|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 November 2005
doi: 10.1242/dev.02142
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Center, Hôpital Sainte-Justine, 3175 Cote Ste-Catherine, Montréal, Quebec H3T 1C5, Canada
* Author for correspondence (e-mail: jacques.michaud{at}recherche-ste-justine.qc.ca)
Accepted 4 October 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Hypothalamus, Transcription factor, Mammillary body, Mouse, Sim1, Sim2
| Introduction |
|---|
|
|
|---|
Most MB neurons send axonal projections to both the anterior thalamic
nuclei and the tegmentum via the MTT and the MTEG, respectively. The MTEG is
one of the earliest tracts to develop in the CNS, appearing at about E10.5
(Easter et al., 1993
;
Mastick and Easter, 1996
).
Much later, at about E17.5, each axon of the MTEG generates collateral that
will contribute to the formation of the MTT
(Van der Kooy et al., 1978
;
Cruce, 1977
;
Hayakawa and Zyo, 1989
;
Allen and Hopkins, 1990
). A
minority of MB neurons appear to contribute only to the MTT
(Hayakawa and Zyo, 1989
). MTT
axons are induced near the boundary between the dorsal and ventral thalami.
Recent observations indicate that the transcription factors PAX6 and FOXB1
regulate the expression of signals in this region that induce and/or guide MTT
axons (Valverde et al., 2000
;
Alvarez-Bolado et al., 2000
).
Both Pax6 and Foxb1 mutant mice are born with an intact MTEG
but without a MTT. In Foxb1 mutant embryos, MTT axons are induced but
do not grow into the thalamus, whereas branching does not occur at all in
Pax6 mutants. PAX6 is produced in a domain surrounding the MTEG, at
the level of the bifurcation, as well as along the dorsal border of the
ventral thalamus. Foxb1 is expressed along the ventral border of the
dorsal thalamus and in the MB. Chimera analysis, however, indicates that
Foxb1 functions in the thalamus to promote MTT formation. The
requirements for MTT axon guidance are thus complex, as the signals controlled
by Pax6 and Foxb1 are produced by closely located but
non-overlapping regions of the thalamus.
The bHLH-PAS transcription factors SIM1 and SIM2 are closely related
paralogues, the expression profiles of which overlap in regions of the
anterior hypothalamus that will give rise to the paraventricular (PVN),
supraoptic (SON) and anterior periventricular (APV) nuclei
(Fan et al., 1996
).
Sim1 is required for the differentiation of virtually all neurons of
the PVN/SON/APV, whereas Sim2 controls the differentiation of a
subset of PVN and APV neurons (Michaud et
al., 1998
; Goshu et al.,
2004
). The interplay between Sim1 and Sim2 is
complex; mutant analysis indicates that Sim1 acts upstream of
Sim2, but can also compensate for the lack of Sim2, albeit
ineffectively. SIM1 and SIM2 belong to a group of proteins that need to
heterodimerize with members of another group of bHLH-PAS proteins for which
there are only four representatives yet characterized: ARNT
(Hoffman et al., 1991
), ARNT2
(Hirose et al., 1996
),
BMAL1/MOP3 (ARNTL - Mouse Genome Informatics)
(Hogenesch et al., 1997
;
Ikeda and Nomura, 1997
;
Takahata et al., 1998
;
Wolting and McGlade, 1998
) and
BMAL2/MOP9 (ARNTL2 - Mouse Genome Informatics)
(Hogenesch et al., 2000
;
Maemura et al., 2000
;
Okano et al., 2001
;
Ikeda et al., 2000
).
Biochemical, expression and mutant analyses indicate that ARNT2 acts as the
dimerizing partner of SIM1, and presumably SIM2, for anterior hypothalamus
development (Michaud et al.,
2000
; Hosoya et al.,
2001
; Keith et al.,
2001
).
Sim1 and Sim2 are also expressed in the prospective MB. Their function during the development of this structure has not yet been elucidated. Here, we show that MB neurons are generated, but that the MTEG and MTT do not develop, in embryos lacking both Sim1 and Sim2. Instead, MB axons aberrantly cross the midline. The same abnormalities, although less severe, are observed in embryos with reduced dosages of Sim1 or Sim2. Expression and mutant studies indicate that Sim1 and Sim2 act along compensatory pathways that do not require Arnt2 function. We propose that Sim1 and Sim2 regulate the expression of molecules involved in the polarized growth of MB axons.
| Materials and methods |
|---|
|
|
|---|
Twenty micrograms of the construct was linearized at an AscI site
located at its 3' end and electroporated into passage 13 R1 ES cells,
which were grown as previously described
(Michaud et al., 1998
). To
obtain negative and positive selection for homologous recombinants,
gancyclovir and G418 were added to the culture medium at a final concentration
of 0.55 µg/ml and 150 µg/ml, respectively. Double-resistant clones were
further analyzed by Southern blotting, using a probe containing Sim1
genomic sequences 5' of those used in the targeting vector. This probe
hybridizes to a 5.2-kb BamHI fragment of the wild-type Sim1
allele and to a 4.5-kb BamHI fragment of the Sim1 mutant
allele. Homologous recombinant ES cell clones were microinjected into C57BL/6
blastocysts to produce chimeric mice. The resulting male chimeras were
backcrossed to C57BL/6 females.
