|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 November 2005
doi: 10.1242/dev.02145
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


National Institute for Medical Research, The Ridgeway Mill Hill, London NW7 1AA, UK
Author for correspondence (e-mail:
jvincen{at}nimr.mrc.ac.uk)
Accepted 4 October 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Wingless, Arrow, LRP5/6, Frizzled, Endocytosis, Degradation, Morphogen, Drosophila
| Introduction |
|---|
|
|
|---|
Typically, the degradation of extracellular ligands is initiated by
receptor-mediated endocytosis, which is then followed by targeting to
multi-vesicular bodies and lysosomes. Two classes of receptors have been
implicated in Wnt signalling, the Frizzled class of seven-transmembrane
receptors and the LRP (LDL receptor-related protein) family. According to the
current model (Huelsken and Behrens,
2002
), Wingless signalling is initiated by the binding of Wingless
to Frizzled or Frizzled2. This leads to the recruitment of Dishevelled at the
plasma membrane and the association of the Frizzled-Wingless complex with
Arrow, the Drosophila homologue of LRP5/6. Arrow is then able to
recruit Axin, thus allowing Armadillo (the Drosophila homologue of
ß-catenin) to accumulate. Genetic analysis clearly shows that both
classes of receptors (Frizzled and Arrow/LRP) are essential for signal
transduction (Kennerdell and Carthew,
1998
; Chen and Struhl,
1999
; Wehrli et al.,
2000
). Binding assays suggest that ligand capture is primarily
performed by a Frizzled family member: Frizzled receptors are able to recruit
Wingless at the cell surface (Bhanot et
al., 1996
; Wu and Nusse,
2002
), while similar experiments have failed to show that Arrow
has such activity (Wu and Nusse,
2002
).
As shown by Cadigan et al. (Cadigan et
al., 1998
), overexpression of Frizzled2 causes Wingless
stabilization in wing discs. Indeed, it has been suggested that Frizzled2
could protect Wingless from degradation
(Cadigan et al., 1998
),
possibly by titrating a putative extracellular protease
(Eldar et al., 2003
). The
stabilizing effect of overexpressed Frizzled2 is somewhat surprising because
ligand degradation is usually initiated by receptor-mediated endocytosis and
subsequent targeting to lysosomes. In this paper, we investigate and compare
the role of the two signalling receptors Frizzled2 and Arrow in Wingless
degradation. We show that, while Frizzled2 internalizes Wingless, Arrow
targets internalized Wingless/Frizzled2 complexes to a degradative
compartment. Therefore, the two receptors contribute specific features that
together trigger Wingless degradation. The contribution of Arrow to
degradation explains why overexpression of Frizzled2 alone leads to
stabilization.
| Materials and methods |
|---|
|
|
|---|
C-HA, amino acids 1477 to 1602 (the N
terminal half of the intracellular region) were replaced with the glycine
linker and the HA tag. Frizzled2-FLAG carries the FLAG tag at the C terminus
and Frizzled2
C-FLAG lacks residues 621 to 694 retaining only 14
residues after the 7th transmembrane domain (with the FLAG tag at the C
terminus). The above constructs were introduced in pUAST for transgenic
expression and pMT/V5-HisA (Invitrogen) for expression in cell culture.
hs-Frizzled2-FLAG was made by subcloning Frizzled2-FLAG from pUAST into
CaSpeR-hs. Frizzled2-HA was generated by replacing the FLAG-tag sequence with
a HA-tag sequence in Frizzled2-FLAG. UAS-Frizzled2GPI (myc-tagged) was
obtained from R. Nusse (Stanford University). UAS-Shi[ts] was a gift from T.
Kitamoto. Expression of UAS constructs in cultured cells was induced by
co-transfecting pMTGal4 (driving Gal4 expression under the metallothionein
promoter), a gift from A. Ephrussi (EMBL). Additional details are available
upon request.
Drosophila stocks
The following transgenic stocks were used for exogenous expression:
UAS-HRP-wingless (Dubois et al.,
2001
), UAS-Frizzled2-FLAG/CyO,
UAS-Frizzled2
C-FLAG/CyO, UAS-Arrow-HA,
UAS-Arrow
C-HA/CyO, dpp-Gal4 UAS-Arrow-HA/TM6B (all
generated for this study), UAS-Dally-like (from S. Cohen, EMBL),
UAS-Armadillo[S10] (Pai et al.,
1997
), UAS-Armadillo (Marygold
and Vincent, 2003
), UAS-Shibire[ts]
(Kitamoto, 2001
) and
UAS-Frizzled2GPI (Cadigan et al.,
1998
). They were driven with dpp-Gal4, ap-Gal4 or
en-Gal4. hs-Frizzled2-FLAG was generated for this study while
hs-Patched was from Isabel Guerrero
(Sampedro and Guerrero,
1991
).
The following genotypes are depicted: dpp-Gal4/UAS-HRP-wingless
(Fig. 1A), dpp-Gal4/UAS-Frizzled2-FLAG (Fig.
2A-A''', Fig.
3A, Fig. S1A in the supplementary material),
dpp-Gal4/UAS-Frizzled2GPI (Fig.
2B-B''', Fig.
4B, Fig. S1C in the supplementary material),
UAS-Frizzled2-FLAG/+; dpp-Gal4/UAS-Arrow-HA
(Fig. 3B),
UAS-Armadillo[S10]/+; dpp-Gal4/UAS-Frizzled2-FLAG
(Fig. 3D), dpp-Gal4/UAS-Dally-like (Fig.
