they are transplanted to adult hosts
(Bryant and Levinson, 1985
)
(reviewed by Day and Lawrence,
2000
). During normal disc development, disc cell number increases
approximately exponentially from the end of the first larval instar until it
slows around the middle of the third and final instar. Some developmental
constraints on growth are likely to exist during the fast phase
(Garcia-Bellido and Merriam,
1971
; Gonzalez-Gaitan et al.,
1994
; Milan et al.,
1996
; Johnston and Sanders,
2003
). Importantly, final organ size sensing mechanisms sense and
control disc size rather than disc cell number
(Neufeld et al., 1998
;
Day and Lawrence, 2000
).
Furthermore, there is no evidence for a cell size checkpoint and it is likely
that growth (increase in mass) and cell division are regulated independently
of each other (Neufeld et al.,
1998
; Leevers and Hafen,
2004
; Prober and Edgar,
2000
; Datar et al.,
2000
; Coelho and Leevers,
2000
). A mild degree of cell death occurs during most of imaginal
disc development (Milan et al.,
1997
). Recent work suggests that this cell death is necessary to
maintain reproducible organ size (de la
Cova et al., 2004
).
There are a few hints of temporal changes in the growth promoting activity
of specific signalling pathways during late imaginal disc growth. For example,
late in larval development, wing disc cells seem to become refractile to
growth-inducing signals from a constitutively activated Dpp receptor
(Martin-Castellanos and Edgar,
2002
). Thus unknown factors may inhibit the ability of wing discs
cells to respond to Dpp after the larval growth period. Two potential
inhibitors of late disc growth have been identified. Nitric oxide (NO)
inhibits imaginal disc cell proliferation, and NO levels have been shown to
increase in late third instar imaginal discs
(Kuzin et al., 1996
). Wg
signalling mediates cell-cycle arrest at the dorsoventral boundary during the
third instar as part of the program of disc differentiation
(Johnston and Edgar, 1998
).
More recent work has suggested that this role of Wg signalling in cell cycle
arrest may extend to the rest of the wing pouch during the late third instar
(Johnston and Sanders, 2003
;
Giraldez and Cohen, 2003
).
Growth and cell division rates are not uniform within wing discs, and mild
regional differences may contribute to the shape of these discs. Johnston and
Sanders (Johnston and Sanders,
2003
) report that median cell doubling times are slower in the
wing pouch (which gives rise to the adult wing blade) than in the wing hinge
(see Postlethwait, 1978
). In
addition, growth is faster in the posterior compartment, which in early discs
is smaller than the anterior compartment
(Garcia-Bellido and Merriam,
1971
; Neufeld et al.,
1998
). Within the wing pouch, an evaluation of clone frequencies
and their spatial distribution suggested that there might be pulses of
proliferation that act within intervein regions
(Gonzalez-Gaitan et al.,
1994
). It is not clear what determines these regional differences
in growth and cell division rates. Indeed, cell division rates in early discs
do not reflect the distribution of the known morphogens Wg and Dpp
(Milan et al., 1996
;
Martin-Castellanos and Edgar,
2002
). Interestingly, reducing Myc or ribosomal protein (Rp)
function in wing imaginal disc clones results in region-specific effects on
clonal growth. These effects have been attributed to regional differences in
the severity of cell competition (Simpson,
1979
; Moreno et al.,
2002
; Moreno and Basler,
2004
).
We report here the role in growth control of Pixie, an ATP-binding-cassette
(ABC) domain protein with two N-terminal iron-sulphur-binding domains.
Although many ABC proteins are transporters that possess transmembrane
domains, Pixie belongs to the ABC-E subfamily of ABC proteins, which, like the
ABC-F subfamily, lack trans-membrane domains
(Dean and Allikmets, 2001
).
Several ABC-E and ABC-F proteins have recently been shown to play roles in the
regulation of translation (reviewed by
Kerr, 2004
). The yeast homolog
of Pixie, RLI1, functions in translation-initiation complex formation and
ribosomal biogenesis and thus may provide a functional link between assembly
of iron sulphur clusters, ribosomal biogenesis and translation initiation
(Kispal et al., 2005
;
Yarunin et al., 2005
;
Dong et al., 2004
).
Here, we show that in Drosophila S2 cells, Pixie is required for translation and that pixie mutants behave like recessive Minutes. Both pixie and Minute mutant wing discs show complex defects in growth and cell survival that vary temporally and spatially. These defects are compensated such that near normal final body size and pattern are achieved. Clonal analysis in wing discs suggests that in keeping with its role as a translation regulator, pixie is required for growth.