Genotyping of mice
The production and genotyping of mice and embryos carrying the
Sim1- or Sim2- alleles have been
previously described (Michaud et al.,
1998
; Goshu et al., 2003). Sim1tlz embryos and
mice were genotyped by PCR, using two sets of primers. The first set was
designed to detect the mutant allele, and amplifies a 189-bp fragment of the
neo gene. The second set was designed to detect the wild-type
Sim1 allele, and amplifies a 250-bp fragment that is deleted in the
mutant allele. The sequences of these primers are as follows: neo,
CTCGGCAGGAGCAAGGTGAGATG and GTCAAGACCGACCTGTCCGGTGC; Sim1,
CCGAGTGTGATCTCTAATTGA and TAGGCACAGACGCTTACCTT. The reaction was carried out
at 94°C for 30 seconds, 54°C for 45 seconds, and 72°C for 45
seconds, with 10% DMSO for 32 cycles, using Taq polymerase.
Genotyping of double mutants was performed by Southern blot using 5' external probes. The same probe was used for the detection of the Sim1- and Sim1tlz alleles. This probe hybridizes to a 5.2-kb BamHI fragment of the wild-type Sim1 allele, to a 3.4-kb BamHI fragment of the Sim1- allele and to a 4.5-kb fragment of the Sim1tlz allele. The Sim2 probe hybridizes to an 11-kb EcoRI fragment of the wild-type Sim2 allele and to a 12-kb EcoRI fragment of the Sim2- allele.
C112k mice, which were derived at the Oak Ridge National
Laboratory, carry a microdeletion encompassing Arnt2
(Michaud et al., 2000
). The
anterior hypothalamus defect maps to a 320-350 kb region, of which the
Arnt2 structural genes spans 140-170 kb. Wild-type and heterozygous
embryos were distinguished from homozygotes by the lack of eye pigmentation in
the latter.
Histology, in situ hybridization, ß-galactosidase staining and DiI labelling
All analyses were carried out on at least two different embryos of the same
stage and with the same genotype. For histology, embryo and newborn brains
were fixed in Carnoy's fluid, embedded in paraffin, sectioned at 6 µm and
stained with Haematoxylin. In situ hybridization was performed on paraffin
sections, as previously described (Michaud
et al., 1998
). The following probes were generous gifts:
Foxb1 (P. A. Laboski, University of Pennsylvania, Philadelphia);
Nkx2.1 (J. L. R. Rubenstein, University of California, San
Francisco); Robo1, Robo2, Slit1, Slit2 and Slit3 (M.
Tessier-Lavigne; Stanford University, Stanford); Rig-1 (A.
Chédotal, CNRS/Université de Paris, Paris); Sim1 and
Sim2 (C.-M. Fan, Carnegie Institute of Washington, Baltimore). The
Lhx1 probe was generated by RT-PCR. Whole brains stained for
ß-galactosidase activity were sectioned at 100 µm with a vibratome.
DiI crystals (Molecular Probes) were inserted into the MB of E14.5 brains
fixed with 4% paraformaldehyde. These brains were incubated in
paraformaldehyde for one week at room temperature and then sectioned at 100
µm with a vibratome.
| Results |
|---|
|
|
|---|
|
|
ARNT2, the bHLH-PAS dimerizing partner of SIM1, and presumably of SIM2, for
anterior hypothalamus development, is expressed extensively in the CNS,
including in the developing MB. We determined whether ARNT2 acts as a
dimerizing partner of SIM1 and SIM2 for MB axonal development by comparing
histologically the brains of E18.5 wild-type and C112k homozygous
embryos, which carry a microdeletion encompassing the Arnt2 locus
(Michaud et al., 2000
).
Surprisingly, we found that the MTT and the MTEG are intact in these
C112k mutants. All together, these observations raise the possibility
that another dimerizing partner interacts with SIM1 and SIM2 for MB axonal
development.