4A), UAS-Arrow-HA/+; dpp-Gal4/UAS-Dally-like
(Fig. 4A'), UAS-Arrow-HA/+; dpp-Gal4/UAS-Frizzled2GPI
(Fig. 4B'),
dpp-Gal4/UAS-Frizzled2
C-FLAG
(Fig. 4C), UAS-Frizzled2
C-FLAG/+; dpp-Gal4/UAS-Arrow-HA
(Fig. 4C'),
en-Gal4/UAS-Arrow
C-HA; hs-Frizzled2-FLAG/+
(Fig. 4D-D')
shi[ts]/Y; dpp-Gal4/UAS-Arrow-HA
(Fig. 5D), hs-Frizzled2-FLAG/+ (Fig.
6A-D), hs-Patched/+
(Fig. 6E-F) and
UAS-Frizzled2-FLAG/+; dpp-Gal4/UAS-Frizzled2-FLAG (see Fig. S1B in
the supplementary material).
For the shibire[ts] experiments, the following genotypes are depicted: dpp-Gal4/UAS-Shibire[ts] (Fig. 1D), ap-Gal4/+; UAS-Shibire[ts]/+ (Fig. 1F), shibire[ts]/+; en-Gal4 UAS-Armadillo (Fig. 1G) and shibire[ts]/Y; en-Gal4 UAS-Armadillo/+.
For loss-of-function studies, clones of mutant cells were induced by Flp-mediated mitotic recombination by heat-shocking larvae 2 days after egg laying for 1 hour at 37°C.
For arrow mutant clones, the following stocks were used: FRT42D pwn arr[2]/Gla Bc (obtained from R. Mann, Columbia University), FRT42D pcna ubi-GFP/CyO-GFP; lama-Gal4 UAS-Flp (from I. Salecker, NIMR, London), UAS-CD8-GFP hs-Flp; FRT42D tub-Gal80; tubulin-Gal4 (from S. Cohen, EMBL), FRTG13 arr[2]/CyO and y w hs-Flp; FRT G13 M(2)58F ubi-GFP/CyO (from X. Lin, Cincinnati Children's Hospital).
The following genotypes are depicted: y w hs-flp/+; FRT G13 M(2) 58F ubi-GFP/FRTG13 arr[2] (Fig. 7B-B'), FRT42D pcna/FRT42D pwn arr[2]; lama-Gal4 UAS-Flp (see Fig. S2 in the supplementary material) and UAS-CD8-GFP hs-Flp; FRT42D tub-Gal80/FRT42D pwn arr[2]; tubulin-Gal4 (see Fig. 3A-A' in the supplementary material).
For frizzled frizzled2 mutant clones, the following stocks were used: y w hs-Flp; Sp/CyO; fz[P21] Dfz2[C2] ri FRT2A/TM2 (from G. Struhl, Columbia University) and y; M(3)I55 FRT2A; p[nls-GFP]/TM6B (from F. Schweisguth, Ecole Normale Superieure, Paris). The genotype depicted in Fig. 7A-A' is y w hs-Flp/+; fz[P21] Dfz2[C2] ri FRT2A/M(3)I55 FRT2A.
For the deep-orange mutant clones the following stocks were used:
dor[8] FRT18A/FM6 and w arm-LacZ FRT18A; hs-Flp
(Sevrioukov et al., 1999
). The
genotype depicted in Fig. 1B,C
is dor[8] FRT18A/w arm-LacZ FRT18A; hs-Flp/+.
For hrs (l(2)23AdD28) mutant clones, the following stocks were
used: hrs FRT40A/CyO and y w hs-Flp; ubi-GFP FRT40A. For the
arrow rescue, the following stocks were used: arr[2]
UAS-Arrow
C/Gla Bc and arr[2] arm-Gal4/Gla
Bc.
Antibodies
The following primary antibodies were used: mouse anti-Wingless 4D4
(prepared from cells obtained from the DSHB), mouse M2 anti-FLAG (Sigma;
1/15,000), rabbit anti-FLAG (Abcam; 1/3000), mouse anti-HA 1.1 (Babco;
1/3000), Alexa-488 labelled mouse anti-HA 1.1 (Covance; 1/500), mouse anti-Myc
(Roche; 1/600), rabbit anti-Myc (Santa Cruz; 1/500), rabbit anti-GFP (Abcam;
1/2500), rabbit anti-ß-galactosidase (Cappel; 1/12,000), mouse
anti-Distalless (a gift from Ian Duncan; 1/500), mouse-anti-Armadillo N2
7A1(DSHB; 1/150), mouse anti-Engrailed 4D9 (DSHB;1/200) and mouse anti-Patched
(a gift from Isabel Guererro; 1/50). Rabbit anti-Arrow antibody was raised for
this study against peptide 892-908 (1/5000). Rabbit anti-Frizzled2 antibody
was raised against peptide 232-251 (1/2000). The following reagents were used
for secondary detection: Alexa488-conjugated goat anti-rabbit (Molecular
Probes; 1/200), Alexa488-conjugated goat anti-mouse (Molecular Probes; 1/200),
Alexa594-conjugated goat anti-mouse (Molecular Probes; 1/200), Cy5-conjugated
goat anti-rabbit (Jackson; 1/200) and Alexa555 Zenon mouse IgG1 labelling kit
(Invitrogen).
Larval treatments
Heat-shock induced expression of Frizzled2 and Patched was obtained by
incubating intact larvae at 37°C for 35 minutes and chasing at room
temperature for the indicated times before fixation. Localized (UAS-Shi[ts])
or uniform (shi[ts] hemizygous) temporary inhibition of
shibire activity was obtained by incubating intact third instar
larvae at 32°C for the indicated times before dissection.
