|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 9 November 2005
doi: 10.1242/dev.02155
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Molecular Genetics and Cell Biology, The University of Chicago,
Chicago, IL 60637, USA
2 Department of Medicine, The University of Chicago, Chicago, IL 60637,
USA
3 Department of Human Genetics, The University of Chicago, Chicago, IL 60637,
USA
* Author for correspondence (e-mail: emcnally{at}uchicago.edu)
Accepted 10 October 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Myoblast, Fusion, Ferlin
| Introduction |
|---|
|
|
|---|
The genetic analysis of myogenesis in Drosophila has yielded
considerable molecular information about the proteins mediating the
attraction, adhesion and fusion of myoblasts
(Chen and Olson, 2004
).
Drosophila myogenic cells are divided into founder cells and
fusion-competent cells. Founder cells seed muscle development by attracting
and fusing with fusion-competent cells to form small myotubes. Attraction and
adhesion are mediated by the extracellular immunoglobulin domains in
Dumbfounded (Duf; also known as Kirre, Kin of Irre) and Sticks and stones
(Sns), which are expressed, respectively, on founder and fusion-competent
cells (Bour et al., 2000
;
Ruiz-Gomez et al., 2000
;
Strunkelnberg et al., 2001
).
Mutations in the gene encoding myoblast city (Mbc), a protein that mediates
cytoskeletal dynamics through Rac, produce a phenotype where fusion-competent
cells adhere to founders, but fail to fuse
(Erickson et al., 1997
;
Rushton et al., 1995
). Rolling
pebbles (Rols7; also know as Rols, or Antisocial or Ants), interacts with Mbc
(Chen and Olson, 2001
), and
mutations in Rols7 also affect fusion; some fusion-competent cells
manage to fuse with founders, but these binucleate precursors fail to grow
beyond this initial cellular fusion stage
(Menon and Chia, 2001
;
Rau et al., 2001
).
Differences exist between invertebrate and vertebrate myogenesis. Evidence
for founder cells and fusion-competent cells in mammals is lacking. Based on
sequence comparisons, the mammalian ortholog of Duf and Sns
is nephrin, a gene involved in kidney development
(Kestila et al., 1998
;
Lenkkeri et al., 1999
). Mbc,
and its vertebrate homolog DOCK180, are members of the CDM (CED-5, DOCK180,
Myoblast city) family; members of this family have been classified as novel
guanine nucleotide-exchange factors for Rho family GTPases, and they regulate
diverse cellular pathways (Lu et al.,
2005
).
Despite the apparent lack of direct homology between Drosophila
and mammalian myoblast fusion genes, some similar structural motifs are found.
Like Duf and Sns, BOC and CDO are mammalian members of the immunoglobulin
superfamily. Overexpression of either BOC or CDO enhances differentiation and
fusion in the muscle cell line C2C12. The intracellular domain of CDO is
thought to create a positive-feedback loop with MYOD and other myogenic
transcription factors (Kang et al.,
2002
). CDO and BOC interact with N- and M-cadherin in developing
muscle cells (Cifuentes-Diaz et al.,
1994
; Hahn and Covault,
1992
; Moore and Walsh,
1993
; Rose et al.,
1994
). Interestingly, a CDO deletion mutant that cannot bind
N-cadherin inhibits myoblast differentiation
(Kang et al., 2003
).
M-cadherin is expressed in myoblasts and is further induced during
differentiation (Donalies et al.,
1991
). In adult muscle, M-cadherin is expressed in satellite cells
where it may function in regeneration
(Bornemann and Schmalbruch,
1994
; Irintchev et al.,
1994
). In the presence of peptides that block the self-interaction
of M-cadherin, myoblasts do not fuse
(Zeschnigk et al., 1995
).
Surface clustering of N-cadherins by ligand- or antibody-coated beads is
sufficient to trigger fusion (Goichberg
and Geiger, 1998
). Activation of N-cadherin may be sufficient for
differentiation, but it is not necessary, as myoblasts lacking N-cadherin fuse
and differentiate normally (Charlton et
al., 1997
). These data suggest that there is functional redundancy
among the cadherins during muscle development.
It is clear that the interactions of N- and M-cadherins with CDO and BOC
play a role in differentiation, but the details of this process remain to be
elucidated. In addition, experimental evidence implicates several
transmembrane and membrane associated proteins such as ADAM12, ß1
integrin, tetraspanin CD9, VLA4, VCAM1, caveolin 3 and calpain 3 in the
myoblast fusion process (Horsley and
Pavlath, 2004
), but again the molecular mechanisms are not fully
understood.
The mechanics of membrane fusion have been studied in other cell types. At
nerve terminals, neurotransmitter release requires the regulation of synaptic
vesicle fusion to the plasma membrane
(Chapman, 2002
). This fusion
process relies on interactions among the SNARE proteins snytaxin, SNAP 25 and
synaptobrevin to tether the vesicles to the plasma membrane. Upon increased
intracellular calcium concentration, the C2A and C2B domains of synaptotagmin
anchored in the vesicle, bind calcium and interact with SNARE proteins
(Chapman et al., 1995
;
Davis et al., 1999
;
Shao et al., 1997
).
Synaptotagmin C2 domains are believed to insert into the plasma membrane
phospholipids and trigger membrane fusion
(Bai et al., 2002
;
Chapman and Davis, 1998
;
Chapman and Jahn, 1994
),
possibly by making fusion more energetically favorable
(Chapman, 2002
). The fusion of
synaptic vesicles with the plasma membrane is calcium sensitive, and
synaptotagmin has been proposed to be the calcium sensor
(Brose et al., 1992
;
Fernandez-Chacon et al.,
2001
). Non-neuronal synaptotagmins regulate calcium-sensitive
fusion of lysosomes with the plasma membrane to allow resealing after membrane
disruptions in cells such as fibroblasts
(Reddy et al., 2001
).