Interestingly during the late, slow growth phase, pixie mutant clones are smallest in regions of the disc where growth is slowest. Together our data are consistent with a model in which pixie function is a target of the growth constraining signals that slow growth during late larval life.
| Materials and methods |
|---|
|
|
|---|
For most experiments, larvae were collected from short egg lays and reared at defined densities, in order to avoid asynchrony.
dsRNAi
dsRNAi was performed by adding 10 µg dsRNA to 35 mm wells containing
2x106 Drosophila Schneider S2 cells as described
(Clemens et al., 2000
). DNA
templates containing 5' T7 RNA polymerase-binding sites were PCR
amplified from plasmid or genomic DNA and transcribed with the Megascript T7
transcription kit (Ambion). Primers contained 5' T7 RNA
polymerase-binding sites preceded by a GAA overhang followed by sense or
antisense sequences: pixie sense primer, GGAGAAGCACACAACGCATCG;
pixie antisense primer, TGATCGAATGGTCAAGGCAGC; eIF4A sense
primer, GCATCTTGGAATCCGGTTGCC; eIF4A antisense primer,
GTTGCAGAAGATTACCGACTGG.
Translation assays
S2 cells (8x106 per point) were incubated for 3 hours in 1
ml Schneider's Drosophila medium (Gibco), 10% foetal bovine serum,
containing 200 µCi Promix [35S] cell labelling mix (1000
Ci/mMol, Amersham Biosciences). For emetine treatment, cells were pre-treated
for 30 minutes in 0.1 mM emetine (Sigma), prior to addition of Promix. Cells
were lysed in 100 µl per point of lysis buffer [50 mM HEPES (pH 7.5), 1%
Triton X-100, 150 mM NaCl, 2 mM EDTA, 2 mM EGTA, 1 mM NaVO4, 50 mM
NaF, 10 µg/ml aprotinin, 1 µg/ml leupeptin, 10 µg/ml Pepstatin A, 15
µM TLCK, 1 mM PMSF], and aliquots were removed for protein assay (BioRad DC
protein assay kit) and analysis by western blotting. Incorporation of
[35S]cysteine and [35S]methionine into total cellular
protein was assessed by TCA precipitation. Aliquots (5 µl) of lysate were
added to 0.5 ml water and 0.5 ml of 0.5 M NaOH containing 1 mM L-methionine
and L-cysteine in glass tubes. Tubes were vortexed, incubated at 30°C for
10 minutes, then 1 ml cold 25% (w/v) TCA was added. Tubes were vortexed and
incubated on ice for 5 minutes. Precipitated [35S]-labelled
proteins were collected by filtration through Whatman GFC glass fibre filters,
washed three times in 5% cold TCA, rinsed in 95% ethanol, dried and quantified
by scintillation counting. Each dsRNAi condition was carried out in duplicate,
and [35S]cysteine and methionine incorporation into protein was
measured in duplicate.
Sucrose sedimentation and western blotting
S2 cells were lysed at a density of 108 cells per ml in SDG100
or SDG500 (high salt lysis) buffer (Tyzack
et al., 2000
) with 0.05 M NaF, 1 mM NaVO4, 0.01%
Pepstatin, 0.01% Aprotinin, 0.015 mM TLCK, 0.001% Leupeptin, 1 mM PMSF.
Cleared lysates were run through 0.8 M sucrose cushions in the presence of 100
mM or 500 mM (high salt) KCl at 290,000 g in a TLA110 rotor
for 2 hours. The samples were collected as described
(Tyzack et al., 2000
) and
analyzed by western blotting. Anti-Pixie polyclonal rabbit antisera were
raised against the C-terminal peptide: KDTEQKRSGQFFFLEDEACN, coupled via its
N-terminal amino group and glutaraldehyde to KLH (Pierce). Anti-DAkt antiserum
has been described previously (Lizcano et
al., 2003
). Anti-ribosomal-P antigen (ImmunoVision) was used at
1:200. Western blots were probed with secondary antibodies labelled with Alexa
Fluor 680 (Molecular Probes) or IRDye800 (Rockland Immunochemicals) and
scanned using the Odyssey Infrared Imaging System (LI-COR Biosciences).
Mitotic recombination and clonal analysis
Mitotic recombination was induced using the FLP/FRT system
(Xu and Rubin, 1993
).
Wild-type or pixL17 clones were generated by heat-shocking
y w; FRT80B/Ubi-GFP FRT80B or y w;
pixL17 FRT80B/Ubi-GFP FRT80B larvae at 34°C for 30
minutes (clones induced during second instar) or 15 minutes (clones induced
during third instar). Similar methods were used to generate
eIF4A1006 clones. To examine clones in adult wings,
w hs-flp122 f36a;
pixL17 FRT80B/mwh P[f+64C
w+] FRT80B larvae were heat-shocked for 45-80 minutes and male
wings were examined.