Labelling of imaginal discs
Dextran labelling was carried out as described
(Entchev et al., 2000
) with a
10-minute pulse of Texas Red dextran (lysine fixable, Mr
3000; Molecular Probes) followed by a 20-minute chase to label the endocytic
compartment. Unless otherwise indicated, a standard antibody staining
technique was used for wing imaginal disc labelling. The original protocol for
extracellular staining (Strigini and
Cohen, 2000
) involves incubating live discs at 4°C to allow
primary antibody binding in the absence of endocytosis
(Strigini and Cohen, 2000
). As
endocytic blockade itself affects the spread of Wingless (see
Fig. 1D), we sought to avoid
the 4°C step and devised a post-fixation extracellular staining protocol.
After fixation in 4% PFA/PBS for 20 minutes at room temperature (in the
absence of detergent), discs were incubated for 30 minutes in 0.1% BSA/PBS.
Primary antibody incubation was performed in S2 medium overnight at 4°C.
Discs were then washed extensively in PBS and incubated for 2 hours at room
temperature with the secondary antibody diluted in 0.1% BSA/PBS. Following
extensive PBS washes, samples were post-fixed for 10 minutes in 4% PFA/PBS to
avoid dissociation of antibody complexes from the antigen. This step was found
to be crucial if the samples were further processed for intracellular
staining. Control antibody staining showed that lumenal markers of
intracellular organelles are not accessible by this staining protocol (see
also Chen et al., 2004
). In
order to label exclusively intracellular Wingless, discs were first subjected
to an extracellular staining with saturating amounts of anti-Wingless antibody
as described above. This ensured that when another primary antibody incubation
was performed, only intracellular Wingless molecules would be available for
antibody binding. Extracellularly stained discs were then permeabilized for 20
minutes in 0.05% Triton-X-100/PBS, incubated in blocking solution (0.1% BSA,
0.05% Triton-X-100/PBS) for 30 minutes and left overnight at 4°C in
blocking solution containing 20 mg/ml of nonspecific mouse IgG1 to saturate
remaining free sites on the secondary antibody used for extracellular
labelling. Discs were then stained for 2 hours at room temperature with
anti-Wg that had been fluorescently prelabelled using the Zenon antibody
labelling kit (Invitrogen) according to manufacturer's instructions. Following
a 30-minute wash in 0.05% Triton-X-100/PBS, discs were again postfixed and
mounted.
Wingless-binding/endocytosis assay
A standard calcium-phosphate transfection protocol was used both for
transient transfections and for the generation of stably transfected cell
lines. GFP-Wingless medium was prepared from S2 cells stably transfected with
a pMK33 construct containing a GFP-Wingless cDNA insert under the control of a
metallothionein promoter (S2-GFPWg cells). GFP-Wingless- and
control-conditioned media were prepared inducing S2-GFPWg and wild type S2
cells, respectively, for 2 days in serum free medium (SFM, Gibco) containing
0.375 mM CuSO4. The medium was cleared by centrifugation at 38,000
g for 25 minutes, and then concentrated 10x using
Centriprep YM-30 (Millipore). The concentrated medium was then supplemented
with 2% BSA (final concentration) and filtered (filter unit 0.2 µM,
Sartorius). Biological activity of GFP-Wingless conditioned medium was
confirmed by a standard Armadillo stabilization assay. GFP-Wingless binding
was carried out on ice as previously described
(Bhanot et al., 1996
) on S2
cells or S2R+ cells grown on coverslips and transiently transfected with the
various receptor constructs and induced over night with 0.25 mM
CuSO4. After binding, internalization was performed by shifting
cells to room temperature in normal growth medium for 30-40 minutes after a
quick ice-cold PBS wash. Uninternalized, cell surface bound GFP-Wingless was
stripped by a 30-second acid wash (0.5%Acetic acid, 0.5 M NaCl; pH 3) before
fixation and antibody staining. GFP-Wingless was detected with an anti-GFP
antibody. The transfected receptors were detected with antibodies against the
relevant epitope tag. To allow for comparative binding/internalization
analysis samples were processed in parallel.
Image analysis and fluorescence quantification
All quantitation was performed using the freeware ImageJ 1.33u
(http://rsb.info.nih.gov/ij/).
For quantitation of GFP-Wg binding to S2 cells, total fluorescence of
individual transfected and untransfected cells was calculated by applying an
identical threshold to all images to eliminate intracellular background and
summing the fluorescence intensity from a stack of 11 sections. In each
experiment, the fluorescence intensity of individual overexpressing cells was
corrected by subtracting the mean of the total cell fluorescence from the
population of untransfected cells.
Arrow RNAi
RNAi against arrow was performed by co-transfecting arrow
double-stranded RNA into S2R+ cells together with pMT-Frizzled2-FLAG using the
Effectene reagent (Qiagen) 2 days before the binding/internalization assay was
carried out. Functional ablation of the Arrow protein was confirmed by the
loss of signalling activity, as assayed by a modified superTOP FLASH
luciferase reporter assay (Takemaru and
Moon, 2000
) (C. Alexandre, unpublished). To generate an
arrow cDNA fragment suitable for in vitro transcription, the
following PCR primers were used:
5'ACGTTTAATACGACTCACTATAGGGAGAAAGATTGAGCGAGCCAGCAT and
5'TGCATTAATACGACTCACTATAGGGAGACTCGGCTCCTCCAAA.
In situ hybridization
In situ hybridization was performed according to standard protocols with a
digoxigenin-labelled wingless probe (C. Alexandre, NIMR, London).
| Results |
|---|
|
|
|---|
No significant ectopic Wingless signalling is seen in dor or
hrs mutant clones, as judged by target gene expression levels (not
shown). Presumably, this is because in these cells, Wingless accumulates in a
compartment where the receptors can no longer engage with the cytoplasmic
signal transduction machinery. To determine whether endocytic trafficking
contributes to signal downregulation, we assessed the effect of an earlier
block in the endocytic pathway. The temperature-sensitive dominant-negative
dynamin was expressed in the dorsal compartment (with the ventral compartment
as a control). After 5 hours at 32°C (restrictive temperature), expression
of distalless, a target of Wingless signalling, is noticeably
depressed (Fig. 1E), suggesting
a reduction in signalling, the opposite of our expectation. As a control, we
assessed the expression of engrailed, a gene that is not known to be
regulated by Wingless or another signal, and that is uniformly expressed in
the posterior compartment at this stage. This too was specifically reduced in
the dorsal compartment (Fig.