Dysferlin has been implicated in vertebrate muscle membrane fusion.
Dysferlin has structural and biochemical similarity to synaptotagmins, with
six C2 domains and a carboxy-terminal transmembrane domain. The amino-terminal
C2 domain, C2A, displays calcium-sensitive phospholipid binding in vitro
(Davis et al., 2002
). In
addition, muscle fibers isolated from dysferlin null mice have markedly
delayed membrane resealing even in the presence of calcium
(Bansal et al., 2003
;
Lennon et al., 2003
). This
deficiency in cellular repair may underlie the muscular dystrophy phenotype
seen in humans with dysferlin gene mutations
(Bashir et al., 1998
;
Liu et al., 1998
).
Dysferlin-mediated muscular dystrophy is associated with the sub-plasmalemmal
accumulation of vesicles (Cenacchi et al.,
2005
; Piccolo et al.,
2000
). A missense mutation in the C2A of dysferlin, V67D, is
responsible for muscular dystrophy
(Illarioshkin et al., 2000
),
and abolishes C2A calcium-induced phospholipid binding in vitro
(Davis et al., 2002
).
Myoferlin is homologous to dysferlin and is expressed highly in developing
muscle (Davis et al., 2000
).
We have now examined myoferlin expression in a cell-culture model of muscle
differentiation, finding that it is expressed at the sites of apposed
membranes undergoing fusion. We found that a mutation in myoferlin C2A
disrupts calcium-induced phospholipid binding. We generated mice lacking
myoferlin and found that myoferlin null myoblasts do not efficiently form
large myotubes. Consistent with this, myoferlin null mice do not generate
large myofibers. Finally, we studied muscle regeneration in myoferlin null
mice and found that the later stages of muscle regeneration are defective. Our
data indicate that myoferlin plays an important role in mediating myoblast
fusion to myotubes during both development and muscle regeneration after
injury.
| Materials and methods |
|---|
|
|
|---|
For immunoblot analysis, C2C12 cells were plated at equal densities on 10 cm tissue culture plates and harvested at specified timepoints. 106 cells were lysed in 1 ml of lysis buffer [25 mM Tris (pH 7.4), 300 mM NaCl, 1 mM CaCl2, 1% Triton-X 100 with Complete Mini Protease Inhibitor cocktail (Roche Molecular Biochemicals)]. Cellular debris was removed, and the protein concentration was determined using the Bio-Rad protein assay (Bio-Rad Protein Laboratories). 30 mg of protein was separated on a 4-10% acrylamide gel. Equivalently loaded gels were stained with Coomassie Blue or transferred to PVDF Immobilon-P membrane (Millipore).
Rabbit antiserum was raised to amino acids 1088-1107 of the mouse myoferlin
protein (Proteintech Group, Chicago, IL). MYOF3 was antigen purified using the
AminoLink Plus Immobilization Kit (Pierce). Purified antibody was concentrated
in a YM-10 Centricon (Millipore). Polyclonal anti-myoferlin (MYOF3; 1:1000),
monoclonal anti-dysferlin (1:1000, NCL-hamlet, Novocastra), monoclonal
anti-annexin II antibody (1:5000, BD Biosciences) and anti-dystrophin 6-10
(1:15000) (Lidov et al., 1990
)
were used in 5% milk in 1xTris-buffered saline with 0.1% Tween 20.
Secondary antibodies, goat anti-mouse and goat anti-rabbit conjugated to
horseradish peroxidase (Jackson ImmunoResearch) were used at a dilution of
1:5000. ECL-Plus chemiluminescence (Amersham-Pharmacia) and Kodak Biomax MS
film or a Molecular Dynamics Phosphorimager was used for detection.
For immunofluorescence microscopy, cells were plated at equal densities in tissue culture plates containing glass coverslips. At specified timepoints, coverslips were fixed for 10 minutes in 4% paraformaldehyde in 1xPBS, then permeablized for 10 minutes in 0.3% Triton-X100. Coverslips were blocked in 1xPBS with 5% fetal bovine serum and 0.1% Triton-X 100, then incubated in this solution with MYOF3 and NCL-hamlet at a dilution of 1:100. A monoclonal anti-embryonic myosin heavy chain (eMyHC) F1.652 antibody (Developmental Studies Hybridoma Bank, University of Iowa) was used at a dilution of 1:5 and polyclonal anti-dystrophin 6-10 at a dilution of 1:200 in PBS containing 5% FBS and 0.1% Triton-X100. Monoclonal anti-caveolin 3 (BD Transduction Laboratories) was used at a dilution of 1:200. Goat anti-mouse conjugated to FITC, goat anti-rabbit conjugated to Cy3 (Jackson ImmunoResearch), goat anti-mouse conjugated to Alexa 488 or goat anti-rabbit conjugated to Alexa 594 (Molecular Probes) antibodies were used at a dilution of 1:2000 for detection. Coverslips were mounted using Vectashield with DAPI (Vector Laboratories), and images were captured using a Zeiss Axiophot microscope and Axiovision software (Carl Zeiss), or a Leica SP2 scanning laser confocal microscope and LCS Leica Confocal Software.
Calcium-dependent phospholipid binding
Calcium-dependent phospholipid binding was carried out as described
(Davis et al., 2002
). C2A
domains were expressed as fusion proteins to glutathione S-transferase, bound
to glutathione sepharose beads (Amersham Pharmacia Biotech), and incubated
with tritiated-phosphotidyl liposomes composed of 50% phosphotidylcholine/50%
phosphotidylserine in either calcium-free or 1 mM calcium buffer.
