|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 January 2005
doi: 10.1242/dev.01618
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Cincinnati Children's Hospital Research Foundation, 3333 Burnett Avenue,
Cincinnati, OH 45229, USA
2 PSTP Program, University of Cincinnati College of Medicine, PO Box 670555,
Cincinnati, OH 45267, USA
* Author for correspondence (e-mail: christopher.wylie{at}cchmc.org)
Accepted 1 December 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Lysophosphatidic acid, Actin cytoskeleton, G-protein-coupled receptor, Xenopus
| Introduction |
|---|
|
|
|---|
Of particular interest is the mechanism by which each cell of the embryo assembles a similar cortical actin network. The number of cells increases rapidly by repeated cell divisions in the early embryo, and yet each cell, as it forms, assembles an actin skeleton appropriate to its contribution to the overall shape and rigidity of the whole embryo. In general, two mechanisms for this can be envisaged. First, each cell could inherit actin assembly instructions from the egg. Second, intercellular signaling could maintain the appropriate density and pattern of cortical actin filaments. In general, little is known about how cells of supracellular arrays all maintain actin skeletons appropriate for the shape, size and rigidity of the array. Xenopus embryos offer an attractive system in which to study this.
It has been known for many years that phospholipids can participate in
intercellular signaling (Vogt,
1963
), and their diverse roles have only recently been realized as
more model systems have become available
(Im et al., 2000
;
Yang et al., 2002
). The
phospholipid LPA can induce different cellular responses, depending upon cell
type and context. These include smooth muscle contraction, cell proliferation,
platelet aggregation, cell migration and neurite retraction
(Goetzl, 2001
;
Xie et al., 2002
). In
particular, LPA signaling has been shown to influence both the actin
cytoskeleton and cellular morphology. Increased LPA signaling in fibroblasts
increases the formation of stress fibers. In different neural cell lines, it
causes rapid process retraction, cell rounding or actin reorganization
(Fukushima et al., 2002
;
Ridley and Hall, 1992
;
Yan et al., 2003
).
Overexpression of the Xenopus XLPA1 receptor in a rat
neuroblastoma line that lacks endogenous LPA receptors, causes cell rounding,
retracted neurites and an increase in stress fibers
(Kimura et al., 2001
).
LPA signals through G-protein-coupled receptors (GPCR) belonging to the
rhodopsin-like class A receptors. These are seven transmembrane domain (TMD)
proteins that bind specific G proteins to elicit responses
(Anliker and Chun, 2004
). The
first LPA receptor was identified as a sheep orphan GPCR (Edg-2) and
subsequently as the mouse ortholog of rec1.3
(Macrae et al., 1996
;
Masana et al., 1995
). It was
also identified in a screen for GPCRs associated with neuron production, as a
transcript expressed in the ventricular zone of the developing mouse cortex,
and demonstrated to be an LPA-specific receptor
(Hecht et al., 1996
).
Overexpression of this transcript in cell lines induced serum-dependent cell
rounding, which was mimicked by addition of LPA. Verification that this was an
LPA receptor was provided by studies in yeast and gain-of-function studies
using the human ortholog (An et al.,
1997
; Erickson et al.,
1998
). Structural studies have suggested key residues to be
important for phospholipid binding and LPA specificity
(Wang et al., 2001
). To date,
three LPA receptors have been identified in mammals and renamed
LPA1, LPA2 and LPA3
(Lynch, 2002
). These share
sequence homology with a more divergent fourth receptor
(Anliker and Chun, 2004
). In
Xenopus, a single LPA receptor and its pseudoallele have so far been
identified. These are most closely related to mammalian LPA1 (and
designated here as XLPA1A and XLPA1B). Both genes are
expressed maternally and throughout embryogenesis
(Kimura et al., 2001
).
In this work, we show that LPA signaling is both necessary and sufficient for maintenance of the normal cortical actin skeleton in the early Xenopus embryo. First, we show that an additional LPA receptor, most closely related to LPA2 (designated here as XLPA2) is expressed after the onset of zygotic transcription. No homolog of mammalian LPA3 was identified. We show that either addition of LPA ligand, or overexpression of Xenopus LPA receptors, increases the density of the cortical actin network in the early embryo and increases the rate of wound healing. Conversely, depletion of XLPA1 and XLPA2 receptors in the blastula reduces the density of the cortical actin network. Cell disaggregation mimics the effect of LPA receptor depletion, and adding soluble LPA to dissociated cells reverses the effect. These data suggest an intercellular signaling mechanism for global patterning of the cortical actin network in the early Xenopus embryo.
| Materials and methods |
|---|
|
|
|---|
Analysis of the actin skeleton
Vitelline membranes were removed from stage 9 embryos in a 1 x MMR
solution on agarose dishes. Embryos were fixed for 30 minutes in FG fixative
(3.7% formaldehyde/0.25% glutaraldehyde/0.2% Triton X-100 in PIPES buffer
(Gard et al., 1997
) before
excision of animal caps to examine the undisturbed actin skeleton.
