|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 January 2005
doi: 10.1242/dev.01593
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Medical Research Council, National Institute for Medical Research, The
Ridgeway, Mill Hill, London, NW7 1AA, UK
2 Stowers Institute for Medical Research, 1000 East 50th Street, Kansas City, MI
64110, USA
3 Institut de Génétique et de Biologie Moléculaire et
Cellulaire (IGBMC), CNRS/INSERM/ULP/Collège de France, BP10142, 67404
ILLKIRCH Cedex, France
4 Department of Pathology and Laboratory Medicine, Kansas University Medical
Center, Kansas City, KS 66160, USA
5 Department of Anatomy and Cell Biology, Kansas University Medical Center,
Kansas City, KS 66160, USA
Author for correspondence (e-mail:
agould{at}nimr.mrc.ac.uk)
Accepted 23 November 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Segmentation, Rhombomere, Hindbrain, Hox, Retinoic acid receptor
| Introduction |
|---|
|
|
|---|
Many different genetic inputs are known to regulate the multigene complexes
in which Hox genes reside. These are integrated in a stage-dependent manner by
multiple enhancer elements, some of which act on only one Hox gene, while
others are shared between several members of a complex (reviewed by
Trainor et al., 2000
;
Kmita and Duboule, 2003
).
Within the presegmented hindbrain, initiation of Hox gene expression requires
a key intercellular signal derived from vitamin A, called retinoic acid (RA)
(reviewed by Marshall et al.,
1996
; Eichele,
1997
; Gavalas,
2002
). This small lipophilic molecule is synthesized by retinal
dehydrogenase 2 (Raldh2/Aldh1a2) within the developing paraxial mesoderm and
induces Hox expression in the adjacent neural tube
(Niederreither et al., 1997
;
Berggren et al., 1999
;
Swindell et al., 1999
). The
timing of Raldh2 expression correlates well with the stages at which
grafted chick somites are known to possess neural Hox-inducing activity
(Grapin-Botton et al., 1995
;
Itasaki et al., 1996
).
Moreover, loss of Raldh2 function produces AP patterning
abnormalities and disrupted Hox expression patterns similar to those resulting
from retinoid deficiency (Maden et al.,
1996
; Gale et al.,
1999
; Niederreither et al.,
2000
; White et al.,
2000
; Begemann et al.,
2001
). RA concentration is not only spatiotemporally regulated at
the synthetic level but also via its local inactivation by cytochrome P450
monooxygenases (McCaffery and Drager,
2000
; Abu-Abed et al.,
2001
; Niederreither et al.,
2002
). The importance of regulating RA availability during
hindbrain development is underscored by several studies showing that the
addition of exogenous RA produces dramatic rostral shifts in Hox expression
boundaries (Morriss-Kay et al.,
1991
; Conlon and Rossant,
1992
; Dekker et al.,
1992
; Marshall et al.,
1992
). These and more recent studies
(Gould et al., 1998
;
Dupé and Lumsden, 2001
;
Nolte et al., 2003
) are
consistent with the hypothesis that Hox genes are differentially sensitive to
the level and/or timing of RA signalling and that this contributes to
specifying their diverse expression borders within the hindbrain.
Specific enhancers containing retinoic acid response elements (RAREs)
mediate RA induction of Hox gene transcription within the hindbrain. The in
vivo characterization of these short DNA sequences from two genes of Hox
paralogue group 1 (Hoxa1 and Hoxb1) and two from group 4
(Hoxb4 and Hoxd4) has revealed that they function by binding
retinoic acid receptors (RARs) and retinoid X receptors (RXRs), probably as
RAR/RXR heterodimers (Marshall et al.,
1994
; Frasch et al.,
1995
; Morrison et al.,
1996
; Dupé et al.,
1997
; Kastner et al.,
1997
; Gould et al.,
1998
; Mascrez et al.,
1998
; Studer et al.,
1998
; Zhang et al.,
2000
). Both classes of receptors interact directly with RA: the
three RARs (
, ß and
) are capable of binding all-trans and
9-cis forms, whereas the
, ß and
RXRs bind 9-cis RA only
(reviewed by Chambon, 1996
).
Owing to extensive functional redundancy, the crucial role of RARs in
hindbrain segmentation and also in Hox regulation only becomes apparent when
two are removed simultaneously or when the activities of all three RARs are
attenuated using a chemical antagonist
(Dupé et al., 1999
;
Dupé and Lumsden, 2001
;
Wendling et al., 2001
). Thus,
although RARß is unique amongst RARs in having an anterior border of
expression at the r6/r7 junction, its inactivation has no apparent effect on
caudal hindbrain segmentation or Hox transcription
(Ruberte et al., 1991
;
Ghyselinck et al., 1997
;
Dupé et al., 1999
;
Folberg et al., 1999
).
However, double mutants for Rarb and Rara do display a
severely enlarged r5, loss of the r6/r7 boundary and absence of hindbrain
Hoxd4 expression (Dupé et
al., 1999
). On the basis of these and other observations, it has
been proposed that the normal role of Rarb is to mediate a caudal
increase in RA signalling, which is necessary for Hoxd4 activation
(Ghyselinck et al., 1997
;
Wendling et al., 2001
).
Although much progress has been made in understanding how hindbrain patterns of Hox expression are generated, less is known about the regulatory mechanisms that govern the neural expression of their key upstream regulators, the RARs. We focus on Rarb, and use a combination of genetic, transgenic and biochemical analyses in the mouse and chick to dissect the mechanism generating its segmental expression border. These studies reveal that Rarb uses a two-step transcriptional regulatory mechanism: induction by a mesodermal RA signal and maintenance by Hoxb4 and Hoxd4. They also show that Rarb is a direct transcriptional target of Hoxb4, thus providing evidence that transcriptional regulation between the Hox and RAR gene families is bidirectional. We describe how these results imply the presence of a self-organizing feedback circuit that corrects for small initial differences in the anterior expression borders of multiple Hox and RAR genes, bringing them into register at a rhombomere boundary.
| Materials and methods |
|---|
|
|
|---|
Hoxb4: CGGCTGGAAGCCGCTCTCTCGC (+ allele), CTGCATCCATGACACAGGCAAACC (- allele) and GAGCCCTATGTAAATCCTGGTGTTG (common).