Generation of myoferlin null mice
The 1.7 kb short arm clone was amplified with a forward primer
(BamHI/shortarm F CGGATCCCACCGAATGGCCTGACATTTCTGTA) that corresponded to the
region 282 bp after the translational start site, and a reverse primer
(KpnI/shortarm R ACGGTACCGCCATGGCTAAGGAAGCTGAGACCT) 1.7 kb downstream. This
product was cloned into the BamHI and KpnI sites of the
pPNT-loxP vector. The 9 kb clone for the long arm was amplified with a forward
primer containing a NotI site (Long Arm NotI F
AGAATGCGGCCGCGTACTGACTCCTTAAGTTGTCCCT) and a reverse primer in exon 1 (mMyo
intronAR3 CCACACTCCCTCTCGGAGTCCACTC). The resulting product was digested with
NotI and XhoI, and ligated to the pPNT vector that already
contained the short arm. The transcriptional start site was predicted by
Promoter Scan II
(http://bimas.dcrt.nih.gov/molbio/proscan),
and the transcription factor binding sites were predicted by TFSEARCH
(http://molsun1.cbrc.aist.go.jp/research/db/TFSEARCH.html).
The targeting vector was linearized with NotI and electroporated into embyronic stem cells (Incyte). Three clones out of 117 were found to contain the predicted recombined allele. ES cells were injected into blastocysts and implanted into pseudopregnant females. Animals born from ES-injected blastocysts displayed chimerism in their coat color, ranging from 40-90%. As these mice produced a high percentage of germline offspring, we bred the high chimeric males to 129SV/J mice to produce mice on a 129SV/J background. Littermate control mice were used for comparison.
Isolation and culture of primary myoblasts
Primary myoblast cultures were isolated and cultured as described
(Rando and Blau, 1994
). For
fusion assays, cells were counted after pre-plating, then plated in primary
cell growth media [Ham's F-10 with 20% fetal bovine serum, and bFGF 2.5 ng/ml
(Promega) with antibiotic-antimycotic (Invitrogen 15240-062)] at 120,000 cells
per well on ECL-treated plastic 4-well chamber slides (Lab-Tek, Nalge Nunc
International). 6 hours later the media was changed (DMEM with 2% horse serum
and PSA). 4 days after differentiation, cells were fixed for 2 minutes in
methanol on ice, rehydrated in 1xPBS and blocked in 1xPBS with 5%
fetal bovine serum and 0.1% Triton-X100. Cells were stained with monoclonal
anti-desmin DE-U-10 (Sigma) at 1:300. They were then incubated with 0.05 µM
Sytox Green nuclear stain (Molecular Probes) and goat anti-mouse Cy3 antibody.
To quantify fusion, eight fields at 10x magnification were analyzed,
using four fields from each of two separate cultures of each genotype. Using
ImageJ, desmin-stained cells were classified as singly nucleated, containing
2-3 nuclei, or containing 4 or more nuclei (n=2390 wild-type and
n=2485 myoferlin null nuclei). Statistical analysis was performed
with InStat, using an unpaired t-test.
Analysis of cardiotoxin damage
Four-month-old wild-type and myoferlin null males were anaesthetized with
isoflurane, and 100 µl of 10 µM cardiotoxin (CalBiochem) in 1xPBS
was injected into the right gastrocnemius muscle. The animals were sacrificed
by cervical dislocation at 3, 5, 7, 9, 11, 13 and 18 days after cardiotoxin
injection. Gastrocnemii muscles were harvested tendon-to-tendon, mounted in
OCT, fixed in chilled isopentane and frozen in liquid nitrogen. 10 µm
sections were prepared on a cryostat, fixed in 10% formalin and stained with
Masson's Trichrome. To quantify adipose and fibrotic infiltration, digital
images were taken of injected muscle at days 9, 11 and 13 after injection. The
blue fibrotic areas and white adipose infiltrates from four fields from the
same region of the muscle at each time point from each genotype were measured
using ImageJ. The areas infiltrated by fibrofatty replacement in wild-type and
null muscle were compared by InStat, using an unpaired t-test with
Welch correction. Sections from frozen gastrocnemii muscles were stained with
Oil Red O stain and Mayer's Hematoxylin counterstain.
Muscle mass and fiber size analysis
The quadriceps, gastrocnemius/soleus, and triceps, were dissected free from
tendon-to-tendon and weighed. Body and muscle masses were analyzed with InStat
using an unpaired t-test with Welch correction. The quadriceps
muscles were preserved in 10% formalin, bisected in the mid-belly and embedded
in paraffin. Sections from the center of the muscle were stained with Masson
Trichrome. Using ImageJ, the area of each fiber in three fields from each
animal was determined using a total of 1740 wild-type and 2240 myoferlin null
fibers. Average areas were compared using InStat and an unpaired
t-test with Welch correction. ATPase staining was performed on 10
µm frozen muscle sections from four animals of each genotype at pH 4.6 and
at pH 9.4 as described in
http://www.neuro.wustl.edu/neuromuscular/pathol/histol/atp.htm.
| Results |
|---|
|
|
|---|
|
Myoferlin null myoblasts do not fuse efficiently
To further understand the in vivo role of myoferlin, we generated myoferlin
null mice. The myoferlin (fer1L3) locus is 52 exons over 144.5 kilobases of
chromosome 19 (Fig. 3A). As
shown in Fig. 3, homologous
recombination resulted in the deletion of exon 1 containing the 5'
untranslated region, the initiation codon and the transcriptional start site.