Clone median doubling time (MDT) was calculated by dividing the number of
hours of the clone induction window by log2 (Median clone cell
number). As is shown in Fig.
6A, the early clone induction windows overlap by 5 hours with the
late 32-hour window, and by 17 hours with the late 44-hour window. Despite
this difference in the period of overlap with a faster growth phase, the twin
MDT within the two late windows is similar. By contrast, twins generated using
the 60 hour clone induction window have a MDT that is intermediate between the
fast and slow phases. Because of the lag time between heat-shock and clone
generation, the actual overlap of the 32, 37 and 44 hour late windows with the
fast phase is likely to be minimal, whereas the 60 hour window spans both fast
and slow growth phases (Fig.
6A,D; an intermediate MDT is also observed with other short
windows that span the fast and slow phases, data not shown). X-ray induced
mitotic clonal analyses revealed exponential growth, with decreases in rate at
the larval moults (average MDT=8.5 hours)
(Garcia-Bellido and Merriam,
1971
). However Johnston and Sanders suggest that MDT increases
gradually as development progresses (in the hinge it is 9.5 hours during early
second instar to 11.5 hours in the third instar)
(Johnston and Sanders, 2003
).
Our data reveal a fast growth phase followed closely by a slower growth phase,
approximating the growth curve demonstrated by Byrant and Levinson (Byrant and
Levinson, 1985). Owing to the limitations of the clonal analysis technique,
our data do not suggest the rate of deceleration of cell division during late
third instar.
To generate clones in a Minute background, y w; FRT80B or y w; pixL17 FRT80B/TM3 Sb, Kr-GFP males were mated with y w hs-flp122; M(3)66D1 Ubi-GFP FRT80B/TM6B Tb females and larvae were heat-shocked for 10 minutes. Tb+ larvae were dissected. Poor-growing mutant clones are often observed as fragments around a wild-type twin clone. When clones have a growth advantage over their surrounding tissue, they generally do not fragment, allowing easy recognition of clone boundaries. In the late hinge in the Minute background, there is a high frequency of smaller pixL17 clones, which contribute to an estimated decrease in hinge MDT when compared with the MDT of these clones in a Minute+ background. In these experiments in a Minute background, Minute-/- twins survive poorly during the late clone induction windows. In the absence of any associated twins, clone fragments belonging to the same mutant clone may be counted as separate smaller clones. Thus, the estimated MDT is likely to be lower than the actual MDT. In the pouch in a Minute background, pixL17 clone size and frequency is low, allowing us to be confident of their poor growth when compared with a Minute+ background.
Histology
Larvae were dissected in PBS and discs fixed in 4% formaldehyde (EM grade,
Polysciences) in 0.1 M PO4 buffer (pH 7.2) for 40 minutes. S2 cells
were seeded on dishes containing coverslips (MaTek), pre-coated with
poly-L-lysine (Sigma), then fixed in 4% formaldehyde in 0.1 M PO4
buffer, pH 7.2 for 20 minutes and permeabilized in 1% TritonX-100 in PBS for 3
minutes. Nuclei were labelled with 10 µg/ml propidium iodide (PI) or
To-PRO-3 (Molecular Probes) at 1:2000 after RNaseA treatment (200 µg/ml;
Sigma). Rhodamine-conjugated phalloidin was used at 1:60. Anti-En monoclonal
4d9 (Developmental Hybridoma Bank, Irvine, USA) was used overnight at 1:1000
as described (Brower, 1986
) and
anti-Pixie polyclonal antisera (see above) was used overnight at 1:5000 in PBS
with 0.1% Tween 20 (PBST) with 5% normal goat serum (Vector Laboratories).
Secondary antibodies used were Alexa Flour 546-coupled anti-mouse IgG
(Molecular Probes) and Alexa Flour 488-coupled anti-rabbit IgG (Molecular
Probes) both at 1:500 in PBST. Discs were mounted in Vectashield (Vector
Labs). Apoptosis was detected using Apoptag Red (Intergen) reagents as
described (White et al.,
2001
).
Growth curve of wing discs
Larvae were picked on hatching from 2-hour egg lays and seeded at 40 larvae
per standard fly tube and maintained moist at 25°C. Approximately ten
larvae were dissected per tube at various time intervals after egg lay (AEL).