Hoxd4: CCTACACCAGACAGCAAGTCCTAG (+ allele), CCCGTGATATTGCTGAAGAGCTTGG (- allele) and CTCGGGCAGGAAGGTAACCTAGTC (common)
lacZ: GCGACTTCCAGTTCAACATC (LZ3) and GATGAGTTTGGACAAACCAC (ZT4).
All-trans RA (25 mg/ml stock in dimethylsulphoxide) was diluted
1:10 in sesame oil and 200 µl per pregnant dam administered by gavage at
E9.25 (
25 mg/kg bodyweight) as previously described
(Gould et al., 1998
).
X-gal and antibody staining and in situ hybridization
Staining with X-gal or a monoclonal antibody directed against murine Hoxb4
was as described (Gould et al.,
1997
). We have deposited anti-Hoxb4 at the Developmental Studies
Hybridoma Bank
(http://www.uiowa.edu/~dshbwww/).
Rabbit anti-Krox20 antibody (Cambridge Bioscience) was used at a dilution of
1:100. For analysis by confocal microscopy, specimens were stained with Alexa
Fluor 488 secondary antibodies (Molecular Probes), flatmounted in Vectashield
with or without propidium iodide (Vector Laboratories), and images prepared
using projections of several sections. In situ hybridization was performed as
described (Wilkinson, 1992
)
except that, for Rarb, hybridization was at 70°C. Antisense
riboprobes incorporating either digoxigenin or fluorescein were made using
Rarb (Zelent et al.,
1991
), Krox20
(Wilkinson et al., 1989a
) or
Hoxb4 (Graham et al.,
1988
) templates.
Sequence analysis
RARß intron sizes were determined by BLAST-like Alignment Tool (BLAT)
(Kent, 2002
) comparisons of
known RARß mRNAs (Zelent et al.,
1991
; Mendelsohn et al.,
1994
) with the UCSC Genome Browser Databases
(Karolchik et al., 2003
) (see
http://genome.ucsc.edu)
using the following genome builds: human May 2004 (hg17), chimp Nov 2003 (pan
Tro1), mouse May 2004 (mm5), rat Jun 2003 (rn3) and dog Jul 2004 (canFam1).
The distance between the HP site of the distal enhancer and the ATG of the
first coding exon (E2) of the RARß1 mRNA isoform is at least 241 kb in
chimp and 215 kb in rat, although gaps in these genome builds indicate that
these distances may be larger. There are no gaps in human (240 kb interval)
and only a small number of gaps in dog (
232 kb interval) and mouse
(
284 kb interval). The position of the P1 promoter is not yet clear in
rat, chimp and dog, as 5' untranslated exon(s) of RARß1 have yet to
be identified. For human, however, Toulouse et al.
(Toulouse et al., 1996
) have
reported the 5' end of the RARß1 isoform (Genbank Accession Number
U49855), which our BLAT comparisons show to be encoded by six non-coding
exons, three of which lie upstream of the HP site. Multispecies HP site
comparisons used MULTIZ (Blanchette et al.,
2004
).
Electrophoretic mobility shift assays (EMSA)
GST-Hoxb4 and Hoxb4 antibody production and EMSA were performed as
previously described (Gould et al.,
1997
), except that Cy5 oligonucleotide labelling was used and gels
were imaged on a Typhoon 8700 (Amersham Biosciences). Oligonucleotide
sequences were as described (Gould et al.,
1997
) or as follows (Hox/Pbx sites in bold, mutated residues
underlined): HS1+HS2 WT (Hoxb4),
GAGAATTATACAGAAAACCATTAATCACTT; HP WT (Rarb),
TTTGAGGAGCAGGGTGATAAATAATGGGGCTTTTCCA; and HP MUT (Rarb),
TTTGAGGAGCAGGGTGGGCCCGCCGGGGGCTTTTCCA.
Chick electroporation
The distal enhancer (a 2.3 kb NheI fragment) of Rarb was
isolated by PCR from mouse genomic DNA using primers AGAATGTGTGTGCTGACTCTGC
and AAGCAGTCTTACCAGGAGGG, cloned into pGEM-T (Promega) and then transferred as
a SacII-NotI fragment into the BGZ40 vector
(Maconochie et al., 1997
). The
HP site was mutated using the Quick Change kit (Stratagene) with the following
61 mer: CCTTGTGAAGTCCCCTTTGAGGAGCAGGGTGGGGCTTTTCCAATTGTTATTTGCCAAAAGG. For the
3x HP construct, annealed oligonucleotides
GGCCGCAAGCTTGAGCAGGGTGATAAATAATGGGGCTTGAGCAGGGTGATAAATAATGGGGCTTGAGCAGGGTGATAAATAATGGGGCTTCCGC
and
GGAAGCCCCATTATTTATCACCCTGCTCAAGCCCCATTATTTATCACCCTGCTCAAGCCCCATTATTTATCACCCTGCTCAAGCTTGC
were cloned into NotI-SacII cut pBSKS and then transferred
into BGZ40. All constructs were confirmed by DNA sequencing.
Hamburger-Hamilton stages 9-11 chick embryos were electroporated as
described (Itasaki et al.,
1999
). BGZ40 derivatives (1 µg/1 µl) were co-electroporated
with Fast Green and CMV-GFP. Only embryos showing strong GFP expression
throughout the neural tube, were analyzed further.
| Results |
|---|
|
|
|---|
|
We then addressed the in vivo mechanisms regulating Rarb and
Hoxb4. For several Hox genes, it is known that hindbrain expression
is initiated prior to rhombomere formation by an inductive process involving
RA synthesis by the paraxial mesoderm (see Introduction). In the case of
Hoxd4, RA induction in the hindbrain is abolished in embryos lacking
the activity of the RA-synthetic enzyme Raldh2
(Niederreither et al., 2000
).
