|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 November 2005
doi: 10.1242/dev.02163
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Biochemistry and Molecular Biophysics, Center for Neurobiology and Behavior, Howard Hughes Medical Institute, Columbia University Medical Center, 701 West 168th Street, New York, NY 10032, USA
* Author for correspondence (e-mail: or38{at}columbia.edu)
Accepted 13 October 2005
| SUMMARY |
|---|
|
|
|---|
Key words: C. elegans, Chemosensory neurons, Laterality, Fate determination, MicroRNA
| Introduction |
|---|
|
|
|---|
We have recently identified a complex autoregulatory feedback loop that
controls a cell-fate decision in the nervous system of the nematode
Caenorhabditis elegans (Fig.
1A) (Chang et al.,
2004
; Chang et al.,
2003
; Hobert et al.,
1999
; Johnston and Hobert,
2003
; Johnston et al.,
2005
). The two morphologically bilaterally symmetric
taste-receptor neurons ASEL and ASER develop from a common ground state to
express a number of features that are specific for ASEL versus ASER
(Fig. 1A). These left/right
asymmetric features include the expression of several putative chemoreceptors
of the GCY family. For example, in adult animals, the gcy-7 gene is
exclusively expressed in ASEL, whereas the gcy-5 gene is exclusively
expressed in ASER (Fig. 1). The
expression of these two terminally differentiated states requires the activity
of a set of gene regulatory factors that interact with one another in a
bistable, double-negative feedback loop
(Johnston et al., 2005
). In
this loop, ASEL-specific inducer genes, including the die-1 zinc
finger transcription factor and the lsy-6 miRNA, activate other
ASEL-specific inducer and effector genes, while repressing ASER-inducers and
ASER-effectors in the ASEL neuron. By contrast, in the ASER neuron,
ASER-inducer genes, including the cog-1 homeobox gene and the
mir-273 miRNA, activate ASER-inducers and effectors, while repressing
the ASEL-inducing genes die-1 and lsy-6
(Fig. 1A).
What triggers the left/right asymmetric activity of the loop? Are there other, as yet unknown, factors that are components of the regulatory loop, and/or required for the loop to function appropriately? To address these questions, we have isolated and analyzed mutants in which the ASEL and/or ASER cell fates are not appropriately executed. We describe here one factor, lsy-2, that is required for the execution of the ASEL fate. lsy-2 codes for a novel C2H2 zinc finger transcription factor that is not an integral part of the regulatory loop. Rather, lsy-2 constitutes a permissive factor that is present in both ASEL and ASER, but is required specifically in ASEL for the execution of the ASEL fate. Furthermore, we show that lsy-2 exerts its activity by regulating the expression of the lsy-6 miRNA.
miRNAs are abundant gene regulatory factors that contribute to the
generation of cellular and morphological diversity in a developing organism
(Ambros, 2004
). Like other gene
regulatory factors that contribute to organismal complexity, many, if not
most, miRNAs are expressed in a spatially and temporally tightly controlled
manner (e.g. Wienholds et al.,
2005
), yet the mechanisms that control miRNA gene expression are
only beginning to be elucidated. Our identification of lsy-2 as a
regulator of the lsy-6 miRNA therefore contributes to our
understanding of the control of miRNA expression, and of the complex
regulatory networks necessary for terminal cell-fate specification.
| Materials and methods |
|---|
|
|
|---|
New transgenes: otEx2044=Ex[ceh-36prom::lsy-6; elt-2::gfp]; otEx1322 to otEx1324 - three independent lines of Ex[lsy-2prom::gfp; rol-6(d)]; otEx1325 to otEx1328, otEx1777 to otEx1780, and otEx1790 - nine independent lines of Ex[lsy-2::gfp; rol-6(d)]; otEx1945 to otEx1947, and otEx1954 - four independent lines of Ex[ceh-36prom::lsy-2; elt-2::gfp].
DNA constructs and generation of transgenic strains
lsy-2prom::gfp, lsy-2::gfp and
ceh-36prom::lsy-2 were constructed using a PCR fusion
approach (Hobert, 2002
). The
gfp constructs are shown in Fig.
