|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 November 2005
doi: 10.1242/dev.02095
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


1 Department of Medicine, Children's Hospital, and Department of Pediatrics,
Harvard Medical School, Boston, MA 02115, USA
2 Institute for Molecular Bioscience, University of Queensland, St Lucia,
Brisbane, Queensland 4072, Australia
Author for correspondence (e-mail:
jordan.kreidberg{at}childrens.harvard.edu)
Accepted 19 October 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Mouse, Vegf, Wt1, Kidney, Angioblast, Flk-1/Flk1
| Introduction |
|---|
|
|
|---|
Many recent studies have significantly advanced our understanding of the
molecular basis of ureteric bud-mesenchymal interactions that initiate kidney
development. For example, Pax2 has been shown to regulate the
expression of glial cell line derived neurotrophic factor (Gdnf)
(Brophy et al., 2001
), a member
of the neurotrophin family expressed by the metanephric and condensed
mesenchyme, which binds the c-Ret receptor expressed at the tip of the
ureteric bud to stimulate growth and branching of the bud
(Durbec et al., 1996
;
Sanicola et al., 1997
;
Trupp et al., 1996
). In
Gdnf-deficient embryos, there is no outgrowth of the ureteric bud
(Moore et al., 1996
;
Pichel et al., 1996
;
Sanchez et al., 1996
).
Compared with that of Pax2, our understanding of how the Wt1
gene regulates the interactions that initiate kidney development is less well
understood. Wt1 encodes a zinc finger transcription factor; this gene
was first identified as a tumor suppressor gene for Wilms' tumor, a neoplasm
of the kidney that occurs in young children
(Call et al., 1990
;
Gessler et al., 1990
;
Glaser et al., 1989
).
Wt1 is expressed in the metanephric mesenchyme and increases in
expression as the mesenchyme condenses around the ureteric bud, finally being
restricted to the podocyte population of the glomerulus, where it continues to
be expressed in the mature kidney. Many genes have been identified as
potential targets for Wt1
(Scharnhorst et al., 2001
),
but it has been difficult to reconcile these findings with the renal agenesis
phenotype of Wt1-deficient embryos
(Kreidberg et al., 1993
). For
example, amphiregulin has been identified as a target for Wt1
(Lee et al., 1999
) and
stimulates branching morphogenesis in kidney organ cultures, but amphiregulin
mutant mice demonstrate normal kidney development
(Luetteke et al., 1999
).
Whether this can be accounted for by redundancy among EGF family members is
not known.
Recently, we reported the phenotype of transgenic mice in which a truncated
form of Wt1, expected to act in a dominant-negative fashion, was
specifically expressed in glomerular podocytes, which are
Wt1-expressing cells that form part of the filtration unit of the
kidney (Natoli et al., 2002a
).
Surprisingly, instead of yielding defects in podocyte differentiation,
expression of the mutant form of Wt1 resulted in abnormal development
of the glomerular capillaries that form in intimate contact with the
podocytes. This observation has led us to hypothesize that one function of
Wt1 is to regulate the expression of growth factors that are involved
in vascular development. A role for growth factors that stimulate vascular
development in kidney development was first suggested by Tufro, who
demonstrated that vascular endothelial growth factor A (Vegfa), or hypoxic
culture conditions, could stimulate proliferation and nephrogenesis in
metanephric kidney organ cultures (Tufro,
2000
; Tufro et al.,
1999
; Tufro-McReddie et al.,
1997
). Here we present results demonstrating that Wt1
does indeed regulate the expression of Vegfa. Furthermore, it is shown that
Vegfa produced by the mesenchyme stimulates branching morphogenesis and
nephrogenesis in the early kidney through reciprocal inductive events that
involve a population of Flk1 (Vegfr2; Kdr - Mouse Genome
Informatics)-expressing angioblasts. Thus, similarly to recent studies
identifying a role for angiogenic cells in hepatogenesis and pancreatic
development (Lammert et al.,
2001
; Matsumoto et al.,
2001
), this work identifies an interaction between angioblasts and
the condensed mesenchyme as an additional crucial interaction involved in
early kidney development, in addition to the classically recognized inductive
interaction between the mesenchyme and the ureteric bud
(Grobstein, 1953
).
| Materials and methods |
|---|
|
|
|---|
Microinjection and electroporation
The electroporation system modified from that previously used to
microinject chick neural tubes (Itasaki et
al., 1999
; Nakamura et al.,
2000
) is depicted in Fig.