Transcripts starting at exon 2 were detectable by RT-PCR (data not shown), but
protein correlating to these transcripts was not detected. Translation of this
mRNA would produce a protein of approximately 210 kDa lacking the C2A domain.
To verify the absence of myoferlin production from the null allele, myoblasts
were isolated from myoferlin null and littermate mice, cultured,
differentiated for five days, and assessed by confocal immunofluorescence
microscopy (Fig. 3D) and
immunoblotting (Fig. 3E).
Neither full-length nor truncated myoferlin proteins were detected. Consistent
with the loss of myoferlin and compensation by the related protein, an
increase in dysferlin protein expression was detected in cultured myotubes.
The expression of other muscle membrane-associated proteins, such as
dystrophin and annexin II, was not altered in myoferlin null myoblasts. To
further investigate the upregulation of dysferlin, quantitative immunoblotting
was used on wild-type and myoferlin null myoblast/myotube cultures at various
timepoints. Wild-type and myoferlin null cultures of confluent myoblasts and
cells that had been exposed to differentiation media for 24 hours expressed
equivalent levels of dysferlin (data not shown). After 4 days of
differentiation, dysferlin expression was 1.6-fold higher in myoferlin null
cultures than in wild type.
|
|
|
Myoferlin null mice have smaller muscles with few large fibers
The loss of myoferlin had no detrimental effect on viability, fertility or
longevity up to 12 months of age. However, myoferlin null mice were
significantly smaller than their littermate controls
(Fig. 5A). Individual muscle
groups were examined revealing that muscles from myoferlin mice were smaller
than those of littermate controls (n=7, null; n=6, wildtype)
(Fig. 5B). Myoferlin null
muscles have smaller myofibers (Fig.
5C). Mean fiber size was significantly smaller in myoferlin null
muscle than in littermate controls (Fig.
5D). The median wild-type fiber size was 2,205 µm2,
whereas the myoferlin null median was 1,711 µm2. The
distribution of fiber size showed an overrepresentation of smaller myofibers
in myoferlin null muscle (Fig.
5E, red). Larger myofibers were lacking in myoferlin null muscle.
Myofibers with an area of greater than 4,300 µm2 make up 7.4% of
wild type fibers; fibers this size are markedly reduced in myoferlin null
quadriceps muscle, making up only 0.33% of the total.
Fiber size was also analyzed in muscles from the upper limb of neonatal
mice, as myoferlin is expressed during embryogenesis
(Davis et al., 2000
) and its
absence could have a phenotypic effect earlier in development. At this age,
there was no difference in average fiber area between wild-type (n=3)
and myoferlin null (n=3) muscle (159 µm2 and 155
µm2, respectively; P=0.5). The median fiber area for
the myoferlin null muscles (131 µm2) was smaller than that of
the wild type (148 µm2), indicating that the distribution of
fiber size was shifted in myoferlin null mice at this stage of development,
although not nearly as much as in adults animals. These data support a role
for myoferlin in normal muscle growth, and, specifically, in the growth of
large myofibers that appear later during muscle maturation.
|
Myoferlin null mice fail to fully regenerate muscle after injury
Myoblast fusion also plays a vital role in healing and regenerating muscle
after injury. To determine what role myoferlin might play in this fusion
process, cardiotoxin was injected into the gastrocnemius of wild-type and
myoferlin mice (d'Albis et al.,
1989
; Davis et al.,
1993
). Cardiotoxins are polypeptides of 60-65 amino acids isolated
from cobra venom, and cause depolarization and degradation of the plasma
membrane. This degeneration activates satellite cells to proliferate and fuse
to form new myofibers (Snow,
1977
). From 1-3 days post-injection, the site of injury consists
of a mononuclear infiltrate composed of inflammatory cells and activated
myoblasts. By day 5, centrally nucleated fibers, indicative of regeneration,
are visible. New fibers continue to form and grow through fusion events, and
at 30 days, although muscle architecture has been fully restored, many
centrally placed nuclei may remain (Kherif
et al., 1999
).
The levels of myoferlin protein were examined 5 days after cardiotoxin injection. The entire gastrocnemius muscle was dissected tendon-to-tendon and homogenized. Immunoblotting showed that myoferlin was present at low levels in wild-type muscle, and that it is very strongly induced 5 days after cardiotoxin injection (Fig. 6A, lanes 1 and 3). Dysferlin was present at equal levels in both injured and control muscle of wild-type and myoferlin null mice. After injury, high levels of myoferlin are expressed in a diffuse pattern in areas of mononuclear infiltration and regeneration (data not shown).
Cardiotoxin injections were performed in myoferlin null and control gastrocnemii muscle. At day 11 after cardiotoxin injection (Fig. 6B), both wild-type and myoferlin null muscle show scattered fibers expressing embryonic myosin-positive fibers (red) consistent with regeneration. Dystrophin staining shows that myoferlin null muscle contains irregularly shaped fibers with a greater fiber size distribution than control muscle. The large dystrophin-negative cells seen in the myoferlin null images represent degenerating fibers. By comparison, at 11 days after cardiotoxin injection, the wild-type muscle exhibits fewer of these fibers and has regained a normal overall architecture similar to uninjured muscle with smoothly outlined myofibers,
Overall, myoferlin null muscle displayed a slower and more incomplete regenerative response than wild-type muscle did. Both wild-type and myoferlin null muscles showed mononuclear infiltrates 3 days after injection, and small, centrally nucleated fibers indicative of regeneration at 5 days (data not shown). 9, 11 and 13 days after cardiotoxin injection, approximately midway through the regenerative process, Masson trichrome staining showed evidence of the replacement of muscle with fibrotic connective tissue (arrow in Fig. 7A) and adipose cell infiltrates (arrowheads in Fig. 7A) in myoferlin null muscle. Oil Red O, a lipid specific dye (Fig. 7B), showed larger and more numerous fat-containing cells. Fibrofatty replacement was additionally evaluated. Myoferlin null gastrocnemius muscles had significantly more fibrous and fatty infiltration after cardiotoxin-induced damage than did wild-type muscles (Fig. 7C). These data support a role for myoferlin specifically in the growth of large myofibers during development and regeneration.
| Discussion |
|---|
|
|
|---|
|
Redundancy of ferlin proteins for fusion
The loss of myoferlin does not completely block the process of myogenesis,
but rather renders it less efficient. This could be because dysferlin, or
other uncharacterized members of the ferlin family (fer1L4 and
fer1L5), are able to partially compensate for the loss of myoferlin.