As there is an inherent variability in Minute disc size evident even
at the end of larval life, discs from the larger 20% of the larvae were
selected for analysis. To count the number of cells per disc, discs of early
stages (before the disc folds were deep) were fixed and stained with PI as
above. Confocal images were collected 2.5 µm apart in a z-series
using a C-Apochromat 40x/1.2 W corrected lens. Cells were counted within
500 µm squares and the average number per square was determined. The area
of discs was estimated using the LSM image browser (Zeiss software) and used
to calculate total cell number. Older discs were dissociated in 25 to 45 µl
Trypsin-EDTA in PBS for 3 to 5 hours at 37°C. Disc cell suspensions were
made by repeated pipetting then 10 µl was loaded onto a haemocytometer and
the cells were counted. Discs from the same larva (CS larvae,
110 hours
AEL) were counted using both techniques and the average difference in result
was
5%.
Microscopy
Confocal images were collected using a Zeiss LSM 510 confocal microscope
and C-Apochromat 40x/1.2 W corrected and Plan-Apochromat 20x/0.75
lenses (wing discs) and a 63x/1.2 W corrected lens (S2 cells). Wing
area, wing circumference and thorax circumference were measured using either
Photoshop or the LSM image browser software. Wings were mounted in Euparal or
Canada Balsam, thoraces were mounted in agar blocks (dorsal side up) and
images were generated using a Nikon Eclipse E800 microscope.
| Results |
|---|
|
|
|---|
10% decrease to a 5-10% increase
(Table 1, data not shown)
(Coelho et al., 2005
|
pixie encodes an ABC-E protein required for translation
Genetic mapping revealed that pixie encodes an ABC-E protein that
possesses two N-terminal iron-sulphur binding domains and two C-terminal ABC
domains (Coelho et al., 2005
)
(see Introduction and Fig.
2A,B). DNA sequence analysis of pixie alleles identified
mis-sense mutations in conserved residues in both the ABC and iron-sulphur
domains, confirming that both are essential for Pixie function
(Fig. 2B and legend). Diverse
cellular functions have been assigned to the human homolog of Pixie, RLI,
including inhibiting RNaseL, aiding lentivirus capsid assembly and stabilizing
MyoD mRNA (Kerr, 2004
;
Zimmerman et al., 2002
;
Dooher and Lingappa, 2004
;
Bisbal et al., 2000
). Given
that the yeast homolog of Pixie is involved in ribosomal biogenesis and
translation initiation (Kispal et al.,
2005
; Yarunin et al.,
2005
; Dong et al.,
2004
), and the phenotypic similarities between pixie and
the Minutes, we investigated whether Pixie is also involved in
translation. Immunostaining revealed that Pixie is predominantly cytoplasmic
in Drosophila S2 Schneider cells and imaginal discs (see Fig. S1 in
the supplementary material and Fig.
3), consistent with a role in translation. dsRNAi-mediated
depletion of Pixie from Drosophila S2 cells significantly lowers
global translation within 2 days (Fig.
2C). Furthermore, sucrose sedimentation experiments suggest that
Pixie associates with ribosomes in a salt-sensitive manner, suggesting that
the association is peripheral and Pixie is not a part of the core ribosomal
complex (Fig. 2D). Further
biochemical analyses also suggest that Pixie, like yeast RLI1, is required for
normal translation (D. Andersen and S.J.L., unpublished).
pixie hypomorph wing discs display distinct patterns of elevated cell death
pixie hypomorphs are developmentally delayed and have extended
larval periods during which the growth of both whole larvae and imaginal discs
is slowed. A higher than normal level of apoptosis is observed in
pixie mutant wing discs (compare
Fig. 4B with A,
Fig. 4F-G with C). This
increased apoptosis changes from uniformly distributed clusters during the
early to mid third-instar (Fig.
4B) to a distinct pattern in the late third instar. In these late
third instar discs (9/12 discs examined a day before wandering and 5/16
examined at wandering), the apoptosis is particularly intense in the wing
pouch (Fig. 4F) and there is
consistently less apoptosis in the hinge than elsewhere in the disc. Shortly
before pupation (in the remaining discs examined a day before and at
wandering) apoptosis is less intense and more uniformly distributed
(Fig. 4G). Nevertheless, at
this stage, it is often elevated at the dorsoventral (DV) boundary and at the
edges of the pouch (thin and thick arrow in
Fig. 4G). Thus, there is a
transient period during late third instar well before pupation, when apoptosis
is intense in the wing pouch. Interestingly, the wing discs of two
Minutes, M(3)66D1/+ and M(3)95A1/+
also show a similar pattern of apoptosis during early to mid-third instar (see
Fig. S2 in the supplementary material and data not shown) and late third
instar (Fig. 4H,I,K).
|
Although cell death is elevated in the wing discs of pixie
hypomorphs, the resulting adults have a near normal body size, suggesting that
extra cell divisions must compensate for the increased cell death. Indeed, the
unusual increase in pixie hypomorph wing size relative to thorax size
may be partly due to such compensatory cell division. Expression of the
Caspase inhibitor, p35, in the posterior compartment of pixie mutant
discs increases the ratio of posterior compartment size to anterior
compartment size, relative to that in control wings also expressing p35 in the
posterior compartment (Fig.