1A. Metanephric kidney organ cultures were placed in a dish under
a drop of buffer, and plasmid vectors were injected into the culture using
15-20 µm diameter glass needles prepared using a Sutter Instrument
micropipette puller model P-87 (Sutter Instruments, Novato, CA). Settings on
the pipette puller were: Heat 400; Pull 150; Velocity 100; Time 100. The glass
tubes for making needles were obtained from Sutter, (#BF100-50-10), outer
diameter 1.0 mm, inner diameter 0.5 mm, 10 cm length. Needles were connected
by thin tubing to a FemtoJet microinjection device (Eppendorf, Hamburg,
Germany) using the following settings: injection Pressure 6.00 psi;
compensation pressure 1.00 psi; injection time 0.4 seconds, two injections per
injection site. A square wave electroporator (BTX ECM830, Genetronics Inc.,
San Diego, CA) was used to pulse the culture immediately after the injection,
using rectangular electrodes (gold plated, Model 516, Genetronics Inc.) placed
in parallel on either side of the organ culture before the injection. The
parameters used here were voltage: 36 V; number of pulse: 5; pulse length: 50
ms; internal time: 100 ms. After growing for 6-48 hours, cultures were
analyzed to examine gene expression, culture growth and differentiation.
In-vitro kidney cultures and immunocytochemistry
Embryonic day (E) 11.5 metanephric rudiments were isolated from embryos of
FVB mice, placed on nitrocellulose filters (0.1 µm pore size, Nuclepore
Track-Etch Membrane, Whatman 0930059), suspended over DMEM/10% fetal calf
serum (FCS) and cultured at the air/medium interface for 24, 36, 48 or 72
hours at 37°C with 5% CO2. Blocking antibodies or
pharmacological agents were added to the growth medium as mentioned for each
experiment. Kidney cultures were fixed in 4% paraformaldehyde (PFA) for in
situ hybridization with RNA probes, or fixed in methanol and stained with
antibodies. Branch tips were quantified by manual counting after
anti-cytokeratin staining, nephron proximal tubule units were identified by
staining with Lotus lectin or Brush Border antibody. Results were
statistically analyzed by Student's t-test. Antibody staining: kidney
cultures were fixed in ice-cold methanol for 10 minutes, washed in PBS
containing 1% bovine serum albumin (BSA) at room temperature and incubated
overnight in primary antibodies at 4°C. The samples were then washed three
times for 2 hours each in PBS at room temperature and incubated overnight in
secondary antibodies at 4°C. Finally, after washing three times for 2
hours each in PBS at room temperature, organ cultures were analyzed using an
inverted fluorescence microscope (Nikon Eclipse TE 300), and imaged using a
Spot 1.4.0 digital camera (Diagnostic Instruments, Sterling Heights, MI).
Images were processed on Macintosh computers using Photoshop 6.0 (Adobe
Systems, Inc., San Jose, CA). Fluorescent alkaline phosphatase (AP) detection
used for Flk1 staining was essentially as published
(Natoli et al., 2004
).
In situ hybridization
Riboprobes were obtained or generated from the coding region of mouse
Gdnf (Srinivas et al.,
1999
) (obtained from F. Costantini, Columbia University),
Wt1 (Pelletier et al.,
1991
), Vegf164 (bases 75-669 in the murine cDNA,
amplified by PCR), Pax2 [(Dressler
et al., 1990
), obtained from P. Grus], Nanog [generated
in our laboratory cDNA 558-1140 (Chambers
et al., 2003
; Mitsui et al.,
2003
)], Osr1 [(So and
Danielian, 1999
), obtained from P. Danielian, Chester Beatty
Laboratories, London] and Wnt4
[(Stark et al., 1994
),
obtained from S. Vainio, University of Oulu, Finland], and subcloned in pCDNA3
or pCRII-TOPO (Invitrogen). Sense and antisense probes were synthesized and
labeled with digoxigenin-UTP (Roche). The protocol used for whole-mount in
situ hybridization was as published
(Wilkinson and Nieto, 1993
).
For section in situs, material was fixed in 4% paraformaldehyde and embedded
in paraffin. Sections were cut at 8uM and deparaffinized through xylene and a
standard ethanol series.
Real-time PCR analysis
As specified in the Results section, RNA was prepared either from whole
organ cultures or from sections co-injected with a GFP expression plasmid, in
which case GFP-expressing sections were micro-dissected apart from the rest of
the organ culture. Total RNA was isolated from kidney organ cultures, digested
with DNase 1 (Qiagen) and reverse-transcribed with SuperScript First-Strand
Synthesis System kit (Invitrogen) to get cDNA template. For Smart Cycler
Real-Time PCR reaction, a mastermix of the following reaction components was
prepared to the indicated end-concentration: Water (RNase free), forward
primer (0.3 µmol/l), reverse primer (0.3 µmol/l), TaqMan probe (0.2
µmol/l, Cepheid), Q solution (1x, Qiagen), dNTPs (0.2 mmol/l,
Biolabs), PCR buffer (1x, containing 15 mmol/l MgCl2, Qiagen), Taq DNA
polymerase (0.1 unit/µl, Biolabs), cDNA template (5 ng/µl). Smart Cycler
reaction mastermix was filled in the Smart Cycler reaction tubes [Cepheid
(Sunnyvale, CA)], which were closed, centrifuged and placed into the Smart
Cycler processing block (Cepheid). The following protocols were used: for
Gapdh and Vegfa, 94°C for 120 seconds; 94°C for 60
seconds, 58°C for 30 seconds, 72°C for 30 seconds, 40 cycles; cool to
4°C. For Pax2, 94°C for 120 seconds; 94°C for 30 seconds,
58°C for 30 seconds, 72°C for 45 seconds, 40 cycles; cool to 4°C.