A Sim1tlacz allele allows staining of mammillary body axons
In order to further characterize the axonal projections originating from
Sim1-expressing cells, we generated a new targeted allele of
Sim1 (Sim1tlz) in which the initiation codon and
the basic and HLH domains were replaced by a Tau-lacZ fusion gene
(Fig. 4A). The targeted region
overlaps with that of the initial Sim1 mutant allele
(Sim1-), in which the initiation codon and the basic
domain were deleted. This Sim1tlz allele, predicted to be
a null, would allow us to stain the MB axons that express Sim1 and
follow their fate in the context of a decrease of Sim1 and/or
Sim2. Using a double-selection strategy, we obtained 12/140 (9%) ES
cell clones in which the Sim1 locus had undergone homologous
recombination. One of these clones was used to generate a male chimera that
was crossed to a C57Bl/6 female, resulting in germline transmission of the
targeted allele (Fig. 4B). Mice
homozygous for this allele show the same phenotypes as those described in mice
with the previously described Sim1- allele:
Sim1tlz/tlz mice die shortly after birth with a severe
defect of the PVN/SON/APV (data not shown). Also, the pattern of lacZ
staining in the brain of Sim1tlz/+ embryos and newborn
mice was comparable to the distribution of the Sim1 transcript
(compare Fig. 1G and
Fig. 5F). Finally, histological
analysis showed that the MB of newborn
Sim1tlz/tlz;Sim2-/- mice is preserved, whereas
the MTT and PMT are not detectable (Fig.
4C,D). All together, these results indicate that the
Sim1tlz allele is suitable to study the impact of
Sim1 function during MB development.
|
|
|
|
|
|
Sim1/Sim2 mutant neurons are generated and survive until E18.5
The MB appears histologically intact in Sim1/Sim2 double
mutants. In order to determine whether Sim1/Sim2 affects the
differentiation of the MB, we performed marker analysis. The Sim1
mutant allele is a null but this does not interfere with the production and
stability of its transcript, which can be used to follow the fate of
Sim1 mutant cells (Michaud et
al., 1998
). We found that the expression of the Sim1
mutant transcript in the MB of E12.5
Sim1-/-;Sim2-/- embryos is comparable to that
of controls, consistent with the fact that the production of the
TAU-ß-gal fusion protein is maintained in the MB of E14.5 mutant embryos
(Fig. 8A,B). Similarly, we
found that Lhx1 and Nkx2.1 expression is maintained in the
MB of E12.5 double mutants (Fig.
8C-F). Of note, the expression of Sim1, Lhx1 and
Nkx2.1 is also maintained in a domain dorsal to the E12.5 MB, in
which the PMT progresses. Because Sim1, Lhx1 and Nkx2.1 are
expressed in virtually all MB cells, the loss of Sim1 and
Sim2 thus does not seem to affect the generation and survival of
postmitotic neurons in the developing MB. By contrast, Foxb1
expression is dramatically decreased in the prospective MB and in the dorsal
domain of Sim1-/-;Sim2-/- embryos, but not in
those of embryos with at least one allele of Sim1/Sim2, indicating
that Sim1/Sim2 acts upstream of Foxb1
(Fig. 8G,H, Fig. 9E-H). At E18.5,
Lhx1 expression remains robust in the MB of double mutants, whereas
the expression of the Sim1 mutant transcript is decreased
(Fig. 9C,D).
The conservation of Sim1 expression in the MB of double mutants indicates that Sim1 expression does not require the presence of Sim2. Conversely, we found that Sim2 expression is maintained in the MB of E12.5 Sim1-/- embryos (data not shown). Therefore, Sim1 and Sim2 function along compensatory but not hierarchical pathways during MB development.
|
In order to determine whether other components of this molecular system are
involved in the genesis of the phenotype, we next compared the expression of
Robo1, Robo2 and Rig-1/Robo3 in the MB of E11.5 and E12.5
wild-type and Sim1/Sim2 mutant embryos. Robo1 is expressed
almost ubiquitously in the caudal hypothalamus, with higher levels found in
the prospective MB (Fig.
10I,K; data not shown). Robo2 is not expressed in the MB,
but it is expressed in more dorsal regions (not shown). The expression of
Robo1 and Robo2 in the caudal hypothalamus was unchanged in
E11.5 and E12.5 Sim1-/-;Sim2-/- embryos
(Fig. 10J,L; data not shown).
Rig-1/Robo3 is a distant homolog of Robo1 and Robo2
that appears to function in a cell autonomous fashion to inhibit SLIT
signalling by a mechanism that has not yet been resolved
(Sabatier et al., 2004
;
Marillat et al., 2004
). At
E11.5, Rig-1/Robo3 is expressed in a small patch that is contained
within the anterior aspect of the Sim1 domain, but its expression is
not found more posteriorly (Fig.