In primary myoblast cultures, dysferlin is expressed at higher levels in
myoferlin null cells than in wild-type cells, suggesting that it can at least
partially compensate for the absence of myoferlin. Dysferlin does not appear
to be upregulated in adult muscle in the absence of myoferlin. This may be due
to the fact that myoferlin is present at such low levels in healthy adult
muscle (Fig. 6A). There may be
some upregulation of dysferlin in response to damage in myoferlin null mice
(data not shown). The fact that we do not detect upregulation of dysferlin in
myoferlin null myoblasts until later in the fusion process
(Fig. 3E), when most of the
fusion events involve fusion to large myotubes, supports the hypothesis that
myoferlin is more important for mediating the fusion of myoblasts to myotubes,
rather than between myoblasts. The biochemical properties of dysferlin and
myoferlin differ, as the C2A domain of dysferlin displays a different
sensitivity, showing half-maximal phospholipid binding at 4.5 µm rather
than 1 µm calcium (Davis et al.,
2002
). This difference could also account for the impaired
myoblast fusion seen in myoferlin null cells, in that increased dysferlin
levels may be less effective at mediating membrane fusion.
|
The primary structure and biochemical properties of myoferlin and dysferlin
suggest that these ferlins may act as calcium sensors. The process for
membrane resealing and the process of myoblast fusion may both use specialized
vesicles, and the ferlins may regulate the calcium sensitivity of vesicular
fusion. The membrane-associated nature of ferlin proteins, along with the
additional C2 domains, may serve to act as a scaffold for other proteins that
are important for fusion processes; these proteins remain to be discovered.
Dysferlin has been shown to interact with annexins A1 and A2 in a manner that
changes with membrane disruption (Lennon
et al., 2003
). We have not detected a similar interaction for
myoferlin with annexins (data not shown), but this may highlight molecular
differences between sarcolemmal resealing and myoblast fusion. The coordinate
expression of myoferlin and dysferlin in myoblasts and myotubes, respectively,
supports an overlapping yet specialized role for these proteins in membrane
fusion events.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Antonio, J. and Gonyea, W. J. (1993). Skeletal
muscle fiber hyperplasia. Med. Sci. Sports Exerc.
25,1333
-1345.[Medline]
Bai, J., Wang, P. and Chapman, E. R. (2002).
C2A activates a cryptic Ca(2+)-triggered membrane penetration activity within
the C2B domain of synaptotagmin I. Proc. Natl. Acad. Sci.
USA 99,1665
-1670.
Bansal, D., Miyake, K., Vogel, S. S., Groh, S., Chen, C. C.,
Williamson, R., McNeil, P. L. and Campbell, K. P. (2003).
Defective membrane repair in dysferlin-deficient muscular dystrophy.
Nature 423,168
-172.[CrossRef][Medline]
Bashir, R., Britton, S., Strachan, T., Keers, S., Vafiadaki, E.,
Lako, M., Richard, I., Marchand, S., Bourg, N., Argov, Z. et al.
(1998). A gene related to Caenorhabditis elegans spermatogenesis
factor fer-1 is mutated in limb-girdle muscular dystrophy type 2B.
Nat. Genet. 20,37
-42.[CrossRef][Medline]
Bornemann, A. and Schmalbruch, H. (1994).
Immunocytochemistry of M-cadherin in mature and regenerating rat muscle.
Anat. Rec. 239,119
-125.[CrossRef][Medline]
Bour, B. A., Chakravarti, M., West, J. M. and Abmayr, S. M.
(2000). Drosophila SNS, a member of the immunoglobulin
superfamily that is essential for myoblast fusion. Genes
Dev. 14,1498
-1511.
Brose, N., Petrenko, A. G., Sudhof, T. C. and Jahn, R.
(1992). Synaptotagmin: a calcium sensor on the synaptic vesicle
surface. Science 256,1021
-1025.
Cenacchi, G., Fanin, M., De Giorgi, L. B. and Angelini, C.
(2005). Ultrastructural changes in dysferlinopathy support
defective membrane repair mechanism. J. Clin. Pathol.
58,190
-195.
Chapman, E. R. (2002). Synaptotagmin: a Ca(2+)
sensor that triggers exocytosis? Nat. Rev. Mol. Cell.
Biol. 3,498
-508.[CrossRef][Medline]
Chapman, E. R. and Jahn, R. (1994).
Calcium-dependent interaction of the cytoplasmic region of synaptotagmin with
membranes. Autonomous function of a single C2-homologous domain. J.
Biol. Chem. 269,5735
-5741.
Chapman, E. R. and Davis, A. F. (1998). Direct
interaction of a Ca2+-binding loop of synaptotagmin with lipid bilayers.
J. Biol. Chem. 273,13995
-14001.
Chapman, E. R., Hanson, P. I., An, S. and Jahn, R.
(1995). Ca2+ regulates the interaction between synaptotagmin and
syntaxin 1. J. Biol. Chem.