4M-N) (Hay et al.,
1994
). It has recently been shown that induction of the cell death
pathway can generate a growth-promoting signal that increases wing size, when
the execution of cell death itself is suppressed by p35. Such a mechanism
causes extensive overgrowth in wings in which the death inducer Hid is
co-expressed with p35 and involves the expression of Wg in cells in which the
death signal is activated (Huh et al.,
2004
; Perez-Garijo et al.,
2004
). We do observe that, when p35 is expressed in the posterior
compartment of pixie mutant discs, Wg is ectopically expressed in
that compartment (arrow in Fig.
4N), suggesting that a reported mechanism can operate by which the
cell death might be compensated (Huh et
al., 2004
; Perez-Garijo et
al., 2004
).
pixie is required for balanced growth and cell survival in wing discs
Although mild reductions in pixie function can allow an increase
in cell proliferation (to compensate for cell death), stronger reductions in
pixie function clearly reduce growth and cell proliferation. When
Pixie levels are reduced through RNAi in S2 cells, cell number is reduced and
an increased proportion of cells accumulate in G1, indicating that Pixie may
be required for G1 to S progression (Fig.
2D, lower panels). Furthermore, wing disc clones of
pixL17, a strong hypomorphic lethal allele, are reduced in
frequency and clone size compared with their wild-type sister clones (twins,
Figs 5,
6). Inhibition of apoptosis in
the posterior compartment by expression of p35 significantly rescues the
frequency of pixL17 mutant clones
(Fig. 5B-D). However, these
mutant clones are still smaller than their sister clones, suggesting that
pixie is required in the wing disc for cell division and growth as
well as cell survival. When pixL17 mutant clones were
generated late in larval life, rare clones survived to the adult wing and
displayed a strong reduction in cell number but not cell size (see
Fig. 5A and its legend).
Together, these observations demonstrate that strong reductions in
pixie function reduce both balanced growth and cell survival.
Balanced growth is the term used to describe an affect on growth (increase in
mass) that is accompanied by a corresponding effect on cell division, thus
leaving cell size unaltered (de la Cova et
al., 2004
).
|
|
Direct cell counting methods showed that increase in cell number slows from
early-mid third instar onwards (Bryant and
Levinson, 1985
) (see Fig. S2 in the supplementary material).
Johnston and Sanders (Johnston and
Sanders, 2003
) have shown that wing pouch cells have a longer
median doubling time (MDT) than hinge cells. The growth of the twins of
pixie mutant clones generated in a pix/+ background is
similar to the growth of wild-type clones generated in a wild-type background
(compare Fig. 6A,D with Fig. S3
in the supplementary material), enabling an estimation of disc growth rates in
our experiments. Early and late clone induction windows were chosen that
allowed a similar median number of twin cell divisions (see
Fig. 6D). Thus, average mutant
clone/twin size is comparable between the early 29-hour and 30-hour windows
and the late 44-hour and 37-hour windows (see red numbers in
Fig. 6D,G). To analyze an early
fast growth phase, clones were examined at the mid-third instar (pink boxes
Fig. 6A,D), and to examine the
late slow growth phase, clones were examined at larval wandering - the end of
the larval growth period (blue boxes Fig.
6A,D). In the experiments in
Fig. 6D-F, the average twin MDT
during the early fast growth phase is 9.4 hours. During the late slow growth
phase, the average twin MDT is 12.8 hours, 27% longer than during the fast
growth phase. MDT is on average 13% longer in the pouch than the hinge, during
the fast phase and 12% longer during the slow phase (see
Fig. 6B,C for regional
demarcation). Thus, the pouch and hinge growth rates decrease to a similar
extent in going from the fast to slow phase (26 and 28%, respectively; see
Materials and methods). Although not quantified, clone sizes in the
presumptive thorax (notum) appear similar to those in the hinge.
During the fast growth phase (Fig. 6E) pixL17 mutant clone size and frequency are greatly reduced even within 29 or 30 hours of clone induction, and clones are completely absent within 46 hours. pixL17 clone growth is poorer in the hinge than the pouch. This is consistent with Pixie being required for translation and the fact that the hinge grows faster than the pouch, resulting in stronger competitive pressure on hinge mutant clones (see below). As disc growth slows, pixL17 mutant clones grow better in the hinge than during the fast phase (compare hinge data in Fig. 6E with F). Increasing the length of the clone induction window can normally strengthen the phenotype by decreasing the level of perdurant wild-type Pixie; the late windows (44 hours and 37 hours) are longer than the early windows (30 hours and 29 hours). Therefore, the better growth of pixie mutant clones during the late windows does reflect a lower requirement for pixie in the hinge during slower growth.