10U,W,Y,A'). In
Sim1-/-;Sim2-/-, as well as in
Sim1-/-:Sim2+/-, embryos, this anterior domain
of expression is dramatically expanded, whereas Rig-1/Robo3
expression becomes detectable in the posterior MB
(Fig. 10V,X,Z,B' and
data not shown). At E12.5, Rig-1/Robo3 is expressed in a narrow
domain that extends obliquely within the mantle layer of the anterior MB
(Fig. 10M). Its medial half
overlaps with the dorsal aspect of the MB prospective domain, as indicated by
comparison with the Sim1 expression pattern, whereas its lateral half
is located more dorsally. In Sim1-/-;Sim2-/-
and Sim1-/-;Sim2+/- embryos,
Rig-1/Robo3 is expressed ectopically in the ventrolateral aspect of
the anterior MB domain, whereas its expression dorsally from this domain is
reduced (Fig. 10N and data not
shown). At the level of the posterior MB, Rig-1/Robo3 expression is
barely detectable in control littermates
(Fig. 10O). By contrast,
Rig-1/Robo3 expression is clearly detectable in the posterior MB of
Sim1-/-;Sim2-/- and
Sim1-/-;Sim2+/- embryos, being restricted to
its lateral aspect (Fig. 10P).
In summary, Rig-1/Robo3 is expressed ectopically in the developing MB
of Sim1/Sim2 double mutants, raising the possibility that it
contributes to the axonal defects by decreasing the sensitivity of MB axons to
Slit signalling.
| Discussion |
|---|
|
|
|---|
|
Ectopic expression of Rig-1/Robo3 in the developing MB, however, does not readily explain other aspects of the axonal phenotype of Sim1/Sim2 embryos. At E11.5, mutant axons do not form clearly recognizable bundles, suggesting a decrease of MB projections, while there are not yet axons directed towards the midline. At E14.5, bundles projecting towards the midline are present in the posterior MB of mutant embryos, but there are no visible axons originating from the anterior MB of these mutants. These observations suggest a decrease of axonal growth in Sim1/Sim2 mutants that cannot be simply explained by an abnormal interaction with the midline. One possibility would be that SLIT2, produced by the ventricular layer that lies ventromedially to the MB, repulses the axons dorsally, contributing to their polarized growth.
Other explanations can be proposed to account for the decrease of axonal
growth in the double mutants. For instance, Sim1/Sim2 could function
in a cell-autonomous fashion to regulate the expression of signalling
components required for response to an attracting signal. Alternatively,
Sim1 and Sim2 would be required in the environment in which
the MB axons progress to control the expression of an attractive or a
permissive signal. Indeed, Sim1 is expressed in a domain dorsal to
the MB, which contains the PMT from the time of its appearance. Before E11.5,
Sim1 and Sim2 expression overlaps in a region of the
ventricular layer that presumably gives rise to MB and the dorsal domain. At
later stages, they are co-expressed in the lateral ventricular layer and in
the medial aspect of the mantle layer of the prospective MB, but do not
overlap in the dorsal domain. If Sim1 and Sim2 are indeed
required in the dorsal domain for the correct development of MB axons, one
might postulate that they function at an early stage in precursors of the
cells of the dorsal domain. The fact that Foxb1 expression in this
domain is downregulated in the Sim1/Sim2 double mutant, but not in
Sim1-/-;Sim2+/+ embryos, indicates that
Sim2 can influence expression in these dorsal cells. Finally,
Sim1 could function in both the axons and their surrounding tissues,
as was shown for the transcription factor Lola in the developing fly
(Crowner et al., 2002
).
Cascade of transcription factors controlling MB development
Signals produced by axial mesodermal structures, such as Shh and
Bmp7, are required to induce Nkx2.1 expression in the
neuroepithelium that will give rise to ventral regions of the developing
hypothalamus, including the MB (Kimura et
al., 1996
; Ericson et al.,
1995
; Pabst et al.,
2000
). The MB and several ventromedial nuclei of the caudal
hypothalamus do not develop in embryos with a loss of Nkx2.1,
suggesting that it is required to specify the whole ventrocaudal hypothalamic
anlage (Kimura et al., 1996
;
Marin et al., 2002
). The fact
that the MB domain of Sim1 expression is dramatically reduced in
Nkx2.1 mutant embryos as early as E11.5 indicates that
Nkx2.1 functions upstream of Sim1 for MB development
(Marin et al., 2002
).
Consistent with this conclusion are our observations that Sim1 and
Sim2 are not required for the generation and initial differentiation
of MB neurons, and that Nkx2.1 expression is not affected by the loss
of both Sim1 and Sim2. Similarly, Nkx2.2, a close
homolog of Nkx2.1, is required for Sim1 expression in the
developing ventral spinal cord, whereas Nkx2.2 expression in this
region is not affected by the loss of Sim1
(Briscoe et al., 1999
;
Briscoe et al., 2000
).