270,23667
-23671.
Charlton, C. A., Mohler, W. A., Radice, G. L., Hynes, R. O. and
Blau, H. M. (1997). Fusion competence of myoblasts rendered
genetically null for N-cadherin in culture. J. Cell
Biol. 138,331
-336.
Chen, E. H. and Olson, E. N. (2001).
Antisocial, an intracellular adaptor protein, is required for myoblast fusion
in Drosophila. Dev. Cell
1, 705-715.[CrossRef][Medline]
Chen, E. H. and Olson, E. N. (2004). Towards a
molecular pathway for myoblast fusion in Drosophila. Trends Cell
Biol. 14,452
-460.[CrossRef][Medline]
Cifuentes-Diaz, C., Nicolet, M., Goudou, D., Rieger, F. and
Mege, R. M. (1994). N-cadherin expression in developing,
adult and denervated chicken neuromuscular system: accumulations at both the
neuromuscular junction and the node of Ranvier.
Development 120,1
-11.[Abstract]
d'Albis, A., Couteaux, R., Janmot, C. and Mira, J. C.
(1989). Myosin isoform transitions in regeneration of fast and
slow muscles during postnatal development of the rat. Dev.
Biol. 135,320
-325.[CrossRef][Medline]
Davis, A. F., Bai, J., Fasshauer, D., Wolowick, M. J., Lewis, J.
L. and Chapman, E. R. (1999). Kinetics of synaptotagmin
responses to Ca2+ and assembly with the core SNARE complex onto membranes.
Neuron 24,363
-376.[CrossRef][Medline]
Davis, D. B., Delmonte, A. J., Ly, C. T. and McNally, E. M.
(2000). Myoferlin, a candidate gene and potential modifier of
muscular dystrophy. Hum. Mol. Genet.
9, 217-226.
Davis, D. B., Doherty, K. R., Delmonte, A. J. and McNally, E.
M. (2002). Calcium-sensitive phospholipid binding properties
of normal and mutant ferlin C2 domains. J. Biol. Chem.
277,22883
-22888.
Davis, H. L., Demeneix, B. A., Quantin, B., Coulombe, J. and
Whalen, R. G. (1993). Plasmid DNA is superior to viral
vectors for direct gene transfer into adult mouse skeletal muscle.
Hum. Gene Ther. 4,733
-740.[Medline]
Doberstein, S. K., Fetter, R. D., Mehta, A. Y. and Goodman, C.
S. (1997). Genetic analysis of myoblast fusion: blown fuse is
required for progression beyond the prefusion complex. J. Cell
Biol. 136,1249
-1261.
Doherty, K. R. and McNally, E. M. (2003).
Repairing the tears: dysferlin in muscle membrane repair. Trends
Mol. Med. 9,327
-330.[CrossRef][Medline]
Donalies, M., Cramer, M., Ringwald, M. and Starzinski-Powitz,
A. (1991). Expression of M-cadherin, a member of the cadherin
multigene family, correlates with differentiation of skeletal muscle cells.
Proc. Natl. Acad. Sci. USA
88,8024
-8028.
Erickson, M. R., Galletta, B. J. and Abmayr, S. M.
(1997). Drosophila myoblast city encodes a conserved protein that
is essential for myoblast fusion, dorsal closure, and cytoskeletal
organization. J. Cell Biol.
138,589
-603.
Fernandez-Chacon, R., Konigstorfer, A., Gerber, S. H., Garcia,
J., Matos, M. F., Stevens, C. F., Brose, N., Rizo, J., Rosenmund, C. and
Sudhof, T. C. (2001). Synaptotagmin I functions as a calcium
regulator of release probability. Nature
410, 41-49.[CrossRef][Medline]
Goichberg, P. and Geiger, B. (1998). Direct
involvement of N-cadherin-mediated signaling in muscle differentiation.
Mol. Biol. Cell 9,3119
-3131.
Hahn, C. G. and Covault, J. (1992). Neural
regulation of N-cadherin gene expression in developing and adult skeletal
muscle. J. Neurosci. 12,4677
-4687.[Abstract]
Ho, M., Post, C. M., Donahue, L. R., Lidov, H. G., Bronson, R.
T., Goolsby, H., Watkins, S. C., Cox, G. A. and Brown, R. H., Jr
(2004). Disruption of muscle membrane and phenotype divergence in
two novel mouse models of dysferlin deficiency. Hum. Mol.
Genet. 13,1999
-2010.
Horsley, V. and Pavlath, G. K. (2004). Forming
a multinucleated cell: molecules that regulate myoblast fusion.
Cells Tissues Organs
176, 67-78.[CrossRef][Medline]
Illarioshkin, S. N., Ivanova-Smolenskaya, I. A., Greenberg, C.
R., Nylen, E., Sukhorukov, V. S., Poleshchuk, V. V., Markova, E. D. and
Wrogemann, K. (2000). Identical dysferlin mutation in
limb-girdle muscular dystrophy type 2B and distal myopathy.
Neurology 55,1931
-1933.
Irintchev, A., Zeschnigk, M., Starzinski-Powitz, A. and Wernig,
A. (1994). Expression pattern of M-cadherin in normal,
denervated, and regenerating mouse muscles. Dev. Dyn.
199,326
-337.[Medline]
Kalderon, N. and Gilula, N. B. (1979). Membrane
events involved in myoblast fusion. J. Cell Biol.
81,411
-425.
Kang, J. S., Mulieri, P. J., Hu, Y., Taliana, L. and Krauss, R.
S. (2002). BOC, an Ig superfamily member, associates with CDO
to positively regulate myogenic differentiation. EMBO
J. 21,114
-124.[CrossRef][Medline]
Kang, J. S., Feinleib, J. L., Knox, S., Ketteringham, M. A. and
Krauss, R. S. (2003). Promyogenic members of the Ig and
cadherin families associate to positively regulate differentiation.