Alternatively, animal caps were excised and cultured for 10 minutes before
fixation in FG fix, to allow the analysis of the response of the actin
skeleton to wounding. In each case, the cortical actin skeleton was analyzed
exactly as described by Kofron et al.
(Gard et al., 1997
;
Kofron et al., 2002
). For
lipid experiments, LPA, phosphatidic acid and phosphatidylethanolamine (Avanti
Polar Lipids) were reconstituted in 0.4% lipid-free BSA (Sigma) in 1 x
MMR and 0.4% lipid-free BSA was added to all solutions as a carrier. After
caps were cut, they were incubated for 10 minutes in a lipid or control
solution before analysis of cortical actin.
Oligonucleotides
Twelve antisense oligonucleotides complementary to both XLPA1A
and XLPA1B mRNA were tested for their ability to deplete the
maternal messages by injecting into the marginal zones of oocytes, incubating
for 24 hours at 18°C, and assaying for mRNA depletion using RTPCR.
Antisense oligonucleotides that depleted both mRNAs to less than 20% of normal
levels were phophorothioate-modified, purified by HPLC, and resuspended in
sterile, filtered water. The sequence of the oligo selected for use was as
follows (where asterisks represent phosphorothioate linkages):
LPA1-10MP, 5'
T*C*A*TTGTAGTAGCAC*T*G*G
3'.
Morpholino oligonucleotides were designed that targeted both XLPA1A and XLPA1B or XLPA2. These were resuspended in sterile, filtered water and injected at doses of 10-40 ng into either oocytes or embryos: XLPA1A and 1B MO, 5' TTCACTTCAGATGTCAGTCATGCTG 3'; XLPA2 MO, 5' ACCTCCAATGTTACAGCGCAGCCTC 3'.
RNA constructs
Clones encoding both X. tropicalis XLPA1 and
XLPA2 were identified by blasting the murine sequences for
LPA1 against X. tropicalis cDNA libraries at the Sanger
Institute site
(http://www.sanger.ac.uk/).
The following clones for XLPA1 (TNeu092p02) and XLPA2
(TNeu013j17) were isolated, sequenced and DNA was linearized with
Asp718. Dominant-negative forms of the human small Rho GTPases were
excised from the pKH3 vector (a generous gift from Yi Zheng) using
BamHI and EcoRI and inserted into the pCS2+ vector. DNA was
linearized with ApaI. In vitro transcription was performed using the
SP6 mMessage Machine (Ambion). Samples were treated for 15 minutes with DNase
I, purified by phenol:chloroform extraction and resuspended in sterile
filtered water.
RT-PCR
Total RNA was isolated from either two oocytes or embryos at specified
stages in a proteinase K solution as described
(Kofron et al., 2002
) and
subsequently treated with DNase I. cDNA was synthesized using oligo dT primers
from 1 µg total RNA. The cDNA samples were analyzed on the MJ Research
Opticon. Uninjected samples were used to generate a standard curve for each
primer set and all data were normalized to either ornithine decarboxylase or
plakoglobin as a control. Water and no reverse transcriptase controls were run
each time and found to produce no product. PCR reactions were run on a 1.8%
agarose gel to verify amplification of the correct size fragment and look for
the formation of primer dimers. Primer pairs that were used are as
follows.
Cell dissociation assays
Vitelline membranes were removed from mid-blastulae (stage 8). Five animal
caps were cut, and dissociated in 67 mM phosphate buffer for 3 minutes
(Snape et al., 1987
).
Dissociated cells were transferred into 1 x
Ca2+/Mg2+-free MMR on a 1% agarose dish. After 1 hour,
cells were transferred into 0.1-1 µM LPA in
Ca2+/Mg2+-free MMR in glass dishes for five minutes, or
allowed to reassociate in 1 x MMR. Cells were removed from the LPA
solutions and maintained in 1 x Ca2+/Mg2+-free MMR
for different time intervals before fixation. Cells were fixed for 4 minutes
in FG fix, washed with 1 x PBS+0.1% Tween-20, and stained with Alexa
488-phalloidin. To determine if Ca2+ or Mg2+ affected
the actin cytoskeleton of dissociated cells, the cells were transferred back
into 1 x MMR 15 minutes after dissociation, incubated for 30 minutes,
and fixed and stained as above.