For Gdnf, 94°C for 120 seconds; 94°C for 30 seconds, 60°C
for 45 seconds, 72°C for 45 seconds, 40 cycles; cool to 4°C. Primers
used were: gapdh (Forward: TCC ACC CAT GGC AAA TTC A; Reverse: TCG
CTC CTG GAA GAT GGT), Vegfa (Forward: AGC AAC ATC ACC ATG CAG AT;
Reverse: TCA CAG TGA TTT TCT GGC TTT G), Pax2 (Forward: TGG CTG TGT
CAG CAA AAT CCT; Reverse: ATTCGGCAATCTTGTCCACCA), and Gdnf (Forward:
TTC GCG CTG ACC AGT GA; Reverse: CTC TCT TCG AGG AAG CGC T). Standard curves
of Gapdh, Vegfa, Pax2 and Gdnf were generated using cDNA
dilutions from 10-3 µg/µl to 10-7 µg/µl
(data not shown); each dilution was run in triplicate, and Ct values all
varied by less than ±0.4 unit cycles. Vegfa, Pax2 and
Gdnf Ct values were normalized using Gapdh Ct values using
the following equation: Vegfa corrected Ct (sample 1) = Vegfa obtained Ct
(sample 1) x Gapdh Ct (sample 2) / Gapdh Ct (sample 1). Ct values were
converted to relative mRNA values using the Vegfa, Pax2 or
Gdnf standard curves.
|
| Results |
|---|
|
|
|---|
As a first test of this system, a green fluorescent protein (GFP)
expression construct (pCS2-EGFP) was microinjected into the E11 kidney organ
cultures (Fig. 1A, part c). GFP
was highly expressed in multiple cell layers at the site of injection (see
Fig. S1 in the supplementary material; additionally, Fig. S2 shows a slight
decrease in branching number as a consequence of electroporation, but the
pattern of Pax2 and Wt1 expression is preserved). To further examine the
ability of this system to manipulate biologically relevant aspects of kidney
development, a vector encoding Gdnf, the major growth factor
responsible for stimulating growth of the ureteric bud
(Sainio et al., 1997
;
Sanicola et al., 1997
), was
introduced into the organ culture by microinjection/electroporation. Localized
expression of Gdnf adjacent to the Wolffian duct led to outgrowth of
ectopic ureteric buds from the Wolffian duct, adjacent to the site of
injection (Fig. 1B, compare
with Fig. 1C). This was
observed in 100% of injections (the success rate for all experiments is
presented in Table 1).
Injection of an empty vector that did not contain the Gdnf cDNA never
resulted in ectopic bud outgrowth from the Wolffian duct
(Fig. 1C). In situ
hybridization with a Gdnf RNA probe showed strong expression of
Gdnf at the site of injection
(Fig. 1D, compare with sense
probe, Fig. 1E).
|
|
Vegfa is expressed in the metanephric kidney
The expression pattern of Vegfa in the early kidney is shown in
Fig. 3A. Vegfa expression was
present in the condensed mesenchyme and highest in pretubular aggregates
(Fig. 3A). Lower levels of
Vegfa were also present in the ureteric bud. In older kidneys, expression was
highest in podocytes of maturing glomeruli. The mesenchymal expression of
Vegfa overlapped with that of Wt1, which was also in condensed mesenchyme and
in pretubular aggregates, and highest in podocytes of older kidneys (data not
shown) (see Armstrong et al.,
1993
; Eremina et al.,
2003
).
Overexpression of Vegfa stimulates branching of the ureteric bud
Vegf164 is a predominant isoform of Vegfa
(Neufeld et al., 1999
). The
findings of Tufro, that Vegfa could stimulate branching morphogenesis and
induction of nephrons were confirmed both by adding Vegfa to the organ culture
(Fig. 3B), and by
microinjection/electroporation of a Vegfa expression vector (not shown).
Addition of Vegfa neutralizing antibodies to the organ culture also resulted
in decreased branching and nephron induction
(Fig. 3C).
|
Flk1 signaling is required to maintain differentiation of the condensed mesenchyme
Next it was determined whether the stimulation of kidney development by
Vegfa required signaling through Flk1. Signaling by Flk1 was blocked by three
independent methods, all of which yielded similar results. Addition of an
Flk1-blocking antibody (DC101 from ImClone Systems)
(Fig. 4B), addition of a
chemical inhibitor of the kinase activity of Flk1 (tyrphostin SU1498) (data
not shown) or microinjection and electroporation of a dominant-negative
truncation mutant form of Flk1 (Tsou et
al., 2002
) (data not shown), all led to reduced branching of the
ureteric bud and reduced numbers of induced nephrons
(Fig. 4B).