We first focused on Hoxb4 and examined the role of Raldh2 during its
induction phase at E8.5 (Gould et al.,
1998
). At this early stage, the reduction in the amount of tissue
in the postotic territory of the hindbrain that occurs progressively from
E8.25-E9.5 in Raldh2-/- embryos is minimal
(Niederreither et al., 2000
).
We find that both the mRNA and protein products of Hoxb4 are only
very weakly expressed in the presegmented hindbrain of
Raldh2-/- embryos (Fig.
2A-D). Thus, like Hoxd4, the early hindbrain expression
domain of Hoxb4 requires RA and, as the major site of Raldh2
expression at E8.5 is the paraxial mesoderm, this requirement probably
signifies a mesodermal-to-neural induction. At spinal levels, however, a
different mechanism of Hoxb4 regulation must operate as neural
expression remains unaffected at the mRNA level, paralleling previous
Hoxd4 findings (Niederreither et
al., 2000
). As we observe that Hoxb4 expression in
Raldh2 mutants is dramatically reduced at the protein level in spinal
regions (compare Fig. 2A,B with
Fig. 2C,D) it is likely that,
as yet uncharacterized, post-transcriptional Hox-regulatory mechanisms are
involved (Brend et al., 2003
;
Dasen et al., 2003
).
|
Rarb is regulated by Hoxb4 and Hoxd4 at late stages
We next focused attention on later stages of development, to identify the
mechanism regulating the expression border of Rarb in the segmented
hindbrain. During the E8.5-E9.5 time window, the anterior expression border of
Rarb regresses by approximately one rhombomere in length, matching
the sharp segmental border of Hoxb4 expression at r6/r7. Given this
late border congruency, we tested the possibilities that either Hoxb4
regulates Rarb or that Rarb regulates Hoxb4.
Functional overlap among RAR genes results in the overall pattern of
Hoxb4 mRNA appearing normal in Rarb single mutants
(Folberg et al., 1999
). In
addition, confocal analysis with single-cell resolution in Rarb
single mutants provided no evidence for a non-redundant requirement for this
particular RAR in specifying the sharpness or positioning of the r6/r7 border
of Hoxb4 protein expression at E10 (data not shown). However, a previous study
showed that blocking the activities of all types of RAR abolished hindbrain
Hoxb4 induction (Gould et al.,
1998
). Together with the analysis of mutants lacking multiple RARs
(see Introduction), we conclude that, although the set of RARs participating
in Hoxb4 induction does include Rarb, other types of RAR can
substitute for its role.
To test for the reciprocal regulatory relationship between Rarb
and Hoxb4, we generated double homozygous mice lacking the functions
of Hoxb4 and Hoxd4. The activities of both of these
paralogues were removed, as previous studies indicated that they play
redundant roles in activating a Hox-responsive enhancer in r7
(Gould et al., 1997
). In
Hoxb4-/-; Hoxd4-/- embryos, caudal
hindbrain tissue aberrantly expresses several region-specific molecular
markers (data not shown). We find that the early phase of neural Rarb
expression is normal in double homozygous embryos at E8.5 and E9.0
(Fig. 3A and data not shown).
Moreover, no alteration in the late phase of Rarb expression was
observed at E10.5, when only two out of four alleles were mutated
(Hoxb4+/+; Hoxd4-/- embryos;
Fig. 3B). However, in double
homozygous embryos, older than E9.0, the position of the Rarb border
is significantly disrupted. Thus, by E9.5, the Rarb expression border
in Hoxb4-/-; Hoxd4-/- embryos lies
approximately one rhombomere in length caudal to the normal r6/r7 location
(Fig. 3C,D). In addition, at
this stage, the border is less sharply defined than in wild-type embryos. One
day later, at E10.5, the caudal shift and diffuseness of the border in
Hoxb4-/-; Hoxd4-/- embryos have become
more dramatic, leaving most of the hindbrain void of detectable Rarb
expression (Fig. 3E,F). These
results demonstrate that Rarb expression in the hindbrain is
initially independent of group four Hox genes but subsequently becomes
positively regulated by overlapping inputs from Hoxb4 and
Hoxd4. Late Hox-dependent regulation comes into play at the time of
morphological segmentation, serving to sharpen and fix the regressing
expression border of Rarb at the r6/r7 boundary.
|
The proximal enhancer mimics early Rarb expression and responds rapidly and transiently to RA
To dissect the Hox-RAR feedback mechanism and, in particular, the way in
which RA and Hox inputs are temporally coordinated by the Rarb gene,
we used two transgenic regulatory DNA constructs from this locus
(Mendelsohn et al., 1991
;
Mendelsohn et al., 1994
): (1)
Rarb2lacZ, expressing ß-galactosidase under the control of a 3.8
kb genomic fragment (termed the proximal enhancer) that includes the proximal
(P2) promoter; and (2) Rarb1lacZ, containing a 2.3 kb NheI
genomic fragment (termed the distal enhancer) that encompasses the distal (P1)
promoter. At E9.5, Rarb1lacZ and Rarb2lacZ drive neural
expression with anterior borders at r6/r7 and r7/r8, respectively
(Mendelsohn et al., 1994
).
However, in the context of the endogenous Rarb gene, transcripts from
both the P1 and the P2 promoters are known to be expressed with a r6/r7
boundary at E10.5 (Mollard et al.,
2000
). This indicates that, when in their normal chromosomal
environment, the proximal and distal enhancers may not be selective for one
promoter. More specifically, it suggests that the distal enhancer may be
capable of regulating both P1 and P2.