Statistics
Using the Laser Scanning Microscope software (Zeiss), projections were made
from z-stacks of single cells or animal caps. The mean intensity was
recorded over a 5000 µm2 area for at least 15 dissociated cells
in each group. For animal caps, the mean intensity was recorded over a 0.62
mm2 area for gain-of-function experiments and a 1000
µm2 area with the low threshold set to 100. The mean intensities
were averaged and are reported as mean±s.e.m. Student's t-test
was used to determine significance and P<0.05 was considered to be
statistically significant.
| Results |
|---|
|
|
|---|
|
Intercellular signaling controls the density of the cortical actin network
Because each cell of the blastula has a similar pattern and density of
cortical actin (Fig. 1C,D), we
tested the possibility that intercellular signaling maintains or initiates
this pattern. We removed animal caps from early blastulae and dissociated them
into single cells by removing the divalent cations required for cell adhesion.
The cells were kept apart, fixed after different times in culture and the
cortical actin network stained using Alexa-488 phalloidin. The cortical actin
network in dissociated cells changed over the course of 30-60 minutes from the
dense cortical network seen in undissociated caps from sibling embryos
(Fig. 2A,B), to a coarser
network of thick filament bundles, similar to those of dividing cells in
intact animal caps (compare Fig.
1F with Fig. 2C).
To avoid the potential artifact that the actin skeleton is reduced by the
Ca2+/Mg2+-free saline, we compared dissociated cells
that had been cultured in Ca2+/Mg2+-free MMR before
fixation with those that were transferred into 1 x MMR at low density
after disaggregation for 30 minutes before fixation. There was no significant
difference in the intensity of phalloidin staining in the two groups of cells
(data not shown). Subsequent reaggregation of single cells by transfer at high
density to 1 x MMR resulted in reassembly of the high-density cortical
actin network characteristic of intact caps
(Fig. 2D). This suggests that
intercellular signaling, either through soluble ligands or by cell contact, is
required to maintain the density and pattern of cortical actin assembly in
each cell of the intact embryo.
|
|
|
The predicted protein was found to be 62% identical and 16% similar to
mouse LPA2 at the protein level and thus was designated X.
tropicalis XLPA2. It contains 344 amino acids, has a predicted
molecular mass of 39.5 kDa, and is predicted to have seven putative
transmembrane domains (TMD) (Fig.
5A). XLPA2 is most divergent from the mammalian
orthologs in the fourth and fifth TMDs and at the C terminus. Based on
structural models, LPA receptors have been shown to contain three residues
that interface with LPA (Wang et al.,
2001
). XLPA2 contains the conserved arginine and lysine
in the third and seventh TMD, respectively, that are thought to interact with
the head group of LPA; and a glutamine in the third domain that confers LPA
specificity (highlighted in red in Fig.
5A). Like mammalian LPA2 receptors, it also lacks the
longer extracellular N terminus of LPA1.
|
Expression of LPA receptors during Xenopus laevis development
Total RNA was isolated from a series of developmental stages, and
expression levels of XLPA1 and XLPA2 analyzed by
real-time RTPCR. As reported previously, XLPA1 was found to be most
abundant in the oocyte (Kimura et al.,
2001
). After the mid-blastula transition (MBT) and the onset of
zygotic transcription, levels of the XLPA1 transcript fall, but low
levels of XLPA1 expression continued until at least stage 45.
Conversely, XLPA2 mRNA was not detected in oocytes or early
embryos. Expression commenced at MBT, and remained constant until at least
stage 45 (Fig. 5B). Results are
representative of a single experiment. This experiment was repeated in three
independent experiments and the same result was obtained each time.
Overexpression of X. tropicalis LPA receptors mimics addition of LPA ligand
To assay for the presence of functional LPA ligand at the blastula stage,
we injected 400 pg of either XLPA1 or XLPA2 receptor
mRNA at the two-cell stage (200 pg/blastomere), and excised animal caps for
analysis of the actin skeleton at the late blastula stage. After removal of
the vitelline membrane, embryos injected with either XLPA1 or
XLPA2 became elongated along the animal-vegetal axis
(Fig. 6A,B). They were also
more compact than controls, and the animal caps healed faster than control
caps (Fig. 6C). The effects on
animal caps of LPA receptor overexpression were identical to those caused by
addition of LPA to the animal caps; denser networks of cortical actin, thicker
purse-strings, no change in contractile rings and faster wound-healing
(Fig. 6D,E). Overexpression of
LPA receptors caused a significant increase in phalloidin intensity over a
0.62 mm2 area from 1133±177 to 1372±302 or
1610±348 for XLPA1 and XLPA2, respectively
(Fig. 4B). All data represent
four independent experiments with five caps per group in each experiment.