4A. lsy-2prom::gfp was generated by fusing 3
kb upstream (up to the preceding gene) of the lsy-2 gene to the
gfp-coding region. The construct was injected at 50 ng/µl together
with rol-6(d) as an injection marker (100 ng/µl).
lsy-2::gfp was generated by fusing 3 kb of the upstream region and
the all of the exons and introns of lsy-2 to the gfp-coding
region and the unc-54 3'UTR. The construct was injected at 5
ng/µl together with rol-6(d) as an injection marker (100
ng/µl). ceh-36prom::lsy-2 was generated by fusing the 5
kb ceh-36 promoter (Chang et al.,
2003
) to the lsy-2 cDNA, including the coding region and
the 3' UTR. The construct was injected at 5 ng/µl together with
rol-6(d) as an injection marker (100 ng/µl).
Primer sequences (5' to 3')
lsy-2prom::gfp
Primer A, GTTGAATCCGACTTCTTCAGGG;
Primer A*, GTTTCTAGCAATCTGGTTGTTG;
Primer B, CTAGAGTCGACCTGCAGGCCATGACAAAATTTGCCTCAGAC;
Primer C, AGCTTGCATGCCTGCAGGTCGACT;
Primer D, AAGGGCCCGTACGGCCGACTA;
Primer D*, GGAAACAGTTATGTTTGGTATATTGGG.
lsy-2::gfp
Primer A, GTTGAATCCGACTTCTTCAGGG;
Primer A*, GTTTCTAGCAATCTGGTTGTTG;
Primer B, CTAGAGTCGACCTGCAGGCAATCAACTGTGGTTCCATCATC;
Primer C, D and D*, as above.
ceh-36prom::lsy-2
Primer A, CAAAAATGAGGCTACCAAG;
Primer A*, CAAAGTAGAGCACTGAGGGTG.
Primer B, CATTTCTTCTGGTTAGCATTTGTGCATGCGGGGGCAGG;
Primer C, CCTGCCCCCGCATGCACAAATGCTAACCAGAAGAAATG;
Primer D, GACTGCAAATGAGACAGTC;
Primer D*, GACGAAGACGACTCCATAG;
Primers were used as in PCR fusion reactions as previously described
(Hobert, 2002
).
RNA interference
RNAi was performed using a bacterial feeding protocol
(Simmer et al., 2003
). NGM
agar plates containing 6 mM IPTG and 100 µg/ml ampicillin were seeded with
bacteria expressing dsRNA, kindly provided by the Greenwald Laboratory.
otIs114; rrf-3 hermaphrodites at the L3/L4 stage were placed onto
these plates and grown at 15°C. Adults were then transferred onto freshly
seeded plates at 20°C, and their F1 progeny were scored for asymmetry and
sterility defects. RNAi was performed in a rrf-3(pk1426) background
because of its increased sensitivity to RNAi
(Simmer et al., 2003
).
Phenotypic analysis
Reporter transgenes were crossed into the respective mutant backgrounds.
All animals were scored with an Axioplan 2 microscope. When needed, ASE
neurons were unambiguously identified through the use of a transgene
(otIs151) that expresses DsRedz bilaterally in ASEL and ASER, as well
as in AWCL and AWCR, under control of the ceh-36 promoter
(Chang et al., 2003
).
| Results |
|---|
|
|
|---|
|
80 kb region on the X chromosome
(Fig. 2). Because all
previously cloned lsy genes coded for gene regulatory factors
(Chang et al., 2004
|
|
|
|
Non-nematode homologs
Database searches with the lsy-2 sequence using either the
full-length protein or individual zinc fingers revealed no clear orthologs of
lsy-2 in non-nematode species. However, the existence of a tightly
clustered, triple C2H2 zinc finger motif is reminiscent of the DNA-binding
domain found in the SP1/KLF proteins, a family of transcription factors with
wide-spread functions in growth and development
(Kaczynski et al., 2003
)
(Fig. 3B). The importance of
the triple zinc finger motif of LSY-2 is highlighted by the ot77
allele, which contains a missense mutation in the second zinc finger that is
predicted to affect DNA binding (Fig.