We analysed early proximal enhancer activity, using E8-E8.5 embryos
transgenic for Rarb2lacZ. We find that Rarb2lacZ is robustly
expressed within the neural plate of two-somite stage embryos
(Fig. 4A). By the seven-somite
stage, reporter activity is observed extending up to the level of the otic
sulcus, corresponding to the future r5/r6 boundary
(Fig. 4B). This pattern
recapitulates the anterior limit of Rarb mRNA at E8.5 that we
describe here (compare Fig. 1D
with Fig. 4B). One day later,
at E9.5, proximal enhancer activity has regressed dramatically and is now
missing from most of the caudal hindbrain but remains present in the spinal
cord (Fig. 4C)
(Mendelsohn et al., 1994
).
This late loss of expression throughout the caudal hindbrain is more extensive
than the regression observed for the endogenous gene, indicating that the
proximal enhancer accounts for the early but not the late phases of
Rarb expression. To investigate the factors regulating the proximal
enhancer, we initially examined Rarb2lacZ expression in
Hoxb4-/-; Hoxd4-/- embryos. However,
removing the functions of both Hox paralogues does not affect the neural
Rarb2lacZ expression pattern at E9.5 or E10.5
(Fig. 4C,D; data not
shown).
|
The distal enhancer mimics late segmental Rarb expression and is activated by Hoxb4 and Hoxd4
We analysed the activity pattern of the second transgenic construct,
Rarb1lacZ, containing the distal enhancer. In contrast to
Rarb2lacZ, no reporter expression is seen at E8.5
(Fig. 5A). Approximately 24
hours later, activity within the neural tube is initiated with a well-defined
limit at r6/r7 that is stably maintained until E10.5 and even later stages
(Fig. 5B and data not shown).
Therefore, the distal enhancer recapitulates the late but not the early phase
of expression of the endogenous Rarb gene. To assess whether the
distal enhancer is regulated in a similar way to its proximal counterpart,
Rarb1lacZ embryos were treated with a single dose of exogenous RA. As
no expression was detected anterior to r6/r7 after 4 or 24 hours, we conclude
that the distal enhancer differs from the proximal enhancer in that it does
not mediate a direct ectopic response to RA
(Fig. 5C,D). As the r6/r7
expression border of distal enhancer activity at E9.5-E10.5 is shared with
Hoxb4 and Hoxd4, we next examined Rarb1lacZ
expression in embryos carrying various combinations of knockout alleles of
these two group 4 Hox paralogues. Although loss of one of the four wild-type
alleles has no reproducible effect on expression at E10.5, removing two or
three copies does lead to significantly reduced neural tube expression
(Fig. 5E-G). Removing all four
alleles, in Hoxb4-/-; Hoxd4-/-
embryos, leads to the complete abolition of all distal enhancer activity with
100% penetrance (Fig. 5H).
Therefore the r6/r7 border and all other aspects of distal enhancer activity
display an absolute requirement for Hoxb4 and Hoxd4
function.
|
|
To test whether the conserved HP site is functionally relevant in vivo, its activity was monitored by chick in ovo electroporation. We first showed that the 2.3 kb murine distal enhancer can direct lacZ reporter expression within the developing chick hindbrain up to the r6/r7 boundary (17/18 embryos, Fig. 6E), the same pattern as observed in transgenic mouse embryos. When present in three copies, a 26 bp oligonucleotide spanning the murine HP site (3xHP) is sufficient to direct a weak r6/r7 pattern (8/12 embryos, Fig. 6F), indicating that rhombomere-specificity information resides within the HP site and/or its immediate flanking sequences. Moreover, within the context of the 2.3 kb distal enhancer, the HP site is required for activity as mutating it to a sequence unable to bind Hoxb4 (HP MUT) results in the complete abolition of lacZ expression (0/36 embryos, Fig. 6G). Taken together, the sequence analysis, EMSA and chick electroporation experiments provide strong evidence that Hoxb4 regulates the distal enhancer of Rarb in a direct manner via the HP site.
| Discussion |
|---|
|
|
|---|
Raldh2-dependent RA synthesis induces Rarb and Hoxb4 within the hindbrain
Raldh2-dependent RA signalling from the paraxial mesoderm induces
a diffuse and unstable border of Rarb mRNA within the presegmented
hindbrain. In the absence of Raldh2, no Rarb expression is detected
within the neuroepithelium, indicating that initial induction by RA is
probably transduced by RAR
and/or RAR
and not by Rarb
itself. This also implies that early hindbrain expression of at least one of
these RARs is independent of induction by RA. The presegmental phase of
Rarb expression is regulated by the proximal RARE-containing
enhancer, which responds rapidly and transiently to RA with similar kinetics
to a RARE that is a known direct target of RARs (cf.
Gould et al., 1998
). Together
with evidence that the proximal RARE directly binds RARs and mediates an
RA-response in cultured cells (de
Thé et al., 1990
;
Hoffmann et al., 1990
;
Sucov et al., 1990
), our
findings strongly suggest that the induction of neural Rarb
expression by RARs is direct. Hence, following initial neural induction via
RAR
and/or RAR
, RARß would then be available to augment its
own expression via direct binding to the RARE of the proximal enhancer.
Group 4 Hox genes regulate the segmental expression of Rarb in a direct manner
Rarb is a well-known regulator of Hox genes, including those of
paralogue group 4 but, surprisingly, our study indicates that reciprocal
regulation also occurs. Together, our mouse knockout and transgenic analyses
reveal that Rarb lies downstream of Hoxb4 and
Hoxd4. Moreover, the combined EMSA and chick electroporation
approaches indicate that regulation is mediated in a direct manner via Hoxb4
binding to the HP site of the Rarb distal enhancer. Given the similar
homeodomain sequences and DNA-binding specificities of Hoxb4 and Hoxd4, it is
likely that the observed genetic requirement for Hoxd4 is also
mediated in the same direct manner.
Rarb and Hoxb4 use similar two-step regulatory mechanisms
We have shown that the mechanisms regulating both the early and late phases
of Rarb expression within the hindbrain operate at the
transcriptional level. At E8.5, the proximal retinoid-dependent enhancer
recapitulates the initial diffuse and transient Rarb expression up to
the presumptive r5/r6 border. Likewise, at E9.5-E10.5, the distal
Hox-dependent enhancer maintains the stable segmental border at r6/r7 via a
direct input from Hoxb4 and probably Hoxd4. Thus, the
summation of the activities of the proximal and distal enhancers accounts for
the establishment and maintenance of hindbrain expression of the endogenous
Rarb gene.