1F), suggesting that reduction of dynamin activity has a
non-specific effect on gene expression, perhaps in response to stress upon
reduction of endocytosis. No effect on dll expression was seen after
3 hours at restrictive temperature, suggesting that a transcriptional target
is not appropriate to assess the effect of Dynamin loss of function on
signalling. We therefore sought to measure Wingless signalling by looking at
an earlier event in the signalling cascade. This was accomplished by obtaining
an estimate of the rate of Armadillo degradation. Armadillo is stabilized in
response to Wingless signalling and this is particularly evident when
armadillo is overexpressed
(Marygold and Vincent, 2003
).
In discs expressing armadillo under the control of the
engrailed-Gal4 driver, Armadillo accumulation is confined to the
cells near the source of Wingless within the pouch
(Fig. 1G), even though the RNA
is produced uniformly throughout the posterior compartment. If Dynamin
activity is inhibited in this context (hemizygous shi[ts];
engrailed-Gal4/UAS-armadillo at 32°C for 3 hours), Armadillo
accumulates throughout the posterior of the wing pouch
(Fig. 1H), but not in the hinge
region where Wingless is absent. This is consistent with enhanced signalling
activity in response to a block in endocytosis (although we cannot exclude a
Wingless-independent effect of shi loss-of-function on Armadillo
stability). This suggests that endocytosis (and presumably subsequent
trafficking) normally participates in signal downregulation.
Frizzled2 is endocytosed and stimulates Wingless endocytosis
Before being targeted to lysosomes, Wingless is most probably internalized
by specific receptors. Although Frizzled and Frizzled2 both participate in
signal transduction, Frizzled2 is considered to be the main receptor because
of its high affinity for Wingless (Wu and
Nusse, 2002
). Overexpression of Frizzled2 causes Wingless
accumulation in wing imaginal discs, not degradation
(Cadigan et al., 1998
). Indeed,
it has been suggested that Frizzled2 could protect Wingless from degradation
by titrating out a putative extracellular protease
(Eldar et al., 2003
). Although
the contribution of extracellular proteases cannot be excluded, it is clear
that substantial degradation occurs in an endosomal compartment (see
Fig. 1). In light of this
finding, an alternative possibility is that Frizzled2 could protect Wingless
from degradation by blocking Wingless endocytosis, thus preventing subsequent
routing to lysosomes. We tested this possibility using imaginal discs and
cultured S2 cells.
|
To assess whether Frizzled2 stimulates Wingless endocytosis, we turned to a
cell culture assay. Conditioned medium from GFP-Wingless-expressing cells was
applied (at 4°C to prevent endocytosis) to S2R+ cells transfected with
Frizzled2. As expected from previous work
(Bhanot et al., 1996
), the
surface of transfected cells becomes decorated with GFP-Wingless
(Fig. 2C), confirming that
GFP-Wingless binds to Frizzled2. Upon switching the cells to room temperature,
which is permissive for endocytosis, GFP-Wingless rapidly accumulates in
intracellular Frizzled2-positive vesicles (shown in
Fig. 2D-D'). This
suggests that Frizzled2 can mediate Wingless internalization. Formation of
these vesicles requires endocytosis as it does not occur at 4°C nor in
cells that are co-transfected with temperature-sensitive dominant-negative
dynamin and kept at the restrictive temperature (not shown). As intracellular
accumulation of GFP-Wingless occurs to a significantly higher extent in
transfected cells than in untransfected cells (asterisk in
Fig. 2D-D'), we also
conclude that increasing the level of Frizzled2 leads to increased Wingless
endocytosis. By contrast, in agreement with our results in imaginal discs,
cells expressing high levels of Frizzled2GPI internalize Wingless poorly
(Fig. 2F-F'), even though
they bind Wingless very efficiently (Fig.
2E). Overall, these data suggest that Frizzled2 harbours an
internalization signal and that, by virtue of its ability to capture Wingless,
contributes to the targeting of Wingless into an endocytic compartment.
Clearly, then, overexpressed Frizzled2 does not stabilize Wingless by
preventing internalization.
|
|
|
C) (Fig.
4C,C') and, as a result, reduces Wingless internalization
(inset in Fig. 4C). Therefore,
Frizzled2 residues located between the first and last transmembrane domains
are required for the coordinated action of Arrow and Frizzled2 on Wingless
degradation. The ability of Arrow to cooperate with a form of Frizzled2 with
apparent reduced endocytic ability suggests that Arrow also carries its own
internalization signal. In support of this suggestion, we find that
overexpression of Arrow in S2R+ cells leads to a significant increase in the
internalization of exogenously added GFP-Wingless (data not shown).
A possible interpretation of our results is that Arrow could harbour, in
its intracellular domain, a signal that targets the Wingless-Frizzled2 complex
to degradation. This signal could be located between residues 1477 and 1612,
as overexpression of a truncated form of Arrow that lacks these residues
(Arr
C) on its own causes mild but reproducible accumulation of
endogenous Wingless in otherwise wild-type imaginal discs (not shown).
Moreover, Arr
C potentiates the stabilizing effect of Frizzled2.