By contrast, pixL17 mutant clone growth in the pouch remains poor during part of the slow growth phase (Fig. 6F). This is most clearly seen in the 44-hour window (Fig. 6F). The sudden increase in strength of phenotype as the clone induction window is extended from 37 to 44 hours, suggests that pixie is strongly required in the pouch at the beginning of the slow phase. This strong requirement in the wing pouch for pixie at this stage was seen in two additional independent experiments (the 46 hour late window in Fig. 5D, left panels; and an additional 44 hour late window, data not shown). Furthermore, other strong pixie alleles have a similarly severe clone phenotype in the pouch, compared with the hinge during part of the slow growth phase (data not shown), indicating that this phenotype is not allele specific. Although not quantified, the growth of pixie mutant clones in the notum appears similar to that in the hinge. Thus, the growth defect of pixie mutant clones is unexpectedly stronger in the slower-proliferating pouch area in late larval discs. Interestingly, clones that are mutant for the eukaryotic translation initiation factor, eIF4A show no such regional differences in their ability to grow within the wing disc during both the fast and slow growth phases (Fig. 6G).
|
|
To study the involvement of cell competition, pixie mutant clones were made in the M(3)66D1/+ background (henceforth referred to as the Minute background), using clone induction windows that span the fast and slow growth phases (Fig. 7A,B). When pixie Minute+ clones in a Minute background are examined at approximately the end of the rapid phase of growth, they are larger than those generated in a non-Minute (Minute+) background and no longer grow more slowly in the hinge than in the pouch. This is clearly observed by comparing clone size distributions of pixie mutant clones in the Minute versus Minute+ background (compare Fig. 7C with D, and Fig. 7E with F). Thus, pixie mutant clones are subject to cell competition; that is, the reduction in mutant clone growth or survival is influenced by the rate of growth of the surrounding cells. These results indicate that the regional differences in pixie mutant clone presence during the fast growth phase in normal discs correlates, as a result of cell competition, with the growth rate of the surrounding tissue (see above).
Cell competition has been suggested to be due at least partially to
differences in the ability of cells to compete for Dpp
(Moreno et al., 2002
;
Moreno and Basler, 2004
).
Minute M(2)C clones are considered to transduce the Dpp signal
inefficiently; thus, these clones ectopically express brinker and are
eliminated in the wing pouch, a region of high Dpp signalling and low
brinker expression (Moreno et
al., 2002
). However, elevated brinker expression is not
observed in all cases of cell competition
(de la Cova et al., 2004
).
pixL17 mutant clones in the wing pouch examined during mid
third instar and pre-wandering stages do not express brinker (see
Fig. S5 in the supplementary material), suggesting that pixie mutant
clones are not eliminated because of an inability to compete for Dpp.
The Minute background enhances the pixie mutant clone growth defect during the slow phase
During the slow growth phase, pouch cells grow more slowly than hinge
cells; thus, the poor growth of pixie mutant clones in the pouch is
unlikely to be due to stronger cell competition there. Indeed, our analysis
reveals that the representation of pixie mutant clones at this stage
is not improved in a Minute background (compare
Fig. 7G with H and
Fig. 7I with J). In the hinge,
it is difficult to estimate pixie mutant clone growth in the
Minute background because of clone fragmentation (see Materials and
methods). However, a growth advantage is not visible. In the pouch,
pixie mutant clones actually grow more poorly in a Minute
background than those made in the Minute+ background. It
is clear that differences in pixie mutant clone growth between the
pouch and hinge are maintained, and even exaggerated, in the Minute
background. An impairment of clone growth in a Minute background has
not been reported for other mutant clones. It is likely that during the slow
phase, wing pouch cells require sufficient levels of Pixie and Rp function in
neighbouring cells for normal growth. Minute-/- clones are
rapidly eliminated because of their very low level of Rp function. We have
noted that in the above Minute environment,
Minute-/- clones are more rapidly eliminated during the
slow phase than during the fast phase (Fig.