Proc. Natl. Acad. Sci. USA
100,3989
-3994.
Kelley, G. (1996). Mechanical overload and
skeletal muscle fiber hyperplasia: a meta-analysis. J. Appl.
Physiol. 81,1584
-1588.
Kestila, M., Lenkkeri, U., Mannikko, M., Lamerdin, J., McCready,
P., Putaala, H., Ruotsalainen, V., Morita, T., Nissinen, M., Herva, R. et
al. (1998). Positionally cloned gene for a novel glomerular
protein-nephrin-is mutated in congenital nephrotic syndrome. Mol.
Cell 1,575
-582.[CrossRef][Medline]
Kherif, S., Lafuma, C., Dehaupas, M., Lachkar, S., Fournier, J.
G., Verdiere-Sahuque, M., Fardeau, M. and Alameddine, H. S.
(1999). Expression of matrix metalloproteinases 2 and 9 in
regenerating skeletal muscle: a study in experimentally injured and mdx
muscles. Dev. Biol. 205,158
-170.[CrossRef][Medline]
Lenkkeri, U., Mannikko, M., McCready, P., Lamerdin, J.,
Gribouval, O., Niaudet, P. M., Antignac, C. K., Kashtan, C. E., Homberg, C.,
Olsen, A. et al. (1999). Structure of the gene for congenital
nephrotic syndrome of the finnish type (NPHS1) and characterization of
mutations. Am. J. Hum. Genet.
64, 51-61.[CrossRef][Medline]
Lennon, N. J., Kho, A., Bacskai, B. J., Perlmutter, S. L.,
Hyman, B. T. and Brown, R. H., Jr (2003). Dysferlin interacts
with annexins A1 and A2 and mediates sarcolemmal wound-healing. J.
Biol. Chem. 278,50466
-50473.
Lidov, H. G., Byers, T. J., Watkins, S. C. and Kunkel, L. M.
(1990). Localization of dystrophin to postsynaptic regions of
central nervous system cortical neurons. Nature
348,725
-728.[CrossRef][Medline]
Liu, J., Aoki, M., Illa, I., Wu, C., Fardeau, M., Angelini, C.,
Serrano, C., Urtizberea, J. A., Hentati, F., Hamida, M. B. et al.
(1998). Dysferlin, a novel skeletal muscle gene, is mutated in
Miyoshi myopathy and limb girdle muscular dystrophy. Nat.
Genet. 20,31
-36.[CrossRef][Medline]
Lu, M., Kinchen, J. M., Rossman, K. L., Grimsley, C., Hall, M.,
Sondek, J., Hengartner, M. O., Yajnik, V. and Ravichandran, K. S.
(2005). A Steric-inhibition model for regulation of nucleotide
exchange via the Dock180 family of GEFs. Curr. Biol.
15,371
-377.[CrossRef][Medline]
Mauro, A. (1961). Satellite cell of skeletal
muscle fibers. J. Biophys. Biochem. Cytol.
9, 493-495.
Menon, S. D. and Chia, W. (2001). Drosophila
rolling pebbles: a multidomain protein required for myoblast fusion that
recruits D-Titin in response to the myoblast attractant Dumbfounded.
Dev. Cell 1,691
-703.[CrossRef][Medline]
Moore, R. and Walsh, F. S. (1993). The cell
adhesion molecule M-cadherin is specifically expressed in developing and
regenerating, but not denervated skeletal muscle.
Development 117,1409
-1420.[Abstract]
Ontell, M., Hughes, D. and Bourke, D. (1988).
Morphometric analysis of the developing mouse soleus muscle. Am. J.
Anat. 181,279
-288.[CrossRef][Medline]
Pena, J., Jimena, I., Luque, E. and Vaamonde, R.
(1995). New fiber formation in rat soleus muscle following
administration of denervated muscle extract. J. Neurol.
Sci. 128,14
-21.[CrossRef][Medline]
Piccolo, F., Moore, S. A., Ford, G. C. and Campbell, K. P.
(2000). Intracellular accumulation and reduced sarcolemmal
expression of dysferlin in limb-girdle muscular dystrophies. Ann.
Neurol. 48,902
-912.[CrossRef][Medline]
Przybylski, R. J., Szigeti, V., Davidheiser, S. and Kirby, A.
C. (1994). Calcium regulation of skeletal myogenesis. II.
Extracellular and cell surface effects. Cell Calcium
15,132
-142.[CrossRef][Medline]
Rando, T. A. and Blau, H. M. (1994). Primary
mouse myoblast purification, characterization, and transplantation for
cell-mediated gene therapy. J. Cell Biol.
125,1275
-1287.
Rau, A., Buttgereit, D., Holz, A., Fetter, R., Doberstein, S.
K., Paululat, A., Staudt, N., Skeath, J., Michelson, A. M. and Renkawitz-Pohl,
R. (2001). rolling pebbles (rols) is required in Drosophila
muscle precursors for recruitment of myoblasts for fusion.
Development 128,5061
-5073.
Reddy, A., Caler, E. V. and Andrews, N. W.
(2001). Plasma membrane repair is mediated by Ca(2+)-regulated
exocytosis of lysosomes. Cell
106,157
-169.[CrossRef][Medline]
Rose, O., Rohwedel, J., Reinhardt, S., Bachmann, M., Cramer, M.,
Rotter, M., Wobus, A. and Starzinski-Powitz, A. (1994).
Expression of M-cadherin protein in myogenic cells during prenatal mouse
development and differentiation of embryonic stem cells in culture.