Expression of Arr
C in the posterior compartment by the en-Gal4 driver,
followed by a uniform pulse of Frizzled2 expression throughout the disc,
causes an extension of the Wingless gradient in the posterior compartment
(Fig. 4D,D'), suggesting
stabilization. By contrast, in the same experimental protocol, full-length
Arrow causes a reduction of the gradient (not shown), consistent with
increased degradation. Unfortunately, Arr
C is less potent in signalling
than wild-type Arrow (weak signalling is restored in arrow mutants
overexpressing Arr
C) and therefore does not allow a clean uncoupling of
degradation and signalling. Nevertheless, we conclude that residues 1477 to
1612 contribute to improving the efficiency of Wingless degradation.
Arrow binds Wingless but less efficiently than Frizzled2
The results described in Figs
3 and
4 show that Arrow and Frizzled2
cooperate to bring about the degradation of Wingless, and that Arrow alone is
not sufficient as it has no or little effect on Frizzled2GPI- or
Dally-like-stabilized Wingless, respectively.
This could be due to the inability of Arrow to bind Wingless in the absence
of Frizzled2, as initial attempts failed to show Arrow-Wingless interaction in
cell-based binding assays or immunoprecipitation
(Wu and Nusse, 2002
) [however,
also see Cong et al. (Cong et al.,
2004
)]. Thus, we performed binding experiments in S2 cells
expressing comparable amounts of Arrow or Frizzled2. S2 cells expressing
Frizzled2 strongly accumulate GFP-Wingless from externally applied conditioned
medium (Fig. 5A-A';
Fig. 5C, top panel). By
contrast, transfected Arrow has a limited effect on GFP-Wingless accumulation
(Fig. 5B-B';
Fig. 5C, bottom panel)
suggesting that Arrow can only weakly contribute to capture.
Despite its capturing activity in cells, overexpressed Arrow alone does not cause Wingless accumulation in imaginal discs as Frizzled2 does. This could be because Wingless captured by Arrow would be promptly targeted to degradation. To assess the capturing activity of Arrow in the absence of degradation, Arrow was overexpressed in shi[ts] hemizygotes at 32°C. Mild Wingless accumulation in the domain of Arrow overexpression was seen (Fig. 5D), consistent with the weak capturing activity apparent in cell culture. From these results and from the observation that Arrow overexpression alone does not reduce the endogenous Wingless gradient in otherwise wild-type discs, we conclude that the contribution of Arrow to Wingless capture must be minor.
Frizzled2 endocytosis, and maybe degradation, are accelerated by the presence of Wingless
In principle, Frizzled2 could accompany Wingless all the way to a
degradation compartment. Alternatively, it could release Wingless earlier in
the endocytic pathway and be recycled to the cell surface. According to the
former possibility, Frizzled2 stability would be affected by the presence of
Wingless. We decided to monitor receptor endocytosis and decay following a
pulse of uniform exogenous expression of tagged protein. This method has two
benefits. First, it focuses on post-transcriptional control because the pulse
of transcription is uniform. Second, it allows clearance of biosynthetic
receptor thus enabling endocytosed receptors to be more readily recognized
than in steady state preparations. Transgenic larvae expressing FLAG-tagged
Frizzled2 under the control of the heat shock promoter were heat shocked for
35 minutes to induce uniform high-level expression. Levels of FLAG-Frizzled2
and Wingless were then monitored at subsequent time points.
Fig. 6A,B show that after a 1.5
hours chase, the number of Frizzled2-containing vesicles is higher around the
source of Wingless. These vesicles largely colocalize with Wingless (insets in
Fig. 6A,B), suggesting that
Wingless stimulates Frizzled2 internalization. After 3 hours, FLAG-Frizzled2
staining becomes depressed preferentially around the normal source of Wingless
(Fig. 6D, compared with 6C). To
verify that these effects are specific to Frizzled2 and that not all receptors
are preferentially trafficked in this region of the disc, an analogous assay
was performed with Patched using a heat shock-patched strain
(Sampedro and Guerrero, 1991
).
In contrast to the situation with Frizzled2, Patched is seen to decay rapidly
in the posterior compartment where its ligand, Hedgehog, is produced
(Fig. 6E,F). Preferential
degradation of Frizzled2 near the source of Wingless suggests that Wingless
could stimulate Frizzled2 degradation and that Wingless and Frizzled2 could be
targeted together to lysosomes. Because the decay of Frizzled2 in the Wingless
domain is not as pronounced as that of Patched in the Hedgehog domain, it is
likely that additional, non-Wingless-dependent mechanisms of degradation are
at play or that the Wingless-dependent mechanism is inefficient. Overall, our
data suggest a model whereby Arrow and Frizzled2 contribute different, though
overlapping, trafficking activities that, together, lead to targeting of
Wingless to a degradation compartment (Fig.
6G,H). Frizzled2 functions predominantly in capture, while Arrow
(and possibly downstream signalling) would be essential for targeting of
internalized Wingless to a degradative compartment.
|
Dextran labelling of imaginal discs shows that Wingless is still
internalized by arrow mutant cells (see Fig. S3 in the supplementary
material), suggesting that Frizzled and Frizzled2 may not require Arrow for
internalization. Indeed, S2R+ cells pretreated with Arrow-RNAi and transfected
with Frizzled2 internalize externally applied GFP-Wingless (see Fig.
S3B,B' in the supplementary material). We conclude that Frizzled2 can
capture and internalize Wingless independently of Arrow and hence also of
signalling. Conversely, clones of cells lacking Frizzled Frizzled2 have been
shown to internalize Wingless (Baeg et al.,
2004
), suggesting that these receptors are also dispensable for
Wingless internalization (although the frizzled [H51] allele used in
this study encodes a receptor that is truncated only after the sixth
transmembrane domain and thus retains both the Wingless-binding domain and
several intracellular residues). In order to compare the trafficking effects
of removing Arrow on the one hand with those of removing Frizzled Frizzled2 on
the other hand, we developed a method that specifically reveals intracellular
Wingless (and used alleles that are not expected to produce plasma
membrane-tethered receptors). The same preparations were also stained using a
`post-fixation extracellular only protocol' adapted from Strigini and Cohen
(see details in the Materials and methods). In both types of mutant clones,
intracellular staining is detected, confirming that Wingless internalization
can occur in the absence of these two receptor classes. Interestingly, large
Wingless-containing vesicles (arrowhead,
Fig. 7A') are relatively
depleted in frizzled frizzled2 mutant cells (when compared with
neighbouring wild-type tissue; Fig.