Collectively, these observations suggest the existence of homologous pathways
in these two ventral regions of the CNS, along which the NKX2 and SIM genes
would act.
We have found that Foxb1 expression is greatly reduced in the MB
of Sim1/Sim2 double mutants. This observation raises the
possibility that Foxb1 mediates the effect of a decrease of
Sim1/Sim2 on MB axonal guidance. However, Foxb1
mutant analysis does not support this possibility, as the loss of
Foxb1 function only affects MTT development
(Alvarez-Bolado et al., 2000
).
Consistently, chimera analyses suggest that Foxb1 is required in the
dorsal thalamus for MTT formation. Moreover, we did not observe a decrease of
Foxb1 expression in embryos with at least one allele of
Sim1/Sim2, despite the fact that axonal guidance abnormalities are
observed in these embryos. The loss of Foxb1, however, might suggest
that Sim1 and Sim2 are required to control aspects of MB
differentiation other than axonal growth that were not revealed by our
analysis.
Respective functions of bHLH-PAS proteins during MB development
The basic HLH and PAS domains of SIM1 and SIM2 share high identity, whereas
their carboxy-terminal domains are poorly conserved. Consistent with the low
identity of their carboxy termini, SIM1 and SIM2 display distinct
transcriptional properties in cultured cell systems. The SIM1;ARNT(2)
heterodimer transactivates reporter constructs via the ARNT carboxy terminus
(Moffett and Pelletier, 2000
;
Woods and Whitelaw, 2002
).
SIM1 has neither activation nor repression activity in this context. By
contrast, SIM2;ARNT(2) activates transcription only when the carboxy terminus
of SIM2 is deleted. The carboxy terminus of SIM2 appears to have a repressive
function, which quenches the transactivating activity of ARNT
(Moffett and Pelletier, 2000
;
Woods and Whitelaw, 2002
).
Because SIM1 and SIM2 compete for binding to ARNT(2) and to the DNA-binding
site, these different properties of SIM1 and SIM2 result in some
transcriptional antagonism, at least in vitro
(Moffett and Pelletier,
2000
).
Our study indicates, however, that Sim1 and Sim2 can
compensate for the absence of each other, the former playing a predominant
role over the latter during MB development. We did not observe a reduction of
Sim2 expression in the MB of Sim1-/- embryos, or
vice versa, suggesting that the interaction between Sim1 and
Sim2 is not hierarchical. All together, these results indicate that
Sim1 and Sim2 can play similar roles in vivo, even though
their C termini have diverged considerably. There are other lines of evidence
supporting this conclusion. Overexpression of Sim1 or Sim2
using a Wnt1 enhancer activates Shh expression in the mouse
midbrain, demonstrating that Sim1 and Sim2 can act similarly
in a given embryonic context (Epstein et
al., 2000
). Moreover, Sim1 can compensate for the absence
of Sim2, albeit ineffectively, during differentiation of the PVN. The
interplay between Sim1 and Sim2 is, however, complex in the
developing PVN, as mutant analysis indicates that they also control different
aspects of PVN neuronal differentiation and that Sim1 is required for
Sim2 expression (Goshu et al.,
2004
). Recent studies provide other examples of interaction among
bHLH-PAS proteins during development. For instance, dysfusion
downregulates trachealess expression in the developing trachea of the
fly, and NXF competes with SIM2 for binding to elements that regulate the
expression of a gene engaged in dendritic-cytoskeleton modulation at synapses
(Jiang and Crews, 2003
;
Ooe et al., 2004
). It will be
interesting to determine whether these or other bHLH-PAS proteins interact
with Sim1/Sim2 during the development of the MB.
Biochemical, expression and mutant studies indicate that ARNT2 is required
for PVN development by acting as the dimerizing partner of SIM1. It appears
likely that SIM2 also heterodimerizes with ARNT2 in the PVN, as they can
physically interact (Goshu et al.,
2004
). However, because the PVN phenotype of
Arnt2-/- mice is identical to that of
Sim1-/- mice, and is more severe than that of
Sim2-/- mice, it has not been formally shown that SIM2
controls PVN neuronal differentiation through this interaction. Surprisingly,
histological analysis suggests that MB axonal tracts can develop in the
absence of Arnt2. A homologue, Arnt, could compensate for
the absence of Arnt2, but its expression level is particularly low in
the MB of wild-type and Arnt2 mutant embryos (A.C. and J.L.M.,
unpublished). Alternatively, SIM1 and SIM2 could dimerize with a member of
another subgroup of partners, such as BMAL1 or BMAL2, raising the possibility
that the use of different partners could influence the function of SIM1/SIM2.