The mechanism regulating Rarb in the presegmented hindbrain is
similar to that of Hoxb4. Both genes are transcriptionally induced by
a Raldh2-dependent RA source and both possess RARE-containing enhancers [for
Hoxb4, this is termed the early neural enhancer (ENE)
(Gould et al., 1998
)] that
direct neural expression with borders that recede after E8.5. These caudal
shifts presumably reflect regression of the inducing ability of the paraxial
mesoderm with increasing embryonic age
(Itasaki et al., 1996
;
Gould et al., 1998
). Although
there are strong parallels between the RARE enhancers of Rarb and
Hoxb4, there are also some differences. For example, proximal
enhancer activity begins at around the two-somite stage, whereas ENE activity
begins at the nine-somite stage. In addition, at E8.5, the anterior border of
the Rarb proximal enhancer is at presumptive r5/6 but that of the
Hoxb4 ENE is at presumptive r6/r7. Although the DNA element
responsible for these expression differences is undefined, it may be relevant
that the DR5 class of RARE, present in both enhancers, differs at 3/12
nucleotide positions.
The regulatory parallels between Rarb and Hoxb4 also
extend to the later phase of segmental expression. Like Rarb, Hoxb4
uses a two-step regulatory strategy of establishment and maintenance within
the hindbrain, involving two enhancer elements that are mechanistically and
physically separable (Gould et al.,
1998
). For Hoxb4, the late hindbrain element is termed
the late neural enhancer (LNE) (Gould et
al., 1997
). Both the Rarb distal enhancer and the
Hoxb4 LNE drive expression with a sharp r6/r7 border and respond to
stabilizing inputs from group 4 Hox genes. In both cases, these late Hox
inputs serve to halt the caudal regression of diffuse borders that were
established by RARE-containing enhancers. However, when the functions of
Hoxb4 and Hoxd4 are completely removed, Hoxb4 LNE
activity is lost only from r7 (Gould et
al., 1997
), whereas Rarb distal enhancer activity is
abolished within the entire neural tube. This suggests that, although group
4-6 Hox paralogues activate the Hoxb4 LNE
(Gould et al., 1997
), only
some or all of the group 4 Hox genes may be capable of activating the
Rarb distal enhancer.
A feedback circuit aligning the segmental expression borders of Rarb, Hoxb4 and Hoxd4
We have argued that the early induction and late maintenance mechanisms
regulating hindbrain Rarb transcription are strikingly similar to
those of Hoxb4. As both genes are transcriptionally regulated by RARs
and Hox proteins, numerous types of feedback loop are possible. Importantly,
the Hox-to-Rarb direction of regulation that we have uncovered in
this study identifies a new molecular link completing a circuit between the
two different gene families. Combining our results with those of several
previous studies (see Introduction), it can be seen that bidirectional Hox-RAR
regulation forms the core of a complex genetic circuit involving direct and
indirect interactions between Rarb, Hoxb4 and Hoxd4
(Fig. 7). It is likely that the
feedback circuit we describe also includes a fourth gene, as Hoxb3
shares the LNE with Hoxb4 and thus upregulates its expression
posterior to r6/r7 at late stages (Gould
et al., 1997
). One important requirement for the indirect type of
feedback loop to occur is that the RAR
Hox and Hox
RAR interactions
must overlap in developmental time rather than being strictly sequential. More
specifically, RAR
Hox regulation must persist long enough after the
initial stage of RA-dependent Hox induction at E8.5 to coincide with the onset
of the reciprocal Hox
RAR regulation, first detectable at around E9.5.
Consistent with this temporal overlap, the isolated ENE of Hoxb4 does
remain active within the neural tube at E9.5
(Gould et al., 1998
).
|
RA induction is not sufficient to specify the late segmental expression
border of Rarb or Hoxb4. Furthermore, although both genes
interpret the same Raldh2-dependent signal, small differences in the
responsiveness of their RARE-containing enhancers produce early expression
borders that are out of register. Despite this, and some variations in the
Hox-responsive late enhancers of Hoxb4 and Rarb, when all of
the components are appropriately combined within the in vivo genetic circuit,
they function to generate congruent expression at the r6/r7 boundary. In
addition to these self-organizing properties, the Hox-RAR circuit is also
genetically robust such that overlapping inputs from both gene families ensure
that loss of any one gene has a minimal effect on the expression of the
others. For example, we found that the r6/r7 expression border of
Hoxb4 is unaffected by loss of all Rarb activity and,
conversely, that the Rarb mRNA pattern remains normal when all
Hoxd4 activity is removed. Finally, the identification of the above
border-matching circuit was initiated by the observation that group 4 Hox
genes share a segmental expression pattern with Rarb. As
Rara is reported to be expressed up to the r3/r4 boundary
(Ruberte et al., 1991
),
coincident with the expression limits of Hoxa1 and Hoxb1, a
related Hox-RAR feedback circuit may also operate at this segment border.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Abu-Abed, S., Dollé, P., Metzger, D., Beckett, B.,
Chambon, P. and Petkovich, M. (2001). The retinoic
acid-metabolizing enzyme, CYP26A1, is essential for normal hindbrain
patterning, vertebral identity, and development of posterior structures.
Genes Dev. 15,226
-240.
Begemann, G., Schilling, T. F., Rauch, G. J., Geisler, R. and
Ingham, P. W. (2001). The zebrafish neckless mutation reveals
a requirement for raldh2 in mesodermal signals that pattern the hindbrain.
Development 128,3081
-3094.
Berggren, K., McCaffery, P., Drager, U. and Forehand, C. J.
(1999). Differential distribution of retinoic acid synthesis in
the chicken embryo as determined by immunolocalization of the retinoic acid
synthetic enzyme, RALDH-2. Dev. Biol.