7), suggesting that the Minute environment during the
slow phase constrains growth/cell survival.
|
|
| Discussion |
|---|
|
|
|---|
We have found that reduced Rp and Pixie function, but not EIF4A function,
results in regional differences in growth and cell survival. The molecular
basis for these differences is not immediately clear and suggests that
reducing the function of different components of the translation machinery can
have different effects on disc growth and cell survival. Our results imply
that the regional differences in growth rates across the wing disc are not
accompanied by regional differences in levels of translation that are large
enough to result in detectable differences in the requirement for
eIF4A (Johnston and Sanders,
2003
; Garcio-Bellido and Merriam, 1971) (data shown here). By
contrast, the requirement for pixie and rp function does
seem to reflect regional differences in other properties that reflect the
non-homogenous nature of wing disc cells. It is intriguing that reducing
rp or pixie function does not result in randomly distributed
clusters of dying cells throughout the wing disc throughout development,
instead these clusters are elevated in the wing pouch towards the end of
development. However, this non-homogenous nature of wing disc cells is not
easily explained by what is known about the activities of signalling pathways
that regionally regulate cell survival and proliferation in the wing disc. For
example, Wg and Dpp signalling are required for cell survival and balanced
growth in the wing pouch (Neumann and
Cohen, 1996
; Giraldez and
Cohen, 2003
; Johnston and
Sanders, 2003
;
Martin-Castellanos and Edgar,
2002
; Moreno et al.,
2002
). A temporal analysis of the requirement for Wg signalling
revealed that Wg is required more strongly in the wing pouch for cell survival
during the fast growth phase (Johnston and
Sanders, 2003
). This contrasts with the pattern of cell death
observed in pixie mutant and Minute discs. Furthermore,
clonal analysis suggests that during the fast growth phase, pixie is
required more in the hinge than in the wing pouch. Johnston and Sanders also
suggest that Wg signalling constrains balanced growth in the wing pouch during
the late stages of disc growth. This observation is compatible with the poor
growth of pixie mutant clones in the wing pouch during slow phase
(see below). However, it is not compatible with a potential role for Wg in
compensation of pixie mutant cell death
(Huh et al., 2004
;
Perez-Garijo et al.,
2004
).
Similar to the eIF4A mutant clones, insulin-signalling mutants
have not been reported to show regional differences in their effect on wing
disc clone growth (S.J.L., unpublished). Besides Minute and
pixie mutant clones, clones that express lower levels of Myc also
show regional differences in their growth in wing discs
(Simpson, 1979
;
Moreno et al., 2002
;
Moreno and Basler, 2004
). Myc
has recently been shown to regulate levels of rRNA and also has the potential
to regulate levels of ribosomal proteins
(Grewal et al., 2005
). Thus
far, these regional effects in clone growth of Myc-underexpressing and
Minute clones have been attributed to differences in the severity of
cell competition (Moreno et al.,
2002
; Moreno and Basler,
2004
). Our findings however, raise the possibility that some of
these regional effects are due to sensitivity to growth constraints. During
the slow growth phase, the strong pixie clone phenotype in the pouch
is better explained by an increased sensitivity to growth-constraining
signals, rather than competition from faster-growing neighbouring cells.
A model to explain how Pixie might respond to growth constraining signals
A possible explanation for the dynamic spatial requirement for
pixie is that pixie responds to growth promoters that are
limiting for growth and also show dynamic spatial expression. However, it is
hard to explain why levels of these growth promoters would be limiting in the
early hinge and late pouch (where the pixie clone phenotype is
stronger), and not the early pouch and late hinge (where the pixie
clone phenotype is weaker). Thus, it is unlikely that the varying effects on
pixie mutant clone growth can be explained purely on the basis of the
differential activity of growth promoters. In addition, we observe that
reducing cell competition in Minutes does not remove the regional
differences in growth rate of Minute+ clones with a growth
advantage - pouch clones still grow more slowly than hinge clones. Our data
are more easily explained by a model in which growth results from a balance
between the activities of growth promoters and inhibitors. The inhibitors
antagonize the activity of the promoters and are at higher levels in the
pouch; pixie mutant cells show increased sensitivity to the growth
inhibitors. Thus, we propose that during the fast phase, levels of growth
inhibitors are low and growth promoters high, and pixie is required
more where growth is faster. As inhibitor levels rise during the slow phase
and promoter activity drops, pixie is now required more where
inhibitor levels are higher. pixie function may be the direct or
indirect target of inhibitor activity. Alternatively, pixie function
may counteract the activity of the inhibitors.
The model proposed above is based partly on a hypothetical, mathematically
simulated model described by Nijhout to explain how disc size is sensed and
growth stopped (Fig. 8)
(Nijhout, 2003
). This model
proposes that inhibitor levels are low during the exponential phase of growth,
but rise as disc growth slows and remain high during the slow growth phase.
Thus, Nijhout's model proposes differential gene activity (differences in
inhibitor levels) between the fast and slow growth phases. Computer
simulations using Nijhout's model show that increases in cell number correlate
with changes in activator and inhibitor concentrations over time, and resemble
the observed growth curve of imaginal discs. However, our model also requires
that the inhibitors are at higher levels in the pouch and thus it is an
adaptation of Nijhout's model (Fig.