Therefore, overexpression of the LPA receptor is sufficient to increase
cortical actin and the rate of wound healing in the early embryo, and
demonstrates the presence of endogenous ligand.
|
|
Despite the reduction of cortical actin at the blastula stage, embryos
depleted only of the maternal XLPA1 were able to gastrulate and
develop normally to tadpole stages (Fig.
7E). This could be due to re-establishment of receptor levels as
the maternal store is replaced by zygotic transcription of XLPA1
and/or XLPA2. To test this possibility, we synthesized antisense
morpholino oligos, which block translation of their target mRNAs throughout
early development (Heasman et al.,
2000
), complementary to each mRNA separately (XLPA1-MO
and XLPA2-MO). These were injected at either the two-cell stage of
development into the animal hemisphere at doses from 10-40 ng, or into oocytes
that were then fertilized using the host transfer technique.
At doses of 20-40 ng of the XLPA1-MO, there was a generalized decrease in the amount of F-actin staining throughout all cells in the animal caps (Fig. 9A), similar to caps depleted of maternal XLPA1. Purse-strings were present after animal cap excision, but at reduced levels compared with control caps (Fig. 9A). At high power, cells in LPA1-depleted caps were found to have lost the dense cortical network of actin filament bundles, but retained a coarser network similar to that seen in dividing cells, and in dissociated cells. In addition, fewer cell processes were present (Fig. 9B). These data are representative of four independent experiments with five animal caps per group.
|
Addition of soluble LPA to isolated cells restores the cortical actin density to in vivo levels
Loss of LPA signaling reduces the density of the cortical skeleton, and
mimics the effect of dissociating the cells, suggesting that LPA is an
endogenous intercellular signal that controls the density of the cortical
actin skeleton. To test this, cortical actin skeletons were compared between
intact embryos, cells from embryos that had been dissociated at the
mid-blastula stage and kept apart for 1 hour, and cells kept apart for 1 hour
and then incubated for 5 minutes in 0.1 or 1 µM LPA. The cortical actin
skeleton was significantly reduced in dissociated cells compared with intact
embryos, and was rescued by subsequent addition of LPA to the dissociated
cells (Fig. 10A). The mean
fluorescence intensity for each cell was determined over a 5000
µm2 area and averaged for each group. Addition of LPA to
dissociated cells caused a statistically significant rise from 933±180
to 1626±349. Washing out the LPA, and keeping the cells dissociated
caused a drop in cortical actin back to the level in dissociated cells after
45 minutes (Fig. 10B). The
experiment was repeated three times with the same result. These data show that
continuous signaling by LPA is required to maintain the normal pattern and
level of cortical actin.
|
To determine whether LPA signaling in early Xenopus embryos acts through similar pathways, we expressed these same dominant-negative constructs, assayed their effects on the actin skeleton and asked if overexpression of LPA receptors could rescue these effects. We injected mRNA for either XLPA2 alone, a dominant-negative GTPase alone or for both mRNAs at the two-cell stage and analyzed the actin skeleton at stage 9. Overexpression of RhoA-N19 alone resulted in a loss of purse-strings (arrow in Fig. 8B, upper middle panel), delayed wound healing and an increase in cellular processes (Fig. 8A,B, lower left panel). At higher doses, cell division was blocked and occasionally large cells were seen that had not divided (not shown). When XLPA2 and RhoA-N19 were injected together, the Rho-N19 blocked the effect of XLPA2 on wound healing, but not the increase in overall cortical actin (Fig. 8A,B). This suggests that RhoA is downstream of LPA signaling in the formation of purse strings and wound healing, but not in the pathway leading to assembly of the cortical network of actin.
|
| Discussion |
|---|
|
|
|---|
LPA-mediated signaling has been implicated in a wide range of cell
behavior, including proliferation, survival, motility, cell shape and
differentiation (Anliker and Chun,
2004
; Fukushima et al.,
2002
; Tigyi, 2001
;
Ye et al., 2002
). Targeted
mutation of LPA receptors in the mouse has shown that LPA signaling is
required for normal development (Contos et
al., 2000
; Contos et al.,
2002
). Redundancies in receptor function and the pleiotropic
effects of their removal have made it difficult to identify specific cellular
events in specific organs that require LPA signaling. However, it is clear
that in its absence, normal development does not occur. One specific event
found to require LPA signaling in vivo was survival of Schwann cells in the
sciatic nerve (Contos et al.,
2000
). In the present study, we have used the early
Xenopus embryo as a relatively simple and tractable system to
identify a specific role for LPA signaling in vivo. Upregulation of either the
ligand or its receptor increased the density of cortical actin, indicating the
presence of functional receptor and ligand in the embryo. Downregulation of
the two LPA receptors had the converse effect, indicating that LPA signaling
is both necessary and sufficient for maintenance of the correct density and
pattern of cortical actin.