210,288
-304.[CrossRef][Medline]
Birgbauer, E. and Fraser, S. E. (1994).
Violation of cell lineage restriction compartments in the chick hindbrain.
Development 120,1347
-1356.[Abstract]
Blanchette, M., Kent, W. J., Riemer, C., Elnitski, L., Smit, A.
F., Roskin, K. M., Baertsch, R., Rosenbloom, K., Clawson, H., Green, E. D. et
al. (2004). Aligning multiple genomic sequences with the
threaded blockset aligner. Genome Res.
14,708
-715.
Brend, T., Gilthorpe, J., Summerbell, D. and Rigby, P. W.
(2003). Multiple levels of transcriptional and
post-transcriptional regulation are required to define the domain of Hoxb4
expression. Development
130,2717
-2728.
Capecchi, M. R. (1997). Hox genes and mammalian
development. Cold Spring Harb. Symp. Quant. Biol.
62,273
-281.
Chambon, P. (1996). A decade of molecular
biology of retinoic acid receptors. FASEB J.
10,940
-954.[Abstract]
Conlon, R. A. and Rossant, J. (1992). Exogenous
retinoic acid rapidly induces anterior ectopic expression of murine Hox-2
genes in vivo. Development
116,357
-368.[Medline]
Dasen, J. S., Liu, J. P. and Jessell, T. M.
(2003). Motor neuron columnar fate imposed by sequential phases
of Hox-c activity. Nature
425,926
-933.[CrossRef][Medline]
de Thé, H., Vivanco-Ruiz, M. M., Tiollais, P.,
Stunnenberg, H. and Dejean, A. (1990). Identification of a
retinoic acid responsive element in the retinoic acid receptor beta gene.
Nature 343,177
-180.[CrossRef][Medline]
Dekker, E. J., Pannese, M., Houtzager, E., Timmermans, A.,
Boncinelli, E. and Durston, A. (1992). Xenopus Hox-2
genes are expressed sequentially after the onset of gastrulation and are
differentially inducible by retinoic acid. Development
Suppl. 195-202.
Dupé, V. and Lumsden, A. (2001).
Hindbrain patterning involves graded responses to retinoic acid signalling.
Development 128,2199
-2208.
Dupé, V., Davenne, M., Brocard, J., Dollé, P.,
Mark, M., Dierich, A., Chambon, P. and Rijli, F. (1997).
In vivo functional analysis of the Hoxa1 3' retinoid
response element (3' RARE). Development
124,399
-410.[Abstract]
Dupé, V., Ghyselinck, N. B., Wendling, O., Chambon, P.
and Mark, M. (1999). Key roles of retinoic acid receptors
alpha and beta in the patterning of the caudal hindbrain, pharyngeal arches
and otocyst in the mouse. Development
126,5051
-5059.[Abstract]
Eichele, G. (1997). Retinoids: from hindbrain
patterning to Parkinson disease. Trends Genet.
13,343
-345.[CrossRef][Medline]
Folberg, A., Nagy Kovacs, E., Luo, J., Giguère, V. and
Featherstone, M. S. (1999). RARbeta mediates the response of
Hoxd4 and Hoxb4 to exogenous retinoic acid. Dev. Dyn.
215,96
-107.[CrossRef][Medline]
Frasch, M., Chen, X. and Lufkin, T. (1995).
Evolutionary-conserved enhancers direct region-specific expression of the
murine Hoxa-1 and Hoxa-2 loci in both mice and
Drosophila. Development
121,957
-974.[Abstract]
Fraser, S., Keynes, R. and Lumsden, A. (1990).
Segmentation in the chick embryo hindbrain is defined by cell lineage
restrictions. Nature
344,431
-435.[CrossRef][Medline]
Gale, E., Zile, M. and Maden, M. (1999).
Hindbrain respecification in the retinoid-deficient quail. Mech.
Dev. 89,43
-54.[CrossRef][Medline]
Gavalas, A. (2002). ArRAnging the hindbrain.
Trends Neurosci. 25,61
-64.[CrossRef][Medline]
Ghyselinck, N. B., Dupé, V., Dierich, A., Messaddeq, N.,
Garnier, J. M., Rochette-Egly, C., Chambon, P. and Mark, M.
(1997). Role of the retinoic acid receptor beta (RARbeta) during
mouse development. Int. J. Dev. Biol.
41,425
-447.[Medline]
Gould, A., Morrison, A., Sproat, G., White, R. and Krumlauf,
R. (1997). Positive cross-regulation and enhancer sharing:
two mechanisms for specifying overlapping Hox expression patterns.
Genes Dev. 11,900
-913.
Gould, A., Itasaki, N. and Krumlauf, R. (1998).
Initiation of rhombomeric Hoxb4 expression requires induction by somites and a
retinoid pathway. Neuron
21, 39-51.[CrossRef][Medline]
Graham, A., Papalopulu, N., Lorimer, J., McVey, J., Tuddenham,
E. and Krumlauf, R. (1988). Characterization of a murine
homeo box gene, Hox 2.6, related to the Drosophila deformed
gene. Genes Dev. 2,1424
-1438.
Grapin-Botton, A., Bonnin, M.-A., Ariza-McNaughton, L.,
Krumlauf, R. and LeDouarin, N. M. (1995). Plasticity of
transposed rhombomeres: Hox gene induction is correlated with phenotypic
modifications. Development
121,2707
-2721.[Abstract]
Hoffmann, B., Lehmann, J. M., Zhang, X. K., Hermann, T.,
Husmann, M., Graupner, G. and Pfahl, M. (1990). A retinoic
acid receptor-specific element controls the retinoic acid receptor-beta
promoter. Mol. Endocrinol.
4,1727
-1736.
Hunt, P., Gulisano, M., Cook, M., Sham, M., Faiella, A.,
Wilkinson, D., Boncinelli, E. and Krumlauf, R. (1991). A
distinct Hox code for the branchial region of the head.