Such heterogeneity in the composition of the SIM1 and SIM2 complexes could
account for the discrepancy between their respective in vivo and in vitro
transcriptional activities.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Allen, G. V. and Hopkins, D. A. (1990). Topography and synaptology of mamillary body projections to the mesencephalon and pons in the rat. J. Comp. Neurol. 301,214 -231.[CrossRef][Medline]
Altman, J. and Bayer, S. A. (1978). Development of the diencephalon in the rat. I. Autoradiographic study of the time of origin and settling patterns of neurons of the hypothalamus. J. Comp. Neurol. 182,945 -971.[CrossRef][Medline]
Alvarez-Bolado, G., Zhou, X., Voss, A. K., Thomas, T. and Gruss, P. (2000). Winged helix transcription factor Foxb1 is essential for access of mammillothalamic axons to the thalamus. Development 127,1029 -1038.[Abstract]
Bagri, A., Marin, O., Plump, A. S., Mak, J., Pleasure, S. J., Rubenstein, J. L. and Tessier-Lavigne, M. (2002). Slit proteins prevent midline crossing and determine the dorsoventral position of major axonal pathways in the mammalian forebrain. Neuron 33,233 -248.[CrossRef][Medline]
Briscoe, J., Sussel, L., Serup, P., Hartigan-O'Connor, D., Jessell, T. M., Rubenstein, J. L. and Ericson, J. (1999). Homeobox gene Nkx2.2 and specification of neuronal identity by graded Sonic hedgehog signalling. Nature 398,622 -627.[CrossRef][Medline]
Briscoe, J., Pierani, A., Jessell, T. M. and Ericson, J. (2000). A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell 101,435 -445.[CrossRef][Medline]
Crowner, D., Madden, K., Goeke, S. and Giniger, E. (2002). Lola regulates midline crossing of CNS axons in Drosophila. Development 129,1317 -1325.
Cruce, J. A. (1977). An autoradiographic study of the descending connections of the mammillary nuclei of the rat. J. Comp. Neurol. 176,631 -644.[CrossRef][Medline]
Easter, S. S., Jr, Ross, L. S. and Frankfurter, A. (1993). Initial tract formation in the mouse brain. J. Neurosci. 1,285 -299.
Epstein, D. J., Martinu, L., Michaud, J. L., Losos, K. M., Fan, C. and Joyner, A. L. (2000). Members of the bHLH-PAS family regulate Shh transcription in forebrain regions of the mouse CNS. Development 127,4701 -4709.[Abstract]
Ericson, J., Muhr, J., Placzek, M., Lints, T., Jessell, T. M. and Edlund, T. (1995). Sonic hedgehog induces the differentiation of ventral forebrain neurons: a common signal for ventral patterning within the neural tube. Cell 81,747 -756.[CrossRef][Medline]
Fan, C.-M., Kuwana, E., Bulfone, A., Fletcher, C. F., Copeland, N. G., Jenkins, N. A., Crews, S., Martinez, S., Puelles, L., Rubenstine, J. et al. (1996). Expression patterns of two murine homologs of Drosophila Single-minded suggest possible roles in embryonic patterning and in the pathogenesis of Down syndrome. Mol. Cell. Neurosci. 7,1 -16.[CrossRef][Medline]
Giger, R. J. and Kolodkin, A. L. (2001). Silencing the siren: guidance cue hierarchies at the CNS midline. Cell 105,1 -4.[CrossRef][Medline]
Goshu, E., Jin, H., Lovejoy, J., Marion, J. F., Michaud, J. L.
and Fan, C. M. (2004). Sim2 contributes to neuroendocrine
hormone gene expression in the anterior hypothalamus. Mol.
Endocrinol. 18,1251
-1262.
Hayakawa, T. and Zyo, K. (1989). Retrograde double-labeling study of the mammillothalamic and the mammillotegmental projections in the rat. J. Comp. Neurol. 284, 1-11.[CrossRef][Medline]
Hirose, K., Morita, M., Ema, M., Mimura, J., Hamada, H., Fuji, H., Saijoh, Y., Gotoh, O., Sogawa, K. and Fujii-Kuriyama, Y. (1996). cDNA cloning and tissue-specific expression of a novel basic Helix-Loop-Helix/PAS factor (ARNT2) with close sequence similarity to the aryl hydrocarbon receptor nuclear translocator (ARNT). Mol. Cell. Biol. 16,1706 -1713.[Abstract]
Hoffman, E. C., Reyes, H., Chu, F. F., Sander, F., Conley, L.
H., Brooks, B. A. and Hankinson, O. (1991). Cloning of a
factor required for activity of the Ah (dioxin) receptor.
Science 252,954
-958.