To further examine the effect of angioblast-derived signals on the differentiation of the mesenchymal component of the early kidney, it was determined whether signaling through Flk1 is involved in maintaining expression of several genes characteristically expressed by the condensed mesenchyme. The expression of several known, and one novel, marker of the condensed mesenchyme was examined by whole-mount in situ hybridization in the presence or absence of the Flk1-blocking antibody. Pax2 expression in the mesenchyme was decreased in the presence of the Flk1-blocking antibody, as shown both by in situ hybridization and real-time PCR, the latter indicating an approximately fourfold decrease in expression level (Fig. 5A,B,K). Whether the expression of Pax2 in the ureteric bud was affected is difficult to determine using whole-mount in situ hybridization.
Pax2 has previously been shown to regulate the expression of
Gdnf (Brophy et al.,
2001
); and, as would be predicted in the presence of decreased
Pax2, Gdnf RNA levels measured by real-time PCR were also decreased
in the presence of the Flk1-blocking antibody
(Fig. 5L).
|
|
The Flk1-dependent signal acts on the condensed mesenchyme
The reduced branching of the ureteric bud observed after blockade of
signaling though Flk1 could be due to a signal from the angioblasts that acts
directly on the ureteric bud, or that acts on the mesenchyme, to indirectly
affect branching. To distinguish these possibilities, Vegfa was expressed by
microinjection/electroporation at the periphery of the condensed mesenchyme.
This resulted in a localized increase in Pax2 expression adjacent to
the injection site (Fig. 6A,
parts a,b), that was apparent within 6 hours of the injection, and that could
be inhibited by either the Flk1-blocking antibody
(Fig. 6A, parts d,e) or SU1498
(data not shown). This observation is most consistent with the possibility
that the Flk1-dependent signal is acting directly on the mesenchyme. By
contrast, if the Flk1-dependent signal were acting directly on the ureteric
bud, it would be expected that the ureteric bud would then induce higher
levels of Pax2 in its usual pattern within the condensed mesenchyme
around the ureteric bud.
The Flk1-dependent signal regulates stability of Pax2 mRNA
As signaling through Flk1 is apparently required to maintain high levels of
Pax2 RNA in the condensed mesenchyme, it can be hypothesized that
reduced branching of the ureteric bud upon blockade of Flk1 signaling would be
due to reduced expression of Pax2 and consequent decreased
stimulation of Gdnf expression. To further examine the role of the
Flk1-dependent signal, Gdnf expression in response to Pax2
microinjection/electroporation in the condensed mesenchyme was examined, in
the presence or absence of Flk1 blockade. Gdnf was abundantly
expressed in response to Pax2, but Flk1 blockade eliminated
Gdnf induction by Pax2
(Fig. 6B).
To further examine the mechanism by which the Flk1-dependent signal may regulate Pax2, the levels of Pax2 RNA expression were measured in response to either a generalized blockade of transcription by actinomycin-D (act-D) or a specific blockade of Flk1 signaling by a pharmacological agent, SU1498. As measured by real-time PCR, levels of Pax2 decreased 1000-fold over an 8-hour treatment period with act-D (Fig. 6C). By contrast, on treatment with SU1498, Pax2 mRNA levels initially decreased but reached a steady-state level significantly higher than that resulting from treatment with act-D. No additive effects were observed when act-D and SU1498 were combined. At least three possible explanations can be offered to account for these observations: (1) the Flk1-dependent signal acts to stabilize Pax2 RNA in the mesenchyme, and the lower level observed after Flk1 blockade reflects a high-turnover state of non-stabilized Pax2 RNA; (2) the difference in Pax2 RNA levels between act-D treatment and Flk1 blockade is due to retention of ureteric bud expression of Pax2 in the latter treatment, compared with complete loss of Pax2 RNA in the former treatment; (3) a third possibility, that the angioblast signal stimulates supra-basal transcription of Pax2, is also possible, although the failure of ectopically expressed Pax2 to induce expression of Gdnf under conditions of Flk1 blockade strongly suggests some degree of post-transcriptional regulation.
|
|
| Discussion |
|---|
|
|
|---|
In embryos carrying a homozygous targeted mutation in the Wt1
gene, the ureteric bud fails to grow out from the Wolffian duct, and there is
consequent apoptosis of the metanephric mesenchyme
(Kreidberg et al., 1993
). It
has been difficult to identify potential targets of Wt1 for which a
deficiency could account for the renal agenesis phenotype, even though several
studies have identified potential Wt1 target genes in the gonad,
including Sry (Hammes et al.,
2001
; Hossain and Saunders,
2001
) and Sf1 (Zfp162 - Mouse Genome
Informatics) (Wilhelm and Englert,
2002
). Low levels of Gdnf were detected in the
metanephric mesenchyme of Wt1-deficient embryos
(Donovan et al., 1999
),
suggesting that Gdnf may not be a target of Wt1, although it
remains possible that Wt1 is involved in boosting levels of
Gdnf to achieve bud outgrowth. More recently, siRNA to Wt1
was used in an organ culture system to confirm the requirement for
Wt1 in early kidney development, but this approach was less amenable
for identifying novel target genes, because of the requirement for
Wt1 to maintain cell viability
(Davies et al., 2004
). The
present study suggests Vegfa as a novel candidate target gene for
Wt1. The angioblast-mesenchyme interaction mediated by Vegfa appears to be
crucial in maintaining the initial differentiated state of the mesenchyme, and
in the absence of this interaction, it is likely that insufficient levels of
Pax2 and Gdnf are present to elicit outgrowth of the ureteric bud.