It is of interest that either dissociation of the blastula cells or depletion of the LPA receptors, caused loss of the high-density cortical actin network, but left a coarser network of actin filaments remaining in the blastomeres. When LPA is added to dissociated cells, or they are allowed to aggregate again, a denser network, similar to that found in vivo, was assembled. This suggests that there are cell-autonomous mechanisms, either mediated by autocrine signaling or constitutively active signaling intermediates, that maintain a basal level of actin assembly, and LPA signaling between cells converts this to the dense network seen in cells that are connected to other cells in the embryo. In this context, it is interesting that cells rounding up to divide lose the denser network, suggesting that LPA signaling may be switched off to allow them to do this. At the moment, we have no direct evidence for this hypothesis, nor of its mechanism.
Intercellular signaling can be mediated through cell-cell contacts,
secreted signals that function in an autocrine or paracrine fashion, or both.
It has been shown that cell-cell contacts, in particular adherens junctions,
modulate the cortical actin skeleton
(Gumbiner, 1990
;
Gumbiner, 1996
). In this work,
we have not determined the roles of adherens junctions. However, the
loss-of-function data presented here shows that LPA signaling is a necessary
signal for regulating the density of the network. In dissociated cells, LPA is
sufficient to increase the density of the actin cytoskeleton without cell
contact. In addition, loss of LPA receptors in the whole embryo results in a
coarser network, without affecting cell adhesion, suggesting that cell-cell
contacts are still present. Despite this, it is likely that cell junctions
will provide information to the cell, in addition to intercellular lipid
signaling, to establish the correct pattern and density of actin
filaments.
We find that there is redundancy in signaling through the XLPA1
and XLPA2 receptors with respect to the changes in the actin
cytoskeleton. Both receptors, when overexpressed, produced a similar increase
in cortical actin and more rapid wound healing. In addition, a high dose of
each morpholino individually caused a similar phenotype to a lower dose of
both morpholinos together. This suggests that the quantity, rather than the
nature, of LPA receptors is crucial for the actin cytoskeleton, and that one
receptor may compensate for the other. No late developmental phenotype was
apparent when the phosphorothioate oligo was used to deplete only the maternal
store of XLPA1. This was most likely due to the onset of
XLPA1 and XLPA2 production after the MBT. Redundancy
also exists between murine LPA receptors. The
Edg4/ mouse (mouse homologs of LPA1 and LPA2
are known as Edg2 and Edg4, respectively) showed no obvious gross or
histological phenotype and the
Edg2//Edg4/ mouse
only showed an increase in frontal hematomas compared with the
Edg2/ mouse
(Contos et al., 2002
). In
addition, when LPA was added to mouse embryonic fibroblasts isolated from the
meninges, stress fibers formed throughout the cell. This response was only
blocked in fibroblasts isolated from the
Edg2//Edg4/ mouse
and not from the individual knockouts
(Contos et al., 2002
).
It is likely that LPA signaling is required for more than the formation of the cortical actin skeleton in the blastula. It is an advantage of this model system that the function in cortical actin skeleton can be studied at an early stage, in the absence of a background of pleiotropic roles of LPA. However, the extensive later developmental defects caused by blockade of LPA1 and LPA2 suggest that LPA signaling is required in different regions of the embryo as more cell types form, and multiple types of cell behavior develop. It will be of interest to identify these, and the mechanisms whereby LPA signaling is spatially and temporally controlled during embryogenesis.
LPA receptors require the function of the small Rho GTPases XRho and XRac
to elicit the overexpression effects of increased cortical actin, increased
wound healing and thick animal caps. It has been well established that in many
cell types LPA signaling functions through RhoA in a G
12/13
pathway (Contos et al., 2002
;
Kimura et al., 2001
;
Ridley and Hall, 1992
;
Yan et al., 2003
). Additional
evidence demonstrates that LPA may also activate Rac through a
G
i/o-mediated pathway to exert its effects
(Van Leeuwen et al., 2003
).
Although we have not determined which G proteins are used in our model, it is
possible that XRho and XRac are being activated in the embryo by similar
mechanisms as in single cells.