Dev. Dyn. 201,245
-259.[Medline]
Ruiz-Gomez, M., Coutts, N., Price, A., Taylor, M. V. and Bate,
M. (2000). Drosophila dumbfounded: a myoblast attractant
essential for fusion. Cell
102,189
-198.[CrossRef][Medline]
Rushton, E., Drysdale, R., Abmayr, S. M., Michelson, A. M. and
Bate, M. (1995). Mutations in a novel gene, myoblast city,
provide evidence in support of the founder cell hypothesis for Drosophila
muscle development. Development
121,1979
-1988.[Abstract]
Schroter, R. H., Lier, S., Holz, A., Bogdan, S., Klambt, C.,
Beck, L. and Renkawitz-Pohl, R. (2004). kette and blown fuse
interact genetically during the second fusion step of myogenesis in
Drosophila. Development
131,4501
-4509.
Shao, X., Li, C., Fernandez, I., Zhang, X., Sudhof, T. C. and
Rizo, J. (1997). Synaptotagmin-syntaxin interaction: the C2
domain as a Ca2+-dependent electrostatic switch.
Neuron 18,133
-142.[CrossRef][Medline]
Snow, M. H. (1977). Myogenic cell formation in
regenerating rat skeletal muscle injured by mincing. II. An autoradiographic
study. Anat. Rec. 188,201
-217.[CrossRef][Medline]
Strunkelnberg, M., Bonengel, B., Moda, L. M., Hertenstein, A.,
de Couet, H. G., Ramos, R. G. and Fischbach, K. F. (2001).
rst and its paralogue kirre act redundantly during embryonic muscle
development in Drosophila. Development
128,4229
-4239.
Yaffe, D. and Saxel, O. (1977). Serial
passaging and differentiation of myogenic cells isolated from dystrophic mouse
muscle. Nature 270,725
-727.[CrossRef][Medline]
Zeschnigk, M., Kozian, D., Kuch, C., Schmoll, M. and
Starzinski-Powitz, A. (1995). Involvement of M-cadherin in
terminal differentiation of skeletal muscle cells. J. Cell
Sci. 108,2973
-2981.[Abstract]
This article has been cited by other articles:
![]() |
S. J. Nowak, P. C. Nahirney, A.-K. Hadjantonakis, and M. K. Baylies Nap1-mediated actin remodeling is essential for mammalian myoblast fusion J. Cell Sci., September 15, 2009; 122(18): 3282 - 3293. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Robinson, W. E. Ackerman IV, N. J. Behrendt, and D. D. Vandre While Dysferlin and Myoferlin Are Coexpressed in the Human Placenta, Only Dysferlin Expression Is Responsive to Trophoblast Fusion in Model Systems Biol Reprod, July 1, 2009; 81(1): 33 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. N. Bernatchez, A. Sharma, P. Kodaman, and W. C. Sessa Myoferlin is critical for endocytosis in endothelial cells Am J Physiol Cell Physiol, January 1, 2009; 297(3): C484 - C492. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cipta and H. H. Patel Molecular bandages: inside-out, outside-in repair of cellular membranes. Focus on "Myoferlin is critical for endocytosis in endothelial cells" Am J Physiol Cell Physiol, January 1, 2009; 297(3): C481 - C483. [Full Text] [PDF] |
||||
![]() |
K. R. Doherty, A. R. Demonbreun, G. Q. Wallace, A. Cave, A. D. Posey, K. Heretis, P. Pytel, and E. M. McNally The Endocytic Recycling Protein EHD2 Interacts with Myoferlin to Regulate Myoblast Fusion J. Biol. Chem., July 18, 2008; 283(29): 20252 - 20260. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. V. Pajcini, J. H. Pomerantz, O. Alkan, R. Doyonnas, and H. M. Blau Myoblasts and macrophages share molecular components that contribute to cell-cell fusion J. Cell Biol., March 5, 2008; 180(5): 1005 - 1019. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yan, D. A. Rachubinski, S. Joshi, R. A. Rachubinski, and S. Subramani Dysferlin Domain-containing Proteins, Pex30p and Pex31p, Localized to Two Compartments, Control the Number and Size of Oleate-induced Peroxisomes in Pichia pastoris Mol. Biol. Cell, March 1, 2008; 19(3): 885 - 898. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Adams, F. Haddad, P. W. Bodell, P. D. Tran, and K. M. Baldwin Combined isometric, concentric, and eccentric resistance exercise prevents unloading-induced muscle atrophy in rats J Appl Physiol, November 1, 2007; 103(5): 1644 - 1654. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. N. Bernatchez, L. Acevedo, C. Fernandez-Hernando, T. Murata, C. Chalouni, J. Kim, H. Erdjument-Bromage, V. Shah, J.-P. Gratton, E. M. McNally, et al. Myoferlin Regulates Vascular Endothelial Growth Factor Receptor-2 Stability and Function J. Biol. Chem., October 19, 2007; 282(42): 30745 - 30753. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Moore, C. A. Parkin, Y. Bidet, and P. W. Ingham A role for the Myoblast city homologues Dock1 and Dock5 and the adaptor proteins Crk and Crk-like in zebrafish myoblast fusion Development, September 1, 2007; 134(17): 3145 - 3153. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Klinge, S. Laval, S. Keers, F. Haldane, V. Straub, R. Barresi, and K. Bushby From T-tubule to sarcolemma: damage-induced dysferlin translocation in early myogenesis FASEB J, June 1, 2007; 21(8): 1768 - 1776. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Jansen and G. K. Pavlath Mannose receptor regulates myoblast motility and muscle growth J. Cell Biol., July 31, 2006; 174(3): 403 - 413. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||