3A,B). This mutant causes an almost complete loss of gene function
(Table 1). Apart from the zinc
fingers themselves, the linker regions that connect the individual zinc
fingers are conserved between the triple zinc finger motifs of LSY-2 and the
SP1/KLF family (Fig. 3C). The
linker region is important for appropriately spacing the contacts that the
adjacent zinc fingers make with DNA, and this region is also engaged in direct
contacts with the phosphate backbone via a conserved lysine residue
(Iuchi, 2001
;
Pavletich and Pabo, 1991
).
Although many multiple-zinc finger proteins display a highly variable length
of the linker region (Iuchi,
2001
), the linker regions of LSY-2 and the SP1/KLF factors have a
similar length and share several amino acids. However, searching the C.
elegans genome sequence with human SP1 and Drosophila Sp1
proteins, or other KLF proteins, reveals several worm triple zinc finger
proteins that have a higher similarity to SP1/KLF proteins than LSY-2 does
(Oates et al., 2001
) (data not
shown). Taken together, our sequence analysis indicates that LSY-2 is likely
to be a DNA-binding protein that is not broadly conserved, but is distantly
related to the SP1/KLF-family of transcription factors.
|
|
|
Because the provision of extra copies of the lsy-2 gene in ASER with the ceh-36prom::lsy-2 transgene does not induce the ASEL fate in ASER, we can furthermore conclude that, even upon overexpression, lsy-2 is not sufficient to induce ASEL fate. Together with the normal expression of lsy-2 in both ASEL and ASER, we can conclude that lsy-2 acts permissively rather than instructively to induce ASEL fate in ASEL.
lsy-2 acts upstream of the lsy-6 miRNA
A bistable feedback loop consisting of the miRNAs lsy-6 and
mir-273, and their respective target transcription factors
cog-1 and die-1, is required for ASE laterality
(Fig. 1A)
(Johnston et al., 2005
).
Because the genetic removal of lsy-2 causes a conversion of ASEL to
the ASER stable state, we wanted to test what role lsy-2 plays in the
feedback loop. We first examined the effect of lsy-2 on the
ASEL-specific expression of the miRNA lsy-6. We found a complete loss
of lsy-6 expression in lsy-2 null mutant animals
(Fig. 5A). lsy-6
represses the expression of the cog-1 transcription factor in ASEL
and, as a result, expression of cog-1 is biased towards the right
cell (Johnston and Hobert,
2003
). As would be expected from a loss of endogenous
lsy-6 miRNA expression, cog-1 expression is de-repressed in
the ASEL neuron of lsy-2 null mutant animals
(Fig. 5B). The de-repression of
cog-1 in ASEL in lsy-2 null mutant is functionally relevant
and provides an explanation for the `two ASER' phenotype of lsy-2
mutants, as a reduction of cog-1 gene activity in a lsy-2
null mutant background significantly represses the adoption of the ASER fate
in ASEL (Table 4).
|
Because components of the regulatory loop regulate the expression of one
another (Fig. 1A), the effects
of lsy-2 on the expression of individual loop components could be
caused either by lsy-2 affecting the expression of only a single
component of the loop, or, alternatively, by lsy-2 independently
affecting the expression of several components of the loop. We previously
reported that die-1 is the likely output regulator of the loop that
directly or indirectly controls the expression of effector genes of the loop
(i.e. of the terminal differentiation markers)
(Johnston et al., 2005
). This
makes lsy-6 the regulatory gene that is most distal from the effector
genes (Fig. 1A). We first asked
whether ectopic expression of lsy-6 miRNA, which induces the ASEL
fate in both ASE neurons (Johnston and
Hobert, 2003
), requires the activity of lsy-2. If
lsy-2 is required for the expression of a loop component that acts
downstream of lsy-6 (i.e. anywhere between lsy-6 and the
effector genes), ectopic lsy-6 would not be able to exert its
ASEL-inducing effect in lsy-2 null mutants. If the effect of ectopic
lsy-6 expression is unaltered in lsy-2 null mutants,
lsy-2 would act upstream of lsy-6. If lsy-2 acts on
multiple components in the loop, intermediate effects might be expected. We
find that the ASEL-inducing activity of ectopic lsy-6 expression is
virtually unaffected in lsy-2 null mutants, as measured with two
distinct cell fate markers (Table
4).