8). The `gradient of responsiveness' model, which also proposes a
role for inhibitors in the determination of size, suggests that inhibitors may
exist at higher levels in the pouch to counteract the effects of morphogens
that are expressed at higher levels there
(Serrano and O'Farrell,
1997
).
|
A mild reduction in Pixie function results in an impairment of balanced
growth and cell survival that varies regionally and temporally in wing discs.
This impairment shows the classical characteristics of compensation known to
occur for example in wing discs subjected to X-irradiation
(Haynie and Bryant, 1977
).
Despite intensive cell death, close to normal final disc size is achieved,
without disturbing differentiation and pattern. However, the observed ability
of pixie mutant and Minute cells to compensate for defects
in survival and growth that occur earlier in development is interesting and
emphasises the intrinsic ability of these mutant cells to grow and survive.
The varying patterns of cell death with time can be seen as a reflection of
the different growth environments that these cells are subjected to as
development progresses. These mutant cells succumb to the changing environment
but do not fully interfere with the ability of the system to correct the
defects that arise due to cell death or even perhaps extra cell proliferation.
However, it is clear that this ability of the system to correct itself is
compromised to the extent that proportion is not always maintained and mild
overgrowth can occur (see Marygold et al.,
2005
; Coelho et al.,
2005
). Studying the ability of mutant tissues to respond to growth
constraints in vivo should advance our understanding of how the slowing down
of growth is triggered.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/132/24/5411/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bisbal, C., Silhol, M., Laubenthal, H., Kaluza, T., Carnac, G.,
Milligan, L., Le Roy, F. and Salehzada, T. (2000). The
2'-5' oligoadenylate/RNase L/RNase L inhibitor pathway regulates
both MyoD mRNA stability and muscle cell differentiation. Mol.
Cell. Biol. 20,4959
-4969.
Brogiolo, W., Stocker, H., Ikeya, T., Rintelen, F., Fernandez, R. and Hafen, E. (2001). An evolutionarily conserved function of the Drosophila insulin receptor and insulin-like peptides in growth control. Curr. Biol. 11,213 -221.[CrossRef][Medline]
Brower, D. L. (1986). Engrailed gene expression in Drosophila imaginal discs. EMBO J. 5,2649 -2656.[Medline]
Bryant, P. J. and Simpson, P. (1984). Intrinsic and extrinsic control of growth in developing organs. Q. Rev. Biol. 59,387 -415.[CrossRef][Medline]
Bryant, P. J. and Levinson, P. (1985). Intrinsic growth control in the imaginal primordia of Drosophila, and the autonomous action of a lethal mutation causing overgrowth. Dev. Biol. 107,355 -363.[CrossRef][Medline]
Clemens, J. C., Worby, C. A., Simonson-Leff, N., Muda, M.,
Maehama, T., Hemmings, B. A. and Dixon, J. E. (2000). Use of
double-stranded RNA interference in Drosophila cell lines to dissect signal
transduction pathways. Proc. Natl. Acad. Sci. USA
97,6499
-6503.
Coelho, C. M. and Leevers, S. J. (2000). Do growth and cell division rates determine cell size in multicellular organisms? J. Cell Sci. 113,2927 -2934.[Abstract]
Coelho, C. M., Kolevski, B., Walker, C. D., Lavagi, I., Shaw,
T., Ebert, A., Leevers, S. J. and Marygold, S. J. (2005). A
genetic screen for dominant modifiers of a small-wing phenotype identifies
proteins involved in splicing and translation in Drosophila melanogaster.
Genetics 171,597
-614.
Cohen, S. (1993). Imaginal disc development. InThe Development of Drosophila melanogaster (ed. M. Bate and A. M. Arias), pp. 747-842. New York: Cold Spring Harbor Laboratory Press.
Dahanukar, A., Walker, J. K. and Wharton, R. P. (1999). Smaug, a novel RNA-binding protein that operates a translational switch in Drosophila. Mol. Cell 4, 209-218.[CrossRef][Medline]
Datar, S. A., Jacobs, H. W., de la Cruz, A. F., Lehner, C. F. and Edgar, B. A. (2000). The Drosophila Cyclin D-Cdk4 complex promotes cellular growth. EMBO J. 19,4543 -4554.[CrossRef][Medline]
Day, S. J. and Lawrence, P. A. (2000). Measuring dimensions: the regulation of size and shape. Development 127,2977 -2987.[Abstract]
de la Cova, C., Abril, M., Bellosta, P., Gallant, P. and Johnston, L. A. (2004). Drosophila myc regulates organ size by inducing cell competition. Cell 117,107 -116.[CrossRef][Medline]