7A') although fine-grained staining is still seen. By
contrast, arrow mutant cells contain such vesicles at the same
density as wild-type cells (Fig.
7B'). Therefore, frizzled frizzled2 mutant cells
appear to be deficient in a trafficking step required to deliver or maintain
Wingless in these vesicles.
|
| Discussion |
|---|
|
|
|---|
Using gain-of-function experiments, we showed that Arrow contributes to the
targeting of Wingless, maybe as a complex with Frizzled2, to a degradative
compartment. As expected, loss of either Arrow or Frizzled and Frizzled2 leads
to extracellular accumulation of Wingless
(Baeg et al., 2004
;
Han et al., 2005
) (our own
observations). Frizzled and Frizzled2 are clearly redundant in this respect
(as in signalling) because removal of either receptor has no noticeable effect
on Wingless distribution (Han et al.,
2005
). Interestingly, large intracellular vesicles are lost in the
absence of Frizzled D-Frizzled 2 but not in the absence of Arrow. We suggest
that Frizzled-mediated endocytosis is sufficient to generate these large
vesicles in the absence of Arrow. The fine-grained Wingless staining seen in
the absence of Frizzled D-Frizzled 2 could be internalized by Arrow or by
another receptor, such as Dally or Dally-like. The distinct intracellular
distribution of Wingless in the absence of Frizzled D-Frizzled 2 when compared
with that in Arrow-deficient cells is consistent with the suggestion that the
two receptor classes have distinct trafficking activities.
It is unclear at this point whether the degrading activity of Arrow is
regulated by post-translational modification or by the recruitment of other
factors. Either process could be impaired in Arrow
C. Work in
Xenopus has identified negative regulators of Wnt signalling,
Kremens, which operate by triggering LRP6 endocytosis and possibly degradation
(Mao et al., 2002
). It remains
to be seen whether this leads to degradation of a Wnt during frog
embryogenesis. Moreover, there is no Kremen homologue encoded by the fly
genome. Clearly further work will be needed to understand the genetic control
of Wnt/Wingless degradation both in flies and other systems. Our data provide
a simple explanation of why overexpression of Frizzled2, a receptor that
mediates Wingless internalization, causes Wingless stabilization. Under such
experimental conditions, Arrow becomes limiting and in the absence of an
effective degradation signal, Wingless accumulates.
|
Because the receptors involved in Wingless degradation are those required
for signalling, Wingless degradation cannot be initiated before a
signalling-competent complex is assembled. Even though signalling downstream
of Armadillo is not sufficient to activate the degradation of
Frizzled2-Wingless complexes (Fig.
3D), we do not know yet whether downstream signalling is necessary
for degradation. In the case of EGF receptor signalling, ubiquitination, the
first step towards degradation of the ligand, is contingent on the tyrosine
phosphorylation that accompanies receptor activation
(Shtiegman and Yarden, 2003
).
However, in this case, a single receptor type is involved. In the case of
TGFß signalling, two receptor types are required for signal transduction.
Type 2 receptor is believed to capture the ligand and this is followed by the
formation of a tripartite complex with type 1 receptor
(Massague, 1998
).
Interestingly, like Arrow, type 1 receptor brings a degradation signal such
that the two types of receptor cooperate to direct the ligand towards
degradation and signalling pathways appropriately
(Anders et al., 1998
;
Di Guglielmo et al., 2003
;
Ebisawa et al., 2001
;
Kavsak et al., 2000
). Sharing
of trafficking duties by distinct receptors may provide cells with increased
flexibility as expression or turnover of the two receptors could be
independently modulated. It may not be a coincidence that both Dpp (the fly
TGF-ß) and Wingless, which can act over a relatively long distance, use
two receptors for signalling and degradation. Maybe separation of capture and
degradation is a feature required for long-range signalling, perhaps by
allowing modulation of local relative receptor levels.
Further work will be needed to identify the relevant trafficking signals in Arrow and Frizzled2, as well as the mechanisms that control relative receptor levels in order to obtain a full understanding of how degradation of Wingless is tuned to generate a reliable concentration gradient.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/132/24/5479/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: UMR 5547 Université Paul Sabatier/CNRS, Centre de
Biologie du Developpement, Bat 4R3, 118 Route de Narbonne, 31062 Toulouse,
France ![]()
| REFERENCES |
|---|
|
|
|---|
Anders, R. A., Dore, J. J., Jr, Arline, S. L., Garamszegi, N.
and Leof, E. B. (1998). Differential requirement for type I
and type II transforming growth factor beta receptor kinase activity in
ligand-mediated receptor endocytosis. J. Biol. Chem.
273,23118
-23125.
Bache, K. G., Slagsvold, T. and Stenmark, H.
(2004). Defective downregulation of receptor tyrosine kinases in
cancer. EMBO J. 23,2707
-2712.[CrossRef][Medline]
Baeg, G. H., Lin, X., Khare, N., Baumgartner, S. and Perrimon,
N. (2001). Heparan sulfate proteoglycans are critical for the
organization of the extracellular distribution of Wingless.
Development 128,87
-94.[Abstract]
Baeg, G. H., Selva, E. M., Goodman, R. M., Dasgupta, R. and
Perrimon, N. (2004). The Wingless morphogen gradient is
established by the cooperative action of Frizzled and Heparan Sulfate
Proteoglycan receptors. Dev. Biol.