Another approach to examine the epistatic relationship of lsy-2
and lsy-6 is to determine whether the loss of ASEL fate observed in
lsy-2 null mutants can be rescued by the expression of lsy-6
under the control of a heterologous, lsy-2-independent promoter in
ASEL. Indeed, in most lsy-2 null mutant animals examined,
heterologously expressed lsy-6 is able to restore the ASEL fate, as
measured with two distinct cell fate markers
(Table 4). lsy-6 is in
fact as efficient at restoring ASEL fate in ASEL in lsy-2 mutants as
it is at inducing ASEL fate when ectopically expressed in ASER (
80%;
Table 4). The most parsimonious
explanation of these observations is that lsy-2 acts upstream of
lsy-6 to regulate ASE asymmetry
(Fig. 5D).
lsy-6 is expressed in several neuron types besides ASEL, including
labial sensory neurons and the PVQ ventral cord interneurons
(Johnston and Hobert, 2003
).
Although lsy-2 is expressed in all of these neuron types,
lsy-6prom::gfp expression is lost only in the ASEL neuron
of lsy-2 null mutants, and not in other head or tail neurons (data
not shown). Like many transcription factor interactions with their target
genes (e.g. Altun-Gultekin et al.,
2001
; Tsalik et al.,
2003
), the genetic interaction of lsy-2 and
lsy-6 is therefore cell-type specific.
| Discussion |
|---|
|
|
|---|
A recent genome sequence analysis has revealed the presence of a conserved
8 bp motif located
200 bp upstream of virtually all known nematode miRNA
(Ohler et al., 2004
). This
observation suggested that a ubiquitously expressed transcription factor, such
as lsy-2, might act through this motif to enable or facilitate global
miRNA gene expression. However, we consider this possibility to be unlikely,
as deletion of this motif does not affect the expression of lsy-6
(data not shown). Loss of lsy-2 also does not affect lsy-6
expression in cells other than ASEL. A role for lsy-2 as a permissive
regulator of miRNA expression is also ruled out by the observation that none
of the morphological defects that are associated with the loss of the
lin-4 or let-7 miRNAs [lin-4: elongated, vulvaless
(Ambros and Horvitz, 1984
);
let-7: lethal because of bursting vulva
(Reinhart et al., 2000
)] can
be observed in lsy-2 null mutants (data not shown). LSY-2 is
therefore unlikely to be a general activator of miRNA gene expression.
In genetic terms, lsy-2 exerts its function by regulating the
cell-type specificity of lsy-6 miRNA gene expression, thereby making
lsy-2 one of the very few factors known to be involved in the spatial
control miRNA gene regulation. Although lsy-2 is expressed throughout
the nervous system, it nevertheless regulates lsy-6 in only one of
the three neuron classes that express lsy-6. Such cell-type
specificity in regulatory interactions is a common theme in transcriptional
regulation. One of the many prominent examples in C. elegans is the
LIM homeobox genes that regulate specific target genes in some cell types but
not in others, even though they are co-expressed
(Altun-Gultekin et al., 2001
;
Tsalik et al., 2003
).