Hogenesch, J. B., Chan, W. K., Jackiw, V. H., Brown, R. C., Gu,
Y.-Z. G., Pray-Grant, M., Perdew, G. H. and Bradfield, C. A.
(1997). Characterization of a subset of the
basic-Helix-Loop-Helix-PAS superfamily that interacts with components of the
dioxin signaling pathway. J. Biol. Chem.
272,8581
-8593.
Hogenesch, J. B., Gu, Y. Z., Moran, S. M., Shimomura, K., Radcliffe, L. A., Takahashi, J. S. and Bradfield, C. A. (2000). The basic helix-loop-helix-PAS protein MOP9 is a brain-specific heterodimeric partner of circadian and hypoxia factors. J. Neurosci. 20,RC83 .
Hosoya, T., Oda, Y., Takahashi, S., Morita, M., Kawauchi, S., Ema, M., Yamamoto, M. and Fujii-Kuriyama, Y. (2001). Defective development of secretory neurones in the hypothalamus of Arnt2-knockout mice. Genes Cells 6, 361-374.[Abstract]
Ikeda, M. and Nomura, M. (1997). cDNA cloning and tissue-specific expression of a novel basic helix-loop-helix/PAS protein (BMAL1) and identification of alternatively spliced variants with alternative translation initiation site usage. Biochem. Biophys. Res. Commun. 233,258 -264.[CrossRef][Medline]
Ikeda, M., Yu, W., Hirai, M., Ebisawa, T., Honma, S., Yoshimura, K., Honma, K. I. and Nomura, M. (2000). cDNA cloning of a novel bHLH-PAS transcription factor superfamily gene, BMAL2: its mRNA expression, subcellular distribution, and chromosomal localization. Biochem. Biophys. Res. Commun. 275,493 -502.[CrossRef][Medline]
Jiang, L. and Crews, S. T. (2003). The
Drosophila dysfusion basic helix-loop-helix (bHLH)-PAS gene controls tracheal
fusion and levels of the trachealess bHLH-PAS protein. Mol. Cell.
Biol. 23,5625
-5637.
Kawano, H., Horie, M., Honma, S., Kawamura, K., Takeuchi, K. and Kimura, S. (2003). Aberrant trajectory of ascending dopaminergic pathway in mice lacking Nkx2.1. Exp. Neurol. 182,103 -112.[CrossRef][Medline]
Keith, B., Adelman, D. M. and Simon, M. C.
(2001). Targeted mutation of the murine arylhydrocarbon receptor
nuclear translocator 2 (Arnt2) gene reveals partial redundancy with Arnt.
Proc. Natl. Acad. Sci. USA
98,6692
-6697.
Kimura, S., Hara, Y., Pineau, T., Fernandez-Salguero, P., Fox,
C. H., Ward, J. M. and Gonzalez, F. J. (1996). The T/ebp null
mouse: thyroid-specific enhancer-binding protein is essential for the
organogenesis of the thyroid, lung, ventral forebrain, and pituitary.
Genes Dev. 10,60
-69.
Maemura, K., de la Monte, S. M., Chin, M. T., Layne, M. D.,
Hsieh, C. M., Yet, S. F., Perrella, M. A. and Lee, M. E.
(2000). CLIF, a novel cycle-like factor, regulates the circadian
oscillation of plasminogen activator inhibitor-1 gene expression.
J. Biol. Chem. 275,36847
-36851.
Marillat, V., Sabathier, C., Failli, V., Matsunaga, E., Sotelo, C., Tessier-Lavigne, M. and Chédotal, A. (2004). The Slit receptor Rig-1/Robo3 controls midline crossing by hindbrain precerebellar neurons and axons. Neuron 43, 69-79.[CrossRef][Medline]
Marin, O., Baker, J., Puelles, L. and Rubenstein, J. L.
(2002). Patterning of the basal telencephalon and hypothalamus is
essential for guidance of cortical projections.
Development 129,761
-773.
Mastick, G. S. and Easter, S. S., Jr (1996). Initial organization of neurons and tracts in the embryonic mouse fore- and midbrain. Dev. Biol. 173, 79-94.[CrossRef][Medline]
Michaud, J. L., Rosenquist, T., May, N. R. and Fan, C.-M.
(1998). Development of neuroendocrine lineages requires the
bHLH-PAS transcription factor SIM1. Genes Dev.
12,3264
-3275.
Michaud, J. L., DeRossi, C., May, N. R., Holdener, B. C. and Fan, C.-M. (2000). ARNT2 acts as the dimerization partner of SIM1 for the development of the hypothalamus. Mech. Dev. 90,253 -261.[CrossRef][Medline]
Moffett, P. and Pelletier, J. (2000). Different transcriptional properties of mSim-1 and mSim-2. FEBS Lett. 466,80 -86.[CrossRef][Medline]
Ooe, N., Saito, K., Mikami, N., Nakatuka, I. and Kaneko, H.