276,89
-100.[CrossRef][Medline]
Bhanot, P., Brink, M., Samos, C. H., Hsieh, J. C., Wang, Y.,
Macke, J. P., Andrew, D., Nathans, J. and Nusse, R. (1996). A
new member of the frizzled family from Drosophila functions as a wingless
receptor. Nature 382,225
-230.[CrossRef][Medline]
Cadigan, K. M., Fish, M. P., Rulifson, E. J. and Nusse, R.
(1998). Wingless repression of Drosophila frizzled 2 expression
shapes the Wingless morphogen gradient in the wing.
Cell 93,767
-777.[CrossRef][Medline]
Chen, C. M. and Struhl, G. (1999). Wingless
transduction by the Frizzled and Frizzled2 proteins of Drosophila.
Development 126,5441
-5452.[Abstract]
Chen, C. M., Strapps, W., Tomlinson, A. and Struhl, G.
(2004). Evidence that the cysteine-rich domain of Drosophila
Frizzled family receptors is dispensable for transducing Wingless.
Proc. Natl. Acad. Sci. USA
101,15961
-15966.
Chen, W., ten Berge, D., Brown, J., Ahn, S., Hu, L. A., Miller,
W. E., Caron, M. G., Barak, L. S., Nusse, R. and Lefkowitz, R. J.
(2003). Dishevelled 2 recruits beta-arrestin 2 to mediate
Wnt5A-stimulated endocytosis of Frizzled 4. Science
301,1391
-1394.
Chen, Y. and Struhl, G. (1996). Dual roles for
patched in sequestering and transducing Hedgehog. Cell
87,553
-563.[CrossRef][Medline]
Cong, F., Schweizer, L. and Varmus, H. (2004).
Wnt signals across the plasma membrane to activate the beta-catenin pathway by
forming oligomers containing its receptors, Frizzled and LRP.
Development 131,5103
-5115.
Di Guglielmo, G. M., Le Roy, C., Goodfellow, A. F. and Wrana, J.
L. (2003). Distinct endocytic pathways regulate TGF-beta
receptor signalling and turnover. Nat. Cell Biol.
5, 410-421.[CrossRef][Medline]
Dubois, L., Lecourtois, M., Alexandre, C., Hirst, E. and
Vincent, J. P. (2001). Regulated endocytic routing modulates
wingless signaling in Drosophila embryos. Cell
105,613
-624.[CrossRef][Medline]
Ebisawa, T., Fukuchi, M., Murakami, G., Chiba, T., Tanaka, K.,
Imamura, T. and Miyazono, K. (2001). Smurf1 interacts with
transforming growth factor-beta type I receptor through Smad7 and induces
receptor degradation. J. Biol. Chem.
276,12477
-12480.
Eldar, A., Rosin, D., Shilo, B. Z. and Barkai, N.
(2003). Self-enhanced ligand degradation underlies robustness of
morphogen gradients. Dev. Cell
5, 635-646.[CrossRef][Medline]
Entchev, E. V., Schwabedissen, A. and Gonzalez-Gaitan, M.
(2000). Gradient formation of the TGF-beta homolog Dpp.
Cell 103,981
-991.[CrossRef][Medline]
Franch-Marro, X., Marchand, O., Piddini, E., Ricardo, S.,
Alexandre, C. and Vincent, J. P. (2005). Glypicans shunt the
Wingless signal between local signalling and further transport.
Development 132,659
-666.
Han, C., Yan, D., Belenkaya, T. Y. and Lin, X.
(2005). Drosophila glypicans Dally and Dally-like shape the
extracellular Wingless morphogen gradient in the wing disc.
Development 132,667
-679.
He, X., Semenov, M., Tamai, K. and Zeng, X.
(2004). LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin
signaling: arrows point the way. Development
131,1663
-1677.
Huelsken, J. and Behrens, J. (2002). The Wnt
signalling pathway. J. Cell Sci.
115,3977
-3978.
Kavsak, P., Rasmussen, R. K., Causing, C. G., Bonni, S., Zhu,
H., Thomsen, G. H. and Wrana, J. L. (2000). Smad7 binds to
Smurf2 to form an E3 ubiquitin ligase that targets the TGF beta receptor for
degradation. Mol. Cell
6,1365
-1375.[CrossRef][Medline]
Kennerdell, J. R. and Carthew, R. W. (1998).
Use of dsRNA-mediated genetic interference to demonstrate that frizzled and
frizzled 2 act in the wingless pathway. Cell
95,1017
-1026.[CrossRef][Medline]
Kitamoto, T. (2001). Conditional modification
of behavior in Drosophila by targeted expression of a temperature-sensitive
shibire allele in defined neurons. J. Neurobiol.
47, 81-92.[CrossRef][Medline]
Lloyd, T. E., Atkinson, R., Wu, M. N., Zhou, Y., Pennetta, G.
and Bellen, H. J. (2002). Hrs regulates endosome membrane
invagination and tyrosine kinase receptor signaling in Drosophila.
Cell 108,261
-269.[CrossRef][Medline]
Mao, B., Wu, W., Davidson, G., Marhold, J., Li, M., Mechler, B.
M., Delius, H., Hoppe, D., Stannek, P., Walter, C. et al.
(2002). Kremen proteins are Dickkopf receptors that regulate
Wnt/beta-catenin signalling. Nature
417,664
-667.[CrossRef][Medline]
Martinez Arias, A. and Steward, A. (2002).
Molecular Principles of Animal Development. Oxford:
Oxford University Press.
Marygold, S. J. and Vincent, J. P. (2003).
Armadillo levels are reduced during mitosis in Drosophila. Mech.