Permissively acting factors in the bistable feedback loop
Our genetic screens have not only retrieved instructive, left/right
asymmetrically expressed factors that are both required and sufficient to
induce either the ASEL or ASER fate, but also permissive factors that control
the ASEL/ASER fate decision (Chang et al.,
2004
; Chang et al.,
2003
; Johnston and Hobert,
2003
). Instructive factors, such as lsy-6, cog-1, mir-273
(in conjunction with other miRNAs; Dominic Didiano and O.H., unpublished) and
die-1, are expressed asymmetrically in either ASEL or ASER and are
not only required to induce either the ASEL or ASER fate, but are also
sufficient to do so if misexpressed in the opposing cell. By contrast,
permissive factors are expressed in both ASEL and ASER, and are therefore only
required but not sufficient to induce the respective fate. As these permissive
factors are not expressed in a left/right asymmetric manner, they are not
intrinsic components of the bistable feedback loop shown in
Fig. 1A and
Fig. 5D, but are permissively
required to confer the activity of left/right asymmetric factors in the loop.
These permissive factors include the Groucho-like co-repressor UNC-37, the
PHD/bromodomain protein LIN-49, the OTX-type homeodomain protein CEH-36
(Chang et al., 2003
), and, as
we describe here, LSY-2. unc-37 is required for the execution of the
ASER fate, whereas lin-49, ceh-36 and lsy-2 are required for
the ASEL fate. What are the specific features of these permissively required
factors and how may their cell-type specific activities be explained?
unc-37/Groucho
Based on the genetic interactions of cog-1 and unc-
37/Groucho, and the presence of a Groucho-binding EH1 domain in the
COG-1 protein, the cell-type specific activity of the ubiquitously expressed
UNC-37 protein can be explained by its physical association with the
ASER-specific COG-1 homeodomain protein
(Chang et al., 2003
). In a
conceptually similar manner, the cell type-specific activity of UNC-37 in
regulating VA motoneuron specification can be explained by its association
with the VA motoneuron-specific homeodomain protein UNC-4
(Pflugrad et al., 1997
).
ceh-36/Otx
This Otx-type homeobox gene is only expressed in two pairs of head neurons
(Chang et al., 2003
;
Lanjuin et al., 2003
), but its
bilateral expression in ASEL and ASER still classifies the gene as a
permissive factor required for ASEL cell fate. One potential model that may
explain the cell-type specificity of ceh-36 proposes that
ceh-36 activity in ASER is competed for by the ASER-inducing
cog-1 gene, which is exclusively expressed in ASER
(Chang et al., 2003
).
lin-49
This gene codes for a PHD/bromodomain protein that is required for the
induction of the ASEL fate, as well as for the regulation of a variety of
other cell fate decisions (Chamberlin and
Thomas, 2000
). We have previously shown that a complete loss of
lin-49 function in lin-49 null mutant animals can be
partially suppressed by lowering cog-1 gene activity
(Chang et al., 2003
). This
effect would support a role of lin-49 upstream of cog-1.
Consistent with this notion, lin-49 mutants display a failure of
downregulation of cog-1 in ASEL in adult animals, a concomitant loss
of lsy-6 expression in ASEL, and, as a likely consequence of ectopic
cog-1 expression, a misregulation of the die-1 3'UTR
(data not shown). These are phenotypes that closely resemble those observed in
lsy-2 mutants, and it is conceivable that both proteins act together
to regulate the expression of lsy-6 and other ASEL-inducing
components of the feedback loop.
lsy-2
Of the above-mentioned cases, the case of unc-37 provides the
clearest example for how a bilaterally expressed, permissively acting factor
can confer cell-specific activity through physical association with
cell-specific, instructive regulatory proteins. By analogy to this case, a
good candidate to confer functional specificity to lsy-2 (and also
lin-49, which acts in a genetically similar manner to lsy-2)
is the ASEL-inducing zinc finger transcription factor die-1. Like
lsy-2, die-1 is required for the expression of the miRNA
lsy-6 (Chang et al.,
2004
). Genetically, the key difference between lsy-2 and
die-1 is that die-1 is left/right asymmetrically expressed
and can act instructively; that is, it can induce ASEL fate if it is
misexpressed in ASER. A common architectural feature of several
well-characterized cis-regulatory regions is the presence of binding
sites for both cell-type specifically expressed factors and broadly expressed
transcription factors, such as, for example, SP1 (to which LSY-2 is distantly
related) (e.g. Falvo et al.,
2000
; Xiao et al.,
1987
). Broadly expressed transcription factors appear to be
required for baseline promoter activity, and functionally synergize with
factors that provide spatiotemporal specificity. A similar scenario may hold
true for LSY-2, which may synergize with DIE-1 to efficiently activate
lsy-6 expression. An ongoing analysis of the lsy-6 promoter
may identify cis-regulatory elements that could be directly targeted
by DIE-1 and LSY-2 proteins.