Both addition of LPA to animal caps and overexpression of either LPA
receptor increased the rate of wound healing. One mechanism that LPA may be
affecting is assembly of a purse-string. Brock et al. first described the
formation of an actinomyosin purse-string that is assembled rapidly to provide
the driving force to close embryonic wounds
(Brock et al., 1996
). However,
previous work in Xenopus embryos suggests that in superficial wounds,
where the deep layer of cells is not breached, the purse-string does not
provide the driving force for wound closure
(Davidson et al., 2002
).
Instead, contraction and ingression of the deep cells may pull the wound
closed. The results presented here do not discriminate between
purse-string-mediated and non-purse-string-mediated mechanisms of wound
healing. They show only that LPA signaling is required for normal purse string
assembly and for wound healing.
It has been hypothesized previously that LPA signaling may play a role in
wound healing. Regular application of LPA to a surface wound in a rat model
accelerated wound closure and a thickening of the epithelial layer after
wounding (Balazs et al., 2001
).
In our gain-of-function experiments, the thickness of the animal cap was
increased in a similar manner and the caps rounded up faster than controls. In
loss-of-function experiments, wound healing was delayed, but the embryo could
still heal. It is possible that there are redundant signaling systems that
compensate for the loss of LPA signaling during wound healing, such as
signaling by related phospholipids. In the
Edg2//Edg4/ mouse,
normal wound healing was observed compared with control mice, but this may
also due to functional redundancy and complexity of the mouse model
(Contos et al., 2002
).
In Drosophila, substantial changes in cell shape by the leading
edge cells are required to draw the wound closed, while in final stages
filopodia between cells may bridge the wound and assist in closure
(Wood et al., 2002
). In
Xenopus oocytes, wound closure is mediated by drawing the wound
closed in a circular fashion via an actinomyosin purse string composed of
F-actin and myosin II (Bement et al.,
1999
). The signals that control these responses have yet to be
elucidated. The experiments documented here show that LPA signaling is
required in vivo for cellular responses to wounding in the early
Xenopus embryo.
In conclusion, these experiments show that intercellular signaling by LPA and its two receptors provides an essential mechanism for coordinating the pattern and density of actin assembly in individual cells of a supracellular array as it forms from a single cell, thus controlling its overall architecture and rigidity. This mechanism is likely to be used many times in development to generate specific architectural shapes from groups of individual cells.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
An, S., Dickens, M. A., Bleu, T., Hallmark, O. G. and Goetzl, E.
J. (1997). Molecular cloning of the human Edg2 protein and
its identification as a functional cellular receptor for lysophosphatidic
acid. Biochem. Biophys. Res. Commun.
231,619
-622.[CrossRef][Medline]
Anliker, B. and Chun, J. (2004).
Lysophospholipid G protein-coupled receptors. J. Biol.
Chem. 279,205
-258.
Balazs, L., Okolicany, J., Ferrebee, M., Tolley, B. and Tigyi,
G. (2001). Topical application of the phospholipid growth
factor lysophosphatidic acid promotes wound healing in vivo. Am. J.
Physiol. Regul. Integr. Comp. Physiol.
280,R466
-R472.
Bement, W. M., Mandato, C. A. and Kirsch, M. N.
(1999). Wound-induced assembly and closure of an actomyosin purse
string in Xenopus oocytes. Curr. Biol.
9, 579-587.[CrossRef][Medline]
Brock, J., Midwinter, K., Lewis, J. and Martin, P.
(1996). Healing of incisional wounds in the embryonic chick wing
bud: characterization of the actin purse-string and demonstration of a
requirement for Rho activation. J. Cell Biol.
135,1097
-1107.
Chun, J., Goetzl, E. J., Hla, T., Igarashi, Y., Lynch, K. R.,
Moolenaar, W., Pyne, S. and Tigyi, G. (2002). International
Union of Pharmacology. XXXIV. Lysophospholipid receptor nomenclature.
Pharmacol Rev. 54,265
-269.
Contos, J. J., Fukushima, N., Weiner, J. A., Kaushal, D. and
Chun, J. (2000). Requirement for the lpA1 lysophosphatidic
acid receptor gene in normal suckling behavior. Proc. Natl. Acad.
Sci. USA 97,13384
-13389.
Contos, J. J., Ishii, I., Fukushima, N., Kingsbury, M. A., Ye,
X., Kawamura, S., Brown, J. H. and Chun, J. (2002).
Characterization of lpa(2) (Edg4) and lpa(1)/lpa(2) (Edg2/Edg4)
lysophosphatidic acid receptor knockout mice: signaling deficits without
obvious phenotypic abnormality attributable to lpa(2). Mol. Cell.