The conclusion that Flk1-expressing angioblasts express a signal that is required to initiate kidney development depends on their identification as the major, if not sole, cell type expressing Flk1 in the early metanephric kidney. Immunostaining for Flk1 and the use of Flk1-LacZ knock-in mice has failed to detect expression in other cell types, and particularly not in the ureteric bud. Furthermore, the observations that (1) localized Vegfa injection/electroporation results in adjacent Pax2 expression, as opposed to enhanced Pax2 expression around the ureteric buds, and (2) addition of Gdnf can overcome the Flk1 blockade, are both more consistent with a model that invokes the requirement for angioblasts, rather than direct stimulation of the ureteric bud by Vegfa. However, the possibility that very low levels of Flk1, not detectable by immunostaining or the use of knock-in mice, are expressed by the ureteric bud and involved in Vegfa stimulation of branching, remains a possibility that might be examined by genetic ablation of the Flk1 gene in the ureteric bud.
There are four major splice forms of the Wt1 gene, due to
alternative splicing of exon 5, and alternative insertion of a three amino
acid sequence, lysine-threonine-serine (KTS), at the end of exon 9
(Haber et al., 1991
). We
recently showed that elimination of exon 5 had no effect on kidney development
and function, and the role of this alternatively spliced exon remains unknown
(Natoli et al., 2002b
). Hammes
et al. (Hammes et al., 2001
)
have published the results of gene targeting experiments that allowed
expression of either the +KTS or -KTS forms of Wt1. In each case,
homozygous mutant embryos showed defective kidney development, with poorly
developed glomeruli, a phenotype more pronounced in the +KTS-only kidneys. The
difference in these phenotypes raised the question of whether this indicated
that the two splice forms of Wt1 have entirely distinct functions, or
whether the two phenotypes are due to differences in severity, but due to the
same function of the different splice forms. Supporting the former possibility
are observations that the +KTS form of Wt1 associates with spliceosomes
(Larsson et al., 1995
), and
has a speckled nuclear staining pattern, whereas the -KTS form has a more
diffuse staining pattern in the nucleus. In our microinjection and
electroporation system it has been observed that both the +KTS and -KTS forms
of Wt1 are capable of inducing expression of Vegfa. However, this
does not necessarily conflict with the likely possibility that the +KTS and
-KTS forms of Wt1 have common functions early in kidney development
but acquire distinct functions during podocyte differentiation. Indeed, both
+KTS- and -KTS-only embryos apparently undergo normal early kidney development
(Hammes et al., 2001
),
implying that they are interchangeable with regard to early functions of
Wt1.
Previous studies examining liver and pancreas development have identified
roles for the vascular system, and in particular Flk1-expressing cells in
organogenesis (Lammert et al.,
2001
; Matsumoto et al.,
2001
). Thus it appears to be an emerging paradigm that organs
require signals from angioblast-type cells to stimulate or maintain
organ-specific patterns of differentiation. It is not known whether liver- and
pancreas-associated angioblastic cells are responding to Vegfa produced by the
mesenchymal components of these organs. It will also be of great interest to
eventually determine whether these signal elaborated by pancreas-, liver- and
kidney-associated angioblasts are identical or differ between these
organs.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/132/24/5437/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Department of Pediatrics, Shandong Provincial Hospital, PR
China ![]()
| REFERENCES |
|---|
|
|
|---|
Armstrong, J. F., Pritchard-Jones, K., Bickmore, W. A., Hastie, N. D. and Bard, J. B. (1993). The expression of the Wilms' tumour gene, WT1, in the developing mammalian embryo. Mech. Dev. 40,85 -97.[CrossRef][Medline]
Brophy, P. D., Ostrom, L., Lang, K. M. and Dressler, G. R.
(2001). Regulation of ureteric bud outgrowth by Pax2-dependent
activation of the glial derived neurotrophic factor gene.
Development 128,4747
-4756.
Call, K. M., Glaser, T., Ito, C. Y., Buckler, A. J., Pelletier, J., Haber, D. A., Rose, E. A., Kral, A., Yeger, H., Lewis, W. H. et al. (1990). Isolation and characterization of a zinc finger polypeptide gene at the human chromosome 11 Wilms' tumor locus. Cell 60,509 -520.[CrossRef][Medline]
Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S. and Smith, A. (2003). Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113,643 -655.[CrossRef][Medline]
Davies, J. A., Ladomery, M., Hohenstein, P., Michael, L., Shafe,
A., Spraggon, L. and Hastie, N. (2004). Development of an
siRNA-based method for repressing specific genes in renal organ culture and
its use to show that the Wt1 tumour suppressor is required for nephron
differentiation. Hum. Mol. Genet.