The complexity of the ASEL versus ASER cell-fate decision
Factors that control the ASEL versus ASER cell fate decision and their
regulatory interactions are summarized in
Fig. 5D. Ongoing genetic
analysis in our laboratory has uncovered even more factors that are involved
in this cell fate decision. The gene regulatory network controlling the
diversification of the ASE neurons therefore appears to be unusually complex
at first sight. However, only if systematic and extensive genetic approaches
similar to those that we have taken with the ASE neurons are applied to other
neuronal fate decisions, can one assess whether such complexity in regulatory
networks may be the rule or the exception.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alpatov, R., Munguba, G. C., Caton, P., Joo, J. H., Shi, Y.,
Hunt, M. E. and Sugrue, S. P. (2004). Nuclear
speckle-associated protein Pnn/DRS binds to the transcriptional corepressor
CtBP and relieves CtBP-mediated repression of the E-cadherin gene.
Mol. Cell. Biol. 24,10223
-10235.
Altun-Gultekin, Z., Andachi, Y., Tsalik, E. L., Pilgrim, D.,
Kohara, Y. and Hobert, O. (2001). A regulatory cascade of
three homeobox genes, ceh-10, ttx-3 and ceh-23, controls cell fate
specification of a defined interneuron class in C. elegans.
Development 128,1951
-1969.
Amazit, L., Alj, Y., Tyagi, R. K., Chauchereau, A., Loosfelt,
H., Pichon, C., Pantel, J., Foulon-Guinchard, E., Leclerc, P., Milgrom, E. et
al. (2003). Subcellular localization and mechanisms of
nucleocytoplasmic trafficking of steroid receptor coactivator-1. J.
Biol. Chem. 278,32195
-32203.
Ambros, V. (2004). The functions of animal microRNAs. Nature 431,350 -355.[CrossRef][Medline]
Ambros, V. and Horvitz, H. R. (1984).
Heterochronic mutants of the nematode Caenorhabditis elegans.
Science 226,409
-416.
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Chamberlin, H. M. and Thomas, J. H. (2000). The bromodomain protein LIN-49 and trithorax-related protein LIN-59 affect development and gene expression in Caenorhabditis elegans. Development 127,713 -723.[Abstract]
Chang, S., Johnston, R. J., Jr and Hobert, O.
(2003). A transcriptional regulatory cascade that controls
left/right asymmetry in chemosensory neurons of C. elegans. Genes
Dev. 17,2123
-2137.
Chang, S., Johnston, R. J., Frokjaer-Jensen, C., Lockery, S. and Hobert, O. (2004). MicroRNAs act sequentially and asymmetrically to control chemosensory laterality in the nematode. Nature 430,785 -789.[CrossRef][Medline]
Chen, W. Y., Lee, W. C., Hsu, N. C., Huang, F. and Chung, B.
C. (2004). SUMO modification of repression domains modulates
function of nuclear receptor 5A1 (steroidogenic factor-1). J. Biol.
Chem. 279,38730
-38735.
Davidson, E. H. (2001). Genomic Regulatory Systems. San Diego: Academic Press.
Edlund, T. and Jessell, T. M. (1999). Progression from extrinsic to intrinsic signaling in cell fate specification: a view from the nervous system. Cell 96,211 -224.[CrossRef][Medline]
Falvo, J. V., Uglialoro, A. M., Brinkman, B. M., Merika, M.,
Parekh, B. S., Tsai, E. Y., King, H. C., Morielli, A. D., Peralta, E. G.,
Maniatis, T. et al. (2000). Stimulus-specific assembly of
enhancer complexes on the tumor necrosis factor alpha gene promoter.