Biol. 22,6921
-6929.
Davidson, L. A., Ezin, A. M. and Keller, R.
(2002). Embryonic wound healing by apical contraction and
ingression in Xenopus laevis. Cell Motil. Cytoskel.
53,163
-176.[CrossRef][Medline]
Erickson, J. R., Wu, J. J., Goddard, J. G., Tigyi, G.,
Kawanishi, K., Tomei, L. D. and Kiefer, M. C. (1998).
Edg-2/Vzg-1 couples to the yeast pheromone response pathway selectively in
response to lysophosphatidic acid. J. Biol. Chem.
273,1506
-1510.
Fukushima, N., Ishii, I., Habara, Y., Allen, C. B. and Chun,
J. (2002). Dual regulation of actin rearrangement through
lysophosphatidic acid receptor in neuroblast cell lines: actin
depolymerization by Ca(2+)-alpha-actinin and polymerization by rho.
Mol. Biol. Cell 13,2692
-2705.
Gard, D. L., Cha, B. J. and King, E. (1997).
The organization and animal-vegetal asymmetry of cytokeratin filaments in
stage VI Xenopus oocytes is dependent upon F-actin and microtubules.
Dev. Biol. 184,95
-114.[CrossRef][Medline]
Goetzl, E. J. (2001). Pleiotypic mechanisms of
cellular responses to biologically active lysophospholipids.
Prostaglandins 64,11
-20.[Medline]
Gumbiner, B. (1990). Generation and maintenance
of epithelial cell polarity. Curr. Opin. Cell Biol.
2, 881-887.[CrossRef][Medline]
Gumbiner, B. M. (1996). Cell adhesion: the
molecular basis of tissue architecture and morphogenesis.
Cell 84,345
-357.[CrossRef][Medline]
Heasman, J., Kofron, M. and Wylie, C. (2000).
Beta-catenin signaling activity dissected in the early Xenopus embryo: a novel
antisense approach. Dev. Biol.
222,124
-134.[CrossRef][Medline]
Hecht, J. H., Weiner, J. A., Post, S. R. and Chun, J.
(1996). Ventricular zone gene-1 (vzg-1) encodes a
lysophosphatidic acid receptor expressed in neurogenic regions of the
developing cerebral cortex. J. Cell Biol.
135,1071
-1083.
Holwill, S., Heasman, J., Crawley, C. and Wylie, C.
(1987). Axis and germ line deficiencies caused by u.v.
irradiation of Xenopus oocytes cultured in vitro.
Development 100,735
-743.
Im, D. S., Ungar, A. R. and Lynch, K. R.
(2000). Characterization of a zebrafish (Danio rerio) sphingosine
1-phosphate receptor expressed in the embryonic brain. Biochem.
Biophys. Res. Commun. 279,139
-143.[CrossRef][Medline]
Jacinto, A. and Baum, B. (2003). Actin in
development. Mech. Dev.
120,1337
-1349.[CrossRef][Medline]
Kimura, Y., Schmitt, A., Fukushima, N., Ishii, I., Kimura, H.,
Nebreda, A. R. and Chun, J. (2001). Two novel Xenopus
homologs of mammalian LP(A1)/EDG-2 function as lysophosphatidic acid receptors
in Xenopus oocytes and mammalian cells. J. Biol. Chem.
276,15208
-15215.
Kofron, M., Heasman, J., Lang, S. A. and Wylie, C. C.
(2002). Plakoglobin is required for maintenance of the cortical
actin skeleton in early Xenopus embryos and for cdc42-mediated wound healing.
J. Cell Biol. 158,695
-708.
Lynch, K. R. (2002). Lysophospholipid receptor
nomenclature. Biochim. Biophys. Acta
1582,70
-71.[Medline]
Macrae, A. D., Premont, R. T., Jaber, M., Peterson, A. S. and
Lefkowitz, R. J. (1996). Cloning, characterization, and
chromosomal localization of rec1.3, a member of the G-protein-coupled receptor
family highly expressed in brain. Mol. Brain Res.
42,245
-254.[Medline]
Masana, M. I., Brown, R. C., Pu, H., Gurney, M. E. and
Dubocovich, M. L. (1995). Cloning and characterization of a
new member of the G-protein coupled receptor EDG family. Receptors
Channels 3,255
-262.[Medline]
Nieuwkoop, P. D. and Faber, J. (1967).Normal Table of Xenopus laevis (Daudin)
.
Amsterdam, The Netherlands: North Holland Publishing.