Dev. 120,157
-165.[CrossRef][Medline]
Massague, J. (1998). TGF-beta signal
transduction. Annu. Rev. Biochem.
67,753
-791.[CrossRef][Medline]
Pai, L. M., Orsulic, S., Bejsovec, A. and Peifer, M.
(1997). Negative regulation of Armadillo, a Wingless effector in
Drosophila. Development
124,2255
-2266.[Abstract]
Piddini, E. and Vincent, J. P. (2003).
Modulation of developmental signals by endocytosis: different means and many
ends. Curr. Opin. Cell Biol.
15,474
-481.[CrossRef][Medline]
Rulifson, E. J., Micchelli, C. A., Axelrod, J. D., Perrimon, N.
and Blair, S. S. (1996). wingless refines its own
expression domain on the Drosophila wing margin.
Nature 384,72
-74.[CrossRef][Medline]
Sabharanjak, S., Sharma, P., Parton, R. G. and Mayor, S.
(2002). GPI-anchored proteins are delivered to recycling
endosomes via a distinct cdc42-regulated, clathrin-independent pinocytic
pathway. Dev. Cell 2,411
-423.[CrossRef][Medline]
Sampedro, J. and Guerrero, I. (1991).
Unrestricted expression of the Drosophila gene patched allows a normal segment
polarity. Nature 353,187
-190.[CrossRef][Medline]
Sevrioukov, E. A., He, J. P., Moghrabi, N., Sunio, A. and
Kramer, H. (1999). A role for the deep orange and carnation
eye color genes in lysosomal delivery in Drosophila. Mol.
Cell 4,479
-486.[CrossRef][Medline]
Shtiegman, K. and Yarden, Y. (2003). The role
of ubiquitylation in signaling by growth factors: implications to cancer.
Semin. Cancer Biol. 13,29
-40.[CrossRef][Medline]
Strigini, M. and Cohen, S. M. (2000). Wingless
gradient formation in the Drosophila wing. Curr. Biol.
10,293
-300.[CrossRef][Medline]
Takemaru, K. I. and Moon, R. T. (2000). The
transcriptional coactivator CBP interacts with beta-catenin to activate gene
expression. J. Cell Biol.
149,249
-254.
von Zastrow, M. (2003). Mechanisms regulating
membrane trafficking of G protein-coupled receptors in the endocytic pathway.
Life Sci. 74,217
-224.[CrossRef][Medline]
Wehrli, M., Dougan, S. T., Caldwell, K., O'Keefe, L., Schwartz,
S., Vaizel-Ohayon, D., Schejter, E., Tomlinson, A. and DiNardo, S.
(2000). arrow encodes an LDL-receptor-related protein essential
for Wingless signalling. Nature
407,527
-530.[CrossRef][Medline]
Wu, C. H. and Nusse, R. (2002). Ligand receptor
interactions in the Wnt signaling pathway in Drosophila. J. Biol.
Chem. 277,41762
-41769.
Related articles in Development:
This article has been cited by other articles:
![]() |
T. Terabayashi, Y. Funato, M. Fukuda, and H. Miki A Coated Vesicle-associated Kinase of 104 kDa (CVAK104) Induces Lysosomal Degradation of Frizzled 5 (Fzd5) J. Biol. Chem., September 25, 2009; 284(39): 26716 - 26724. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Cadigan and M. Peifer Wnt Signaling from Development to Disease: Insights from Model Systems Cold Spring Harb Perspect Biol, August 1, 2009; 1(2): a002881 - a002881. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chiang, R. Priya, M. Ramaswami, K. VijayRaghavan, and V. Rodrigues Neuronal activity and Wnt signaling act through Gsk3-{beta} to regulate axonal integrity in mature Drosophila olfactory sensory neurons Development, April 15, 2009; 136(8): 1273 - 1282. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jaeger, D. Irons, and N. Monk Regulative feedback in pattern formation: towards a general relativistic theory of positional information Development, October 1, 2008; 135(19): 3175 - 3183. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Franch-Marro, F. Wendler, J. Griffith, M. M. Maurice, and J.-P. Vincent In vivo role of lipid adducts on Wingless J. Cell Sci., May 15, 2008; 121(10): 1587 - 1592. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Vaccari, H. Lu, R. Kanwar, M. E. Fortini, and D. Bilder Endosomal entry regulates Notch receptor activation in Drosophila melanogaster J. Cell Biol., February 25, 2008; 180(4): 755 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hayward, T. Kalmar, and A. Martinez Arias Wnt/Notch signalling and information processing during development Development, February 1, 2008; 135(3): 411 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kicheva, P. Pantazis, T. Bollenbach, Y. Kalaidzidis, T. Bittig, F. Julicher, and M. Gonzalez-Gaitan Kinetics of Morphogen Gradient Formation Science, January 26, 2007; 315(5811): 521 - 525. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Goodman, S. Thombre, Z. Firtina, D. Gray, D. Betts, J. Roebuck, E. P. Spana, and E. M. Selva Sprinter: a novel transmembrane protein required for Wg secretion and signaling Development, December 15, 2006; 133(24): 4901 - 4911. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Rusten, L. M.W. Rodahl, K. Pattni, C. Englund, C. Samakovlis, S. Dove, A. Brech, and H. Stenmark Fab1 Phosphatidylinositol 3-Phosphate 5-Kinase Controls Trafficking but Not Silencing of Endocytosed Receptors Mol. Biol. Cell, September 1, 2006; 17(9): 3989 - 4001. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Seto and H. J. Bellen Internalization is required for proper Wingless signaling in Drosophila melanogaster. J. Cell Biol., April 10, 2006; 173(1): 95 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Marois, A. Mahmoud, and S. Eaton The endocytic pathway and formation of the Wingless morphogen gradient Development, January 15, 2006; 133(2): 307 - 317. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||