Mol. Cell. Biol. 20,2239
-2247.
Hobert, O. (2002). PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic C. elegans. Biotechniques 32,728 -730.[Medline]
Hobert, O., Tessmar, K. and Ruvkun, G. (1999). The Caenorhabditis elegans lim-6 LIM homeobox gene regulates neurite outgrowth and function of particular GABAergic neurons. Development 126,1547 -1562.[Abstract]
Hodgkin, J. and Doniach, T. (1997). Natural variation and copulatory plug formation in Caenorhabditis elegans. Genetics 146,149 -164.[Abstract]
Iuchi, S. (2001). Three classes of C2H2 zinc finger proteins. Cell Mol. Life Sci. 58,625 -635.[CrossRef][Medline]
Johnston, R. J. and Hobert, O. (2003). A microRNA controlling left/right neuronal asymmetry in Caenorhabditis elegans. Nature 426,845 -849.[CrossRef][Medline]
Johnston, R. J., Jr, Chang, S., Etchberger, J. F., Ortiz, C. O.
and Hobert, O. (2005). MicroRNAs acting in a double-negative
feedback loop to control a neuronal cell fate decision. Proc. Natl.
Acad. Sci. USA 102,12449
-12454.
Kaczynski, J., Cook, T. and Urrutia, R. (2003). Sp1- and Kruppel-like transcription factors. Genome Biol. 4,206 .[CrossRef][Medline]
Lamond, A. I. and Spector, D. L. (2003). Nuclear speckles: a model for nuclear organelles. Nat. Rev. Mol. Cell. Biol. 4,605 -612.[CrossRef][Medline]
Lanjuin, A., VanHoven, M. K., Bargmann, C. I., Thompson, J. K. and Sengupta, P. (2003). Otx/otd Homeobox Genes Specify Distinct Sensory Neuron Identities in C. elegans. Dev. Cell 5,621 -633.[CrossRef][Medline]
Monod, J. and Jacob, F. (1961). Teleonomic
mechanisms in cellular metabolism, growth, and differentiation.
Cold Spring Harb. Symp. Quant. Biol.
26,389
-401.
Oates, A. C., Pratt, S. J., Vail, B., Yan, Y., Ho, R. K.,
Johnson, S. L., Postlethwait, J. H. and Zon, L. I. (2001).
The zebrafish klf gene family. Blood
98,1792
-1801.
Ohler, U., Yekta, S., Lim, L. P., Bartel, D. P. and Burge, C.
B. (2004). Patterns of flanking sequence conservation and a
characteristic upstream motif for microRNA gene identification.
Rna 10,1309
-1322.
Palmer, R. E., Inoue, T., Sherwood, D. R., Jiang, L. I. and Sternberg, P. W. (2002). Caenorhabditis elegans cog-1 Locus Encodes GTX/Nkx6.1 Homeodomain Proteins and Regulates Multiple Aspects of Reproductive System Development. Dev. Biol. 252,202 -213.[CrossRef][Medline]
Pavletich, N. P. and Pabo, C. O. (1991). Zinc
finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A.
Science 252,809
-817.