(2004). Identification of a novel basic helix-loop-helix-PAS
factor, NXF, reveals a Sim2 competitive, positive regulatory role in
dendritic-cytoskeleton modulator drebrin gene expression. Mol.
Cell. Biol. 24,608
-616.
Okano, T., Sasaki, M. and Fukada, Y. (2001). Cloning of mouse BMAL2 and its daily expression profile in the suprachiasmatic nucleus: a remarkable acceleration of Bmal2 sequence divergence after Bmal gene duplication. Neurosci. Lett. 300,111 -114.[CrossRef][Medline]
Pabst, O., Herbrand, H., Takuma, N. and Arnold, H. H. (2000). NKX2 gene expression in neuroectoderm but not in mesendodermally derived structures depends on sonic hedgehog in mouse embryos. Dev. Genes Evol. 210,47 -50.[CrossRef][Medline]
Pielage, J., Steffes, G., Lau, D. C., Parente, B. A., Crews, S. T., Strauss, R. and Klambt, C. (2002). Novel behavioral and developmental defects associated with Drosophila single-minded. Dev. Biol. 249,283 -299.[CrossRef][Medline]
Sabatier, C., Plump, A. S., Ma, L., Brose, F., Lee, E. Y. H. P. and Tessier-Lavigne, M. (2004). The divergent Robo family protein Rig-1/Robo3 is a negative regulator of Slit responsiveness required for midline crossing by commissural axons. Cell 117,157 -169.[CrossRef][Medline]
Sharp, P. E., Blair, H. T. and Cho, J. (2001). The anatomical and computational basis of the rat head-direction cell signal. Trends Neurosci. 24,289 -294.[CrossRef][Medline]
Takahata, S., Sogawa, K., Kobayashi, A., Ema, M., Mimura, J., Ozaki, N. and Fujii-Kuriyama, Y. (1998). Transcriptionally active heterodimer formation of an Arnt-like PAS protein, Arnt3, with HIF-1a, HLF, and clock. Biochem. Biophys. Res. Commun. 248,789 -794.[CrossRef][Medline]
Valverde, F., Garcia, C., Lopez-Mascaraque, L. and De Carlos, J. A. (2000). Development of the mammillothalamic tract in normal and Pax-6 mutant mice. J. Comp. Neurol. 419,485 -504.[CrossRef][Medline]
Van der Kooy, D., Kuypers, H. G. J. M. and Catsman-Berrevoets, C. E. (1978). Single mammillary body cells with divergent axon collaterals. Demonstration by a simple, fluorescent retrograde double labeling technique in the rat. Brain Res. 158,189 -196.[CrossRef]
Vann, S. D. and Aggleton, J. P. (2003).
Evidence of a spatial encoding deficit in rats with lesions of the mammillary
bodies or mammillothalamic tract. J. Neurosci.
23,3506
-3514.
Vann, S. D. and Aggleton, J. P. (2004). The mammillary bodies: two memory systems in one? Nat. Rev. Neurosci. 5,35 -44.[CrossRef][Medline]
Wharton, K. A., Jr and Crews, S. T. (1993). CNS midline enhancers of the Drosophila slit and Toll genes. Mech. Dev. 40,141 -154.[CrossRef][Medline]
Wolting, C. D. and McGlade, C. J. (1998). Cloning and chromosomal localization of a new member of the bHLH/PAS transcription factor family. Mamm. Genome 9, 463-468.[CrossRef][Medline]
Woods, S. L. and Whitelaw, M. L. (2002).
Differential activities of murine single minded 1 (SIM1) and SIM2 on a hypoxic
response element. Cross-talk between basic helix-loop-helix/per- Arnt-Sim
homology transcription factors. J. Biol. Chem.
277,10236
-10243.
Related articles in Development:
This article has been cited by other articles:
![]() |
S. Woods, A. Farrall, C. Procko, and M. L. Whitelaw The bHLH/Per-Arnt-Sim transcription factor SIM2 regulates muscle transcript myomesin2 via a novel, non-canonical E-box sequence Nucleic Acids Res., June 1, 2008; 36(11): 3716 - 3727. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Xu and C.-M. Fan Allocation of Paraventricular and Supraoptic Neurons Requires Sim1 Function: A Role for a Sim1 Downstream Gene PlexinC1 Mol. Endocrinol., May 1, 2007; 21(5): 1234 - 1245. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Baskin Single-minded view of melanocortin signaling in energy homeostasis. Endocrinology, October 1, 2006; 147(10): 4539 - 4541. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||