13,235
-246.
Donovan, M. J., Natoli, T. A., Sainio, K., Amstutz, A., Jaenisch, R., Sariola, H. and Kreidberg, J. A. (1999). Initial differentiation of the metanephric mesenchyme is independent of WT1 and the ureteric bud. Dev. Genet. 24,252 -262.[CrossRef][Medline]
Dressler, G. R., Deutsch, U., Chowdhury, K., Nornes, H. O. and
Gruss, P. (1990). Pax2, a new murine paired-box-containing
gene and its expression in the developing excretory system.
Development 109,787
-795.
Durbec, P., Marcos, G. C., Kilkenny, C., Grigoriou, M., Wartiowaara, K., Suvanto, P., Smith, D., Ponder, B., Costantini, F., Saarma, M. et al. (1996). GDNF signalling through the Ret receptor tyrosine kinase [see comments]. Nature 381,789 -793.[CrossRef][Medline]
Eremina, V. and Quaggin, S. E. (2004). The role of VEGF-A in glomerular development and function. Curr. Opin. Nephrol. Hypertens. 13,9 -15.[Medline]
Eremina, V., Sood, M., Haigh, J., Nagy, A., Lajoie, G., Ferrara, N., Gerber, H. P., Kikkawa, Y., Miner, J. H. and Quaggin, S. E. (2003). Glomerular-specific alterations of VEGF-A expression lead to distinct congenital and acquired renal diseases. J. Clin. Invest. 111,707 -716.[CrossRef][Medline]
Fong, G. H., Rossant, J., Gertsenstein, M. and Breitman, M. L. (1995). Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature 376,66 -70.[CrossRef][Medline]
Fong, G. H., Zhang, L., Bryce, D. M. and Peng, J. (1999). Increased hemangioblast commitment, not vascular disorganization, is the primary defect in flt-1 knock-out mice. Development 126,3015 -3025.[Abstract]
Gessler, M., Poustka, A., Cavenee, W., Neve, R. L., Orkin, S. H. and Bruns, G. A. (1990). Homozygous deletion in Wilms tumours of a zinc-finger gene identified by chromosome jumping. Nature 343,774 -778.[CrossRef][Medline]
Glaser, T., Driscoll, D. J., Antonarakis, S., Valle, D. and Housman, D. (1989). A highly polymorphic locus cloned from the breakpoint of a chromosome 11p13 deletion associated with the WAGR syndrome. Genomics 5,880 -893.[CrossRef][Medline]
Grobstein, C. (1953). Inductive
Epithelio-mesenchymal interaction in the cultured organ rudiments of the
mouse. Science 118,52
-55.
Haber, D. A., Sohn, R. L., Buckler, A. J., Pelletier, J., Call,
K. M. and Housman, D. E. (1991). Alternative splicing and
genomic structure of the Wilms tumor gene WT1. Proc. Natl. Acad.
Sci. USA 88,9618
-9622.
Hammes, A., Guo, J. K., Lutsch, G., Leheste, J. R., Landrock, D., Ziegler, U., Gubler, M. C. and Schedl, A. (2001). Two splice variants of the Wilms' tumor 1 gene have distinct functions during sex determination and nephron formation. Cell 106,319 -329.[CrossRef][Medline]
Hossain, A. and Saunders, G. F. (2001). The
human sex-determining gene SRY is a direct target of WT1. J. Biol.
Chem. 276,16817
-16823.
Itasaki, N., Bel-Vialar, S. and Krumlauf, R. (1999). `Shocking' developments in chick embryology: electroporation and in ovo gene expression. Nat. Cell Biol. 1,E203 -E207.[CrossRef][Medline]
Kreidberg, J. A., Sariola, H., Loring, J. M., Maeda, M., Pelletier, J., Housman, D. and Jaenisch, R. (1993). WT-1 is required for early kidney development. Cell 74,679 -691.[CrossRef][Medline]
Lammert, E., Cleaver, O. and Melton, D. (2001).
Induction of pancreatic differentiation by signals from blood vessels.
Science 294,564
-567.