Pflugrad, A., Meir, J. Y., Barnes, T. M. and Miller, D. M., 3rd (1997). The Groucho-like transcription factor UNC-37 functions with the neural specificity gene unc-4 to govern motor neuron identity in C. elegans. Development 124,1699 -1709.[Abstract]
Reinhart, B. J., Slack, F. J., Basson, M., Pasquinelli, A. E., Bettinger, J. C., Rougvie, A. E., Horvitz, H. R. and Ruvkun, G. (2000). The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403,901 -906.[CrossRef][Medline]
Simmer, F., Tijsterman, M., Parrish, S., Koushika, S., Nonet, M., Fire, A., Ahringer, J. and Plasterk, R. (2002). Loss of the Putative RNA-Directed RNA Polymerase RRF-3 Makes C. elegans Hypersensitive to RNAi. Curr. Biol. 12,1317 .[CrossRef][Medline]
Simmer, F., Moorman, C., Van Der Linden, A. M., Kuijk, E., Van Den Berghe, P. V., Kamath, R., Fraser, A. G., Ahringer, J. and Plasterk, R. H. (2003). Genome-wide RNAi of C. elegans using the hypersensitive rrf-3 strain reveals novel gene functions. PLoS Biol. 1,E12 .[Medline]
Tsalik, E. L., Niacaris, T., Wenick, A. S., Pau, K., Avery, L. and Hobert, O. (2003). LIM homeobox gene-dependent expression of biogenic amine receptors in restricted regions of the C. elegans nervous system. Dev. Biol. 263,81 -102.[CrossRef][Medline]
White, J. G., Southgate, E., Thomson, J. N. and Brenner, S. (1986). The structure of the nervous system of the nematode Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. B Biol. Sci. 314,1 -340.[CrossRef]
Wicks, S. R., Yeh, R. T., Gish, W. R., Waterston, R. H. and Plasterk, R. H. (2001). Rapid gene mapping in Caenorhabditis elegans using a high density polymorphism map. Nat. Genet. 28,160 -164.[CrossRef][Medline]
Wienholds, E., Kloosterman, W. P., Miska, E., Alvarez-Saavedra,
E., Berezikov, E., de Bruijn, E., Horvitz, H. R., Kauppinen, S. and Plasterk,
R. H. (2005). MicroRNA expression in zebrafish embryonic
development. Science
309,310
-311.
Xiao, J. H., Davidson, I., Macchi, M., Rosales, R., Vigneron,
M., Staub, A. and Chambon, P. (1987). In vitro binding of
several cell-specific and ubiquitous nuclear proteins to the GT-I motif of the
SV40 enhancer. Genes Dev.
1, 794-807.
Zeng, C., Kim, E., Warren, S. L. and Berget, S. M. (1997). Dynamic relocation of transcription and splicing factors dependent upon transcriptional activity. EMBO J. 16,1401 -1412.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
S. Sarin, M. M. O'Meara, E. B. Flowers, C. Antonio, R. J. Poole, D. Didiano, R. J. Johnston Jr., S. Chang, S. Narula, and O. Hobert Genetic Screens for Caenorhabditis elegans Mutants Defective in Left/Right Asymmetric Neuronal Fate Specification Genetics, August 1, 2007; 176(4): 2109 - 2130. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Etchberger, A. Lorch, M. C. Sleumer, R. Zapf, S. J. Jones, M. A. Marra, R. A. Holt, D. G. Moerman, and O. Hobert The molecular signature and cis-regulatory architecture of a C. elegans gustatory neuron Genes & Dev., July 1, 2007; 21(13): 1653 - 1674. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. G. Wulczyn, L. Smirnova, A. Rybak, C. Brandt, E. Kwidzinski, O. Ninnemann, M. Strehle, A. Seiler, S. Schumacher, and R. Nitsch Post-transcriptional regulation of the let-7 microRNA during neural cell specification FASEB J, February 1, 2007; 21(2): 415 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Johnston Jr, J. W. Copeland, M. Fasnacht, J. F. Etchberger, J. Liu, B. Honig, and O. Hobert An unusual Zn-finger/FH2 domain protein controls a left/right asymmetric neuronal fate decision in C. elegans Development, September 1, 2006; 133(17): 3317 - 3328. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. O. Ortiz, J. F. Etchberger, S. L. Posy, C. Frokjaer-Jensen, S. Lockery, B. Honig, and O. Hobert Searching for Neuronal Left/Right Asymmetry: Genomewide Analysis of Nematode Receptor-Type Guanylyl Cyclases Genetics, May 1, 2006; 173(1): 131 - 149. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. HOBERT Architecture of a MicroRNA-controlled Gene Regulatory Network That Diversifies Neuronal Cell Fates Cold Spring Harb Symp Quant Biol, January 1, 2006; 71(0): 181 - 188. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||