Nature 353,861
-864.[CrossRef][Medline]
Itasaki, N., Sharpe, J., Morrison, A. and Krumlauf, R.
(1996). Reprogramming Hox expression in the vertebrate
hindbrain: influence of paraxial mesoderm and rhombomere transposition.
Neuron 16,487
-500.[CrossRef][Medline]
Itasaki, N., Bel-Vialar, S. and Krumlauf, R.
(1999). "Shocking" developments in chick embryology:
electroporation and in ovo gene expression. Nat. Cell
Biol. 1,E203
-E207.[CrossRef][Medline]
Karolchik, D., Baertsch, R., Diekhans, M., Furey, T. S.,
Hinrichs, A., Lu, Y. T., Roskin, K. M., Schwartz, M., Sugnet, C. W., Thomas,
D. J. et al. (2003). The UCSC Genome Browser Database.
Nucleic Acids Res. 31,51
-54.
Kastner, P., Mark, M., Ghyselinck, N., Krezel, W., Dupe, V.,
Grondona, J. M. and Chambon, P. (1997). Genetic evidence that
the retinoid signal is transduced by heterodimeric RXR/RAR functional units
during mouse development. Development
124,313
-326.[Abstract]
Kent, W. J. (2002). BLAT - the BLAST-like
alignment tool. Genome Res.
12,656
-664.
Kmita, M. and Duboule, D. (2003). Organizing
axes in time and space; 25 years of colinear tinkering.
Science 301,331
-333.
Lumsden, A. and Krumlauf, R. (1996). Patterning
the vertebrate neuraxis. Science
274,1109
-1115.
Maconochie, M., Nonchev, S., Studer, M., Chan, S.-K.,
Pöpperl, H., Sham, M.-H., Mann, R. and Krumlauf, R.
(1997). Cross-regulation in the mouse HoxB complex: the
expression of Hoxb2 in rhombomere 4 is regulated by Hoxb1.
Genes Dev. 11,1885
-1896.
Maden, M., Gale, E., Kostetskii, I. and Zile, M.
(1996). Vitamin A deficient quail embryos have half a hindbrain
and other neural defects. Curr. Biol.
6, 417-426.[CrossRef][Medline]
Marshall, H., Nonchev, S., Sham, M. H., Muchamore, I., Lumsden,
A. and Krumlauf, R. (1992). Retinoic acid alters hindbrain
Hox code and induces transformation of rhombomeres 2/3 into a 4/5 identity.
Nature 360,737
-741.[CrossRef][Medline]
Marshall, H., Studer, M., Pöpperl, H., Aparicio, S.,
Kuroiwa, A., Brenner, S. and Krumlauf, R. (1994). A conserved
retinoic acid response element required for early expression of the homeobox
gene Hoxb-1. Nature
370,567
-571.[CrossRef][Medline]
Marshall, H., Morrison, A., Studer, M., Pöpperl, H. and
Krumlauf, R. (1996). Retinoids and Hox genes.
FASEB J. 10,969
-978.[Abstract]
Mascrez, B., Mark, M., Dierich, A., Ghyselinck, N. B., Kastner,
P. and Chambon, P. (1998). The RXRalpha ligand-dependent
activation function 2 (AF-2) is important for mouse development.
Development 125,4691
-4707.[Abstract]
McCaffery, P. and Drager, U. C. (2000).
Regulation of retinoic acid signaling in the embryonic nervous system: a
master differentiation factor. Cytokine Growth Factor
Rev. 11,233
-249.[CrossRef][Medline]
McGinnis, W. and Krumlauf, R. (1992). Homeobox
genes and axial patterning. Cell
68,283
-302.[CrossRef][Medline]
Mendelsohn, C., Ruberte, E., LeMeur, M., Morriss-Kay, G. and
Chambon, P. (1991). Developmental analysis of the retinoic
acid-inducible RAR-beta 2 promoter in transgenic animals.
Development 113,723
-734.[Abstract]
Mendelsohn, C., Larkin, S., Mark, M., LeMeur, M., Clifford, J.,
Zelent, A. and Chambon, P. (1994). RAR beta isoforms:
distinct transcriptional control by retinoic acid and specific spatial
patterns of promoter activity during mouse embryonic development.
Mech. Dev. 45,227
-241.[CrossRef][Medline]
Mollard, R., Viville, S., Ward, S. J., Decimo, D., Chambon, P.
and Dollé, P. (2000). Tissue-specific expression of
retinoic acid receptor isoform transcripts in the mouse embryo.
Mech. Dev. 94,223
-232.[CrossRef][Medline]
Morrison, A., Moroni, M. C., Ariza-McNaughton, L., Krumlauf, R.
and Mavilio, F. (1996). In vitro and transgenic analysis of a
human HOXD4 retinoid-responsive enhancer. Development
122,1895
-1907.[Abstract]
Morriss-Kay, G. M., Murphy, P., Hill, R. E. and Davidson, D.
R. (1991). Effects of retinoic acid excess on expression of
Hox-2.9 and Krox-20 and on morphological segmentation in the hindbrain of
mouse embryos. EMBO J.
10,2985
-2995.[Medline]
Niederreither, K., McCaffery, P., Drager, U. C., Chambon, P. and
Dollé, P. (1997). Restricted expression and retinoic
acid-induced downregulation of the retinaldehyde dehydrogenase type 2
(RALDH-2) gene during mouse development. Mech. Dev.
62, 67-78.[CrossRef][Medline]
Niederreither, K., Subbarayan, V., Dollé, P. and Chambon,
P. (1999). Embryonic retinoic acid synthesis is essential for
early mouse post-implantation development. Nat. Genet.
21,444
-448.[CrossRef][Medline]
Niederreither, K., Vermot, J., Schuhbaur, B., Chambon, P. and
Dollé, P. (2000). Retinoic acid synthesis and
hindbrain patterning in the mouse embryo. Development
127, 75-85.[Abstract]
Niederreither, K., Abu-Abed, S., Schuhbaur, B., Petkovich, M.,
Chambon, P. and Dollé, P. (2002). Genetic evidence
that oxidative derivatives of retinoic acid are not involved in retinoid
signaling during mouse development. Nat. Genet.