Larsson, S., Charlieu, J.-P., Miyagawa, K., Engelkamp, D., Rassoulzaegan, M., Ross, A., Cuzin, F., van Heyningen, V. and Hastie, N. D. (1995). Subnuclear localization of WT-1 in splicing or transcription factor domains is regulated by alternative splicing. Cell 81,391 -401.[CrossRef][Medline]
Lee, S. B., Huang, K., Palmer, R., Truong, V. B., Herzlinger, D., Kolquist, K. A., Wong, J., Paulding, C., Yoon, S. K., Gerald, W. et al. (1999). The Wilms tumor suppressor WT1 encodes a transcriptional activator of amphiregulin. Cell 98,663 -673.[CrossRef][Medline]
Loughna, S., Yuan, H. T. and Woolf, A. S. (1998). Effects of oxygen on vascular patterning in Tie1/LacZ metanephric kidneys in vitro. Biochem. Biophys. Res. Commun. 247,361 -366.[CrossRef][Medline]
Luetteke, N. C., Qiu, T. H., Fenton, S. E., Troyer, K. L., Riedel, R. F., Chang, A. and Lee, D. C. (1999). Targeted inactivation of the EGF and amphiregulin genes reveals distinct roles for EGF receptor ligands in mouse mammary gland development. Development 126,2739 -2750.[Abstract]
Matsumoto, K., Yoshitomi, H., Rossant, J. and Zaret, K. S.
(2001). Liver organogenesis promoted by endothelial cells prior
to vascular function. Science
294,559
-563.
Miettinen, A. and Linder, E. (1976). Membrane antigens shared by renal proximal tubules and other epithelia associated with absorption and excretion. Clin. Exp. Immunol. 23,568 -577.[Medline]
Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M. and Yamanaka, S. (2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113,631 -642.[CrossRef][Medline]
Moore, M. W., Klein, R. D., Farinas, I., Sauer, H., Armani, M., Philips, H., Reichardt, L. F., Ryan, A. M., Carver-Moore, K. and Rosenthal, A. (1996). Renal and neuronal abnormalities in mice lacking GDNF. Nature 382,76 -79.[CrossRef][Medline]
Nakamura, H., Watanabe, Y. and Funahashi, J. (2000). Misexpression of genes in brain vesicles by in ovo electroporation. Dev. Growth Differ. 42,199 -201.[CrossRef][Medline]
Natoli, T. A., Liu, J., Eremina, V., Hodgens, K., Li, C.,
Hamano, Y., Mundel, P., Kalluri, R., Miner, J., Quaggin, S. et al.
(2002a). A mutant form of the Wilms' tumor suppressor gene WT1
observed in Denys-Drash Syndrome interferes with glomerular capillary
development. J. Am. Soc. Nephrol.
13,2058
-2067.
Natoli, T. A., McDonald, A., Alberta, J. A, Taglienti, M. E.,
Housman, D. E. and Kreidberg, J. A. (2002b). A
mammalian-specific exon of WT1 is not required for development or fertility.
Mol. Cell. Biol. 22,4433
-4438.
Natoli, T. A., Alberta, J. A., Bortvin, A., Taglienti, M. E., Menke, D. B., Loring, J., Jaenisch, R., Page, D. C., Housman, D. E. and Kreidberg, J. A. (2004). Wt1 functions in the development of germ cells in addition to somatic cell lineages of the testis. Dev. Biol. 268,429 -440.[CrossRef][Medline]
Neufeld, G., Cohen, T., Gengrinovitch, S. and Poltorak, Z.
(1999). Vascular endothelial growth factor (VEGF) and its
receptors. FASEB J. 13,9
-22.
Newman, P. J. (1997). The biology of PECAM-1. J. Clin. Invest. 100,S25 -S29.
Pelletier, J., Schalling, M., Buckler, A. J., Rogers, A., Haber,
D. A. and Housman, D. (1991). Expression of the Wilms' tumor
gene WT1 in the murine urogenital system. Genes Dev.
5,1345
-1356.
Pichel, J. G., Shen, L., Sheng, H. Z., Granholm, A.-C., Drago, J., Grinberg, A., Lee, E. J., Huang, S. P., Saarma, M., Hoffer, B. J. et al. (1996). Defects in enteric innervation and kidney development in mice lacking GDNF. Nature 382, 73-76.[CrossRef][Medline]
Robert, B., St John, P. L. and Abrahamson, D. R. (1998). Direct visualization of renal vascular morphogenesis in Flk1 heterozygous mutant mice. Am. J. Physiol. 275,F164 -F172.
Sainio, K., Suvanto, P., Davies, J., Wartiovaara, J., Wartiovaara, K., Saarma, M., Arumae, U., Meng, X., Lindahl, M., Pachnis, V. et al. (1997). Glial-cell-line-derived neurotrophic factor is required for bud initiation from ureteric epithelium. Development 124,4077 -4087.[Abstract]
Sanchez, M. P., Silos-Santiago, I., Frisen, J., He, B., Lira, S. A. and Barbacid, M. (1996). Renal aegenesis and absence of enteric ganglions in mice lacking GDNF. Nature 382, 70-74.[CrossRef][Medline]
Sanicola, M., Hession, C., Worley, D., Carmillo, P., Ehrenfels,
C., Walus, L., Robinson, S., Jaworski, G., Wei, H., Tizard, R. et al.
(1997). Glial cell line-derived neurotrophic factor-dependent RET
activation can be mediated by two different cell-surface accessory proteins.
Proc. Natl. Acad. Sci. USA
94,6238
-6243.
Saxen, L. (1987). Organogenesis of the Kidney. Cambridge: Cambridge University Press.