Raats, J. M., Gell, D., Vickers, L., Heasman, J. and Wylie,
C. (1997). Modified mRNA rescue of maternal CK1/8 mRNA
depletion in Xenopus oocytes. Antisense Nucleic Acid Drug
Dev. 7,263
-277.[Medline]
Ridley, A. J. and Hall, A. (1992). The small
GTP-binding protein rho regulates the assembly of focal adhesions and actin
stress fibers in response to growth factors. Cell
70,389
-399.[CrossRef][Medline]
Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D.
and Hall, A. (1992). The small GTP-binding protein rac
regulates growth factor-induced membrane ruffling.
Cell 70,401
-410.[CrossRef][Medline]
Snape, A., Wylie, C. C., Smith, J. and Heasman, J.
(1987). Changes in the states of commitment of single animal pole
blastomeres of Xenopus laevis. Dev. Biol.
119,503
-510.[CrossRef][Medline]
Tigyi, G. (2001). Physiological responses to
lysophosphatidic acid and related glycero-phospholipids.
Prostaglandins 64,47
-62.[Medline]
Van Leeuwen, F. N., Olivo, C., Grivell, S., Giepmans, B. N.,
Collard, J. G. and Moolenaar, W. H. (2003). Rac activation by
lysophosphatidic acid LPA1 receptors through the guanine nucleotide exchange
factor Tiam1. J. Biol. Chem.
278,400
-406.
Vogt, W. (1963). Pharamacologically active
acidic phospholipids and glycolipids. Biochem.
Pharmacol. 12,415
-420.[CrossRef][Medline]
Wang, D. A., Lorincz, Z., Bautista, D. L., Liliom, K., Tigyi, G.
and Parrill, A. L. (2001). A single amino acid determines
lysophospholipid specificity of the S1P1 (EDG1) and LPA1 (EDG2) phospholipid
growth factor receptors. J. Biol. Chem.
276,49213
-49220.
Wood, W., Jacinto, A., Grose, R., Woolner, S., Gale, J., Wilson,
C. and Martin, P. (2002). Wound healing recapitulates
morphogenesis in Drosophila embryos. Nat. Cell Biol.
4, 907-912.[CrossRef][Medline]
Xie, Y., Gibbs, T. C. and Meier, K. E. (2002).
Lysophosphatidic acid as an autocrine and paracrine mediator.
Biochim. Biophys. Acta
1582,270
-281.[Medline]
Yan, H., Lu, D. and Rivkees, S. A. (2003).
Lysophosphatidic acid regulates the proliferation and migration of olfactory
ensheathing cells in vitro. Glia
44, 26-36.[CrossRef][Medline]
Yang, A. H., Ishii, I. and Chun, J. (2002). In
vivo roles of lysophospholipid receptors revealed by gene targeting studies in
mice. Biochim. Biophys. Acta
1582,197
-203.[Medline]
Ye, X., Fukushima, N., Kingsbury, M. A. and Chun, J.
(2002). Lysophosphatidic acid in neural signaling.
NeuroReport 13,2169
-2175.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
S. Nandadasa, Q. Tao, N. R. Menon, J. Heasman, and C. Wylie N- and E-cadherins in Xenopus are specifically required in the neural and non-neural ectoderm, respectively, for F-actin assembly and morphogenetic movements Development, April 15, 2009; 136(8): 1327 - 1338. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lin, S. Chen, D. S. Sepich, J. R. Panizzi, S. G. Clendenon, J. A. Marrs, H. E. Hamm, and L. Solnica-Krezel G{alpha}12/13 regulate epiboly by inhibiting E-cadherin activity and modulating the actin cytoskeleton J. Cell Biol., March 23, 2009; 184(6): 909 - 921. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Ye Lysophospholipid signaling in the function and pathology of the reproductive system Hum. Reprod. Update, September 1, 2008; 14(5): 519 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tao, S. Nandadasa, P. D. McCrea, J. Heasman, and C. Wylie G-protein-coupled signals control cortical actin assembly by controlling cadherin expression in the early Xenopus embryo Development, July 15, 2007; 134(14): 2651 - 2661. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Luo, Y. Xu, T. L. Hoffman, T. Zhang, T. Schilling, and T. D. Sargent Inca: a novel p21-activated kinase-associated protein required for cranial neural crest development Development, April 1, 2007; 134(7): 1279 - 1289. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tao, B. Lloyd, S. Lang, D. Houston, A. Zorn, and C. Wylie A novel G protein-coupled receptor, related to GPR4, is required for assembly of the cortical actin skeleton in early Xenopus embryos Development, June 15, 2005; 132(12): 2825 - 2836. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||