31, 84-88.[Medline]
Nolte, C., Amores, A., Nagy Kovacs, E., Postlethwait, J. and
Featherstone, M. (2003). The role of a retinoic acid response
element in establishing the anterior neural expression border of Hoxd4
transgenes. Mech. Dev.
120,325
-335.[CrossRef][Medline]
Ruberte, E., Dollé, P., Chambon, P. and Morriss-Kay,
G. (1991). Retinoic acid receptors and cellular retinoid
binding proteins II. Their differential pattern of transcription during early
morphogenesis in mouse embryos. Development
111, 45-60.[Abstract]
Studer, M., Gavalas, A., Marshall, H., Ariza-McNaughton, L.,
Rijli, F. M., Chambon, P. and Krumlauf, R. (1998). Genetic
interactions between Hoxa1 and Hoxb1 reveal new roles in regulation of early
hindbrain patterning. Development
125,1025
-1036.[Abstract]
Sucov, H. M., Murakami, K. K. and Evans, R. M.
(1990). Characterization of an autoregulated response element in
the mouse retinoic acid receptor type beta gene. Proc. Natl. Acad.
Sci. USA 87,5392
-5396.
Swindell, E. C., Thaller, C., Sockanathan, S., Petkovich, M.,
Jessell, T. M. and Eichele, G. (1999). Complementary domains
of retinoic acid production and degradation in the early chick embryo.
Dev. Biol. 216,282
-296.[CrossRef][Medline]
Toulouse, A., Morin, J., Pelletier, M. and Bradley, W. E.
(1996). Structure of the human retinoic acid receptor beta 1
gene. Biochim. Biophys. Acta
1309, 1-4.[Medline]
Trainor, P. A., Manzanares, M. and Krumlauf, R.
(2000). Genetic interactions during hindbrain segmentation in the
mouse embryo. Results Probl. Cell Differ.
30, 51-89.[Medline]
Vaage, S. (1969). The segmentation of the
primitive neural tube in chick embryos (Gallus domesticus).
Adv. Anat. Embryol. Cell Biol.
41, 1-88.
Wendling, O., Ghyselinck, N. B., Chambon, P. and Mark, M.
(2001). Roles of retinoic acid receptors in early embryonic
morphogenesis and hindbrain patterning. Development
128,2031
-2038.
White, J. C., Highland, M., Kaiser, M. and Clagett-Dame, M.
(2000). Vitamin A deficiency results in the dose-dependent
acquisition of anterior character and shortening of the caudal hindbrain of
the rat embryo. Dev. Biol.
220,263
-284.[CrossRef][Medline]
Wilkinson, D. G. (1992). Whole mount in situ
hybridisation of vertebrate embryos. In In Situ Hybridisation, A
Practical Approach (ed. D. G. Wilkinson), pp.75
-83. Oxford, UK: Oxford University
Press.
Wilkinson, D. G., Bhatt, S., Chavrier, P., Bravo, R. and
Charnay, P. (1989a). Segment-specific expression of a
zinc-finger gene in the developing nervous system of the mouse.
Nature 337,461
-464.[CrossRef][Medline]
Wilkinson, D. G., Bhatt, S., Cook, M., Boncinelli, E. and
Krumlauf, R. (1989b). Segmental expression of Hox-2
homeobox-containing genes in the developing mouse hindbrain.
Nature 341,405
-409.[CrossRef][Medline]
Zelent, A., Mendelsohn, C., Kastner, P., Krust, A., Garnier, J.
M., Ruffenach, F., Leroy, P. and Chambon, P. (1991).
Differentially expressed isoforms of the mouse retinoic acid receptor beta
generated by usage of two promoters and alternative splicing. EMBO
J. 10,71
-81.[Medline]
Zhang, F., Nagy Kovacs, E. and Featherstone, M. S.
(2000). Murine hoxd4 expression in the CNS requires multiple
elements including a retinoic acid response element. Mech.
Dev. 96,79
-89.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
E. Preger-Ben Noon, H. Barak, N. Guttmann-Raviv, and R. Reshef Interplay between activin and Hox genes determines the formation of the kidney morphogenetic field Development, June 15, 2009; 136(12): 1995 - 2004. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kutejova, B. Engist, M. Self, G. Oliver, P. Kirilenko, and N. Bobola Six2 functions redundantly immediately downstream of Hoxa2 Development, April 15, 2008; 135(8): 1463 - 1470. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Johansen, P. E. Hoyer, L. A. Larsen, P. A. Price, and K. Mollgard YKL-40 Protein Expression in the Early Developing Human Musculoskeletal System J. Histochem. Cytochem., December 1, 2007; 55(12): 1213 - 1228. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Daftary and H. S. Taylor Endocrine Regulation of HOX Genes Endocr. Rev., June 1, 2006; 27(4): 331 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Ashe and J. Briscoe The interpretation of morphogen gradients Development, February 1, 2006; 133(3): 385 - 394. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ferretti, F. Cambronero, S. Tumpel, E. Longobardi, L. M. Wiedemann, F. Blasi, and R. Krumlauf Hoxb1 Enhancer and Control of Rhombomere 4 Expression: Complex Interplay between PREP1-PBX1-HOXB1 Binding Sites Mol. Cell. Biol., October 1, 2005; 25(19): 8541 - 8552. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Vermot, B. Schuhbaur, H. L. Mouellic, P. McCaffery, J.-M. Garnier, D. Hentsch, P. Brulet, K. Niederreither, P. Chambon, P. Dolle, et al. Retinaldehyde dehydrogenase 2 and Hoxc8 are required in the murine brachial spinal cord for the specification of Lim1+ motoneurons and the correct distribution of Islet1+ motoneurons Development, April 1, 2005; 132(7): 1611 - 1621. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||