Scharnhorst, V., van der Eb, A. J. and Jochemsen, A. G. (2001). WT1 proteins: functions in growth and differentiation. Gene 273,141 -161.[CrossRef][Medline]
Schedl, A. and Hastie, N. D. (2000). Cross-talk in kidney development. Curr. Opin. Genet. Dev. 10,543 -549.[CrossRef][Medline]
Shalaby, F., Ho, J., Stanford, W. L., Fischer, K. D., Schuh, A. C., Schwartz, L., Bernstein, A. and Rossant, J. (1997). A requirement for Flk1 in primitive and definitive hematopoiesis and vasculogenesis. Cell 89,981 -990.[CrossRef][Medline]
So, P. L. and Danielian, P. S. (1999). Cloning and expression analysis of a mouse gene related to Drosophila odd-skipped. Mech. Dev. 84,157 -160.[CrossRef][Medline]
Srinivas, S., Wu, Z., Chen, C. M., D'Agati, V. and Costantini, F. (1999). Dominant effects of RET receptor misexpression and ligand-independent RET signaling on ureteric bud development. Development 126,1375 -1386.[Abstract]
Stark, K., Vainio, S., Vassileva, G. and McMahon, A. P. (1994). Epithelial transformation of metanephric mesenchyme in the developing kidney regulated by Wnt-4. Nature 372,679 -683.[CrossRef][Medline]
Torres, M., Gomez, P. E., Dressler, G. R. and Gruss, P. (1995). Pax-2 controls multiple steps of urogenital development. Development 121,4057 -4065.[Abstract]
Trupp, M., Arenas, E., Fainzilber, M., Nilsson, A.-S., Sieber, B. A., Grigoriou, M., Kilkenny, C., Salazar-Grueso, E., Pachnis, V., Arumae, U. et al. (1996). Functional receptor for GDNF encoded by the c-ret proto-oncogene. Nature 381,785 -789.[CrossRef][Medline]
Tsou, R., Fathke, C., Wilson, L., Wallace, K., Gibran, N. and Isik, F. (2002). Retroviral delivery of dominant-negative vascular endothelial growth factor receptor type 2 to murine wounds inhibits wound angiogenesis. Wound Repair Regen. 10,222 -229.[CrossRef][Medline]
Tufro, A. (2000). VEGF spatially directs angiogenesis during metanephric development in vitro. Dev. Biol. 227,558 -566.[CrossRef][Medline]
Tufro, A., Norwood, V. F., Carey, R. M. and Gomez, R. A.
(1999). Vascular endothelial growth factor induces nephrogenesis
and vasculogenesis. J. Am. Soc. Nephrol.
10,2125
-2134.
Tufro-McReddie, A., Norwood, V. F., Aylor, K. W., Botkin, S. J., Carey, R. M. and Gomez, R. A. (1997). Oxygen regulates vascular endothelial growth factor-mediated vasculogenesis and tubulogenesis. Dev. Biol. 183,139 -149.[CrossRef][Medline]
Wilhelm, D. and Englert, C. (2002). The Wilms
tumor suppressor WT1 regulates early gonad development by activation of Sf1.
Genes Dev. 16,1839
-1851.
Wilkinson, D. G. and Nieto, M. A. (1993). Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods Enzymol. 225,361 -373.[Medline]
Xu, P. X., Adams, J., Peters, H., Brown, M. C., Heaney, S. and Maas, R. (1999). Eya1-deficient mice lack ears and kidneys and show abnormal apoptosis of organ primordia. Nat. Genet. 23,113 -117.[CrossRef][Medline]
Xu, P. X., Zheng, W., Huang, L., Maire, P., Laclef, C. and
Silvius, D. (2003). Six1 is required for the early
organogenesis of mammalian kidney. Development
130,3085
-3094.
This article has been cited by other articles:
![]() |
I. Kazama, Z. Mahoney, J. H. Miner, D. Graf, A. N. Economides, and J. A. Kreidberg Podocyte-Derived BMP7 Is Critical for Nephron Development J. Am. Soc. Nephrol., November 1, 2008; 19(11): 2181 - 2191. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Quaggin and J. A. Kreidberg Development of the renal glomerulus: good neighbors and good fences Development, February 15, 2008; 135(4): 609 - 620. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shi, D. Patschan, G. P. H. Dietz, M. Bahr, M. Plotkin, and M. S. Goligorsky Glial cell line-derived neurotrophic growth factor increases motility and survival of cultured mesenchymal stem cells and ameliorates acute kidney injury Am J Physiol Renal Physiol, January 1, 2008; 294(1): F229 - F235. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Schumacher, S. Jeruschke, F. Eitner, J. U. Becker, G. Pitschke, Y. Ince, J. H. Miner, I. Leuschner, R. Engers, A. S. Everding, et al. Impaired Glomerular Maturation and Lack of VEGF165b in Denys-Drash Syndrome J. Am. Soc. Nephrol., March 1, 2007; 18(3): 719 - 729. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||