|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 January 2005
doi: 10.1242/dev.01654
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Botany, University of Florida, Gainesville, FL 32611-8526, USA
* Author for correspondence (e-mail: bahauser{at}botany.ufl.edu)
Accepted 17 December 2004
| SUMMARY |
|---|
|
|
|---|
Key words: Apical meristem, Arabidopsis thaliana, Differentiation, Gene expression, Ovule patterning, Primordia formation
| Introduction |
|---|
|
|
|---|
|
Four-fifths of the known loci that control ovule development regulate the
same, or a similar process, in another plant organ. For example, the WUSCHEL
(WUS) homeodomain protein controls integument initiation
(Groß-Hardt et al.,
2002
), as well as maintaining a pluripotent cell identity in the
central region of floral meristems (Laux
et al., 1996
; Mayer et al.,
1998
). In wus mutants, shoot meristems are initiated
repetitively, but expire prematurely, because the pluripotent population of
cells in the center of the meristem loses this stem cell activity
(Laux et al., 1996
). Ectopic
expression of the SHOOT MERISTEMLESS (STM) and WUS
genes was sufficient to activate cell division in differentiated tissues.
Accompanying microarray analyses indicate that STM and WUS each activate a
different subset of developmental genes
(Gallois et al., 2002
). More
significantly, when appropriate developmental signals are present, WUS
activity can initiate the formation of leaf, flower, or embryo primordia
(Gallois et al., 2004
).
AGAMOUS (AG) is another locus that regulates both ovule
and flower development. Based on analyses in the apetala2 mutant
background, genetic data reveal that AG and the closely related
SEEDSTICK, SHATTERPROOF1, and SHATTERPROOF2 loci all specify
ovule identity (Pinyopich et al.,
2003
; Western and Haughn,
1999
). In flowers, the AG gene specifies organ fate and
limits stem cell proliferation (Bowman et
al., 1991b
). AG establishes carpel identity in the fourth
whorl and, in conjunction with APETALA3 activity, specifies stamen
identity in the third whorl (Bowman et al.,
1989
; Yanofsky et al.,
1990
). In ag mutants, indeterminate flowers consisting of
only sepals and petals form; stamens and carpels are absent. The
gain-of-function studies with AG indicate that this gene is
sufficient to initiate stamens and carpels
(Kempin et al., 1993
;
Mizukami and Ma, 1992
). In
developing flowers, WUS induces AG expression
(Lenhard et al., 2001
;
Lohmann et al., 2001
). Later
in flower development, however, repression of WUS by AG is essential to
terminate floral meristem proliferation
(Lenhard et al., 2001
;
Lohmann et al., 2001
).
We previously reported that the PRETTY FEW SEEDS2 (PFS2)
gene regulates ovule patterning (Park et
al., 2004
). Based on genetic analyses, we report here that
PFS2 encodes a homeodomain gene that is a member of the WUS clade of
transcription factors. The PRESSED FLOWER (PRS) and
NARROW SHEATH (NS) genes are also members of the WUS clade
of transcription factors (Haecker et al.,
2004
; Nardmann et al.,
2004
). In the maize ns1 ns2 double mutant, the leaf blade
is significantly narrower than wild type, which results from diminished
recruitment of cells from the lateral domain of the shoot meristem during leaf
initiation (Nardmann et al.,
2004
). Consistent with this hypothesis is the expression of
NS transcripts in the lateral edges of leaf primordia as they emerge
from shoot meristems (Nardmann et al.,
2004
). In the Arabidopsis prs mutants, the lateral sepals
and the cell files that normally form on the margins of the medial sepals are
often absent (Matsumoto and Okada,
2001
). In addition, prs mutants lack stipules and
sometimes exhibit defects in lateral stamen development
(Nardmann et al., 2004
).
PRS is expressed in the margins of sepal and leaf primordial where it
is proposed to induce cell proliferation
(Matsumoto and Okada, 2001
)
and recruit meristem cells into these primordia
(Nardmann et al., 2004
). This
function is similar to that proposed for NS.
Loss-of-function analyses indicate that PFS2 plays a key role during ovule patterning by regulating cell proliferation of the maternal integuments and differentiation of the MMC. The molecular and genetic analyses described here indicate ovule development is sensitive to the level of PFS2 activity.
| Materials and methods |
|---|
|
|
|---|
100
µmol/m2/s), as recommended by Kranz and Kirchheim
(Kranz and Kirchheim, 1987
Microscopic analysis
Plastic sections
Tissues were fixed overnight in 50 mM cacodylate buffer, pH 7.0, 5%
glutaraldehyde. Samples were then dehydrated in a graded ethanol series, which
was gradually replaced with acetone. These samples were infiltrated with epoxy
resin that was polymerized overnight at 60°C
(Spurr, 1969
). Sections (0.5
µm) were stained with thionin and acridine orange
(Paul, 1980
) and visualized
using a Zeiss Axioscope microscope (Thornwood, NY). Bright-field images were
captured using a Kodak MDS 290 digital camera (Rochester, NY) that was
connected to the microscope. Images were cropped and manipulated for
publication using Adobe Photoshop (Adobe Systems, Inc., San Jose,
California).
Scanning electron microscopy (SEM)
SEM samples were prepared as described by Robinson-Beers et al.
(Robinson-Beers et al., 1992
),
except as noted here. Pistils were sputter coated with platinum. Samples were
examined and images captured using the Hitachi S-4000 FE-SEM (Tokyo, Japan),
which was operated at an acceleration voltage of 5 kV.
Plasmid rescue
Genomic DNA from pfs2-1 mutants was digested using Hind3
restriction enzyme. DNA fragments were ligated into covalently closed circles
using T4 DNA ligase and transformed into SoloPack Gold Supercompetant Cells
(Stratagene, La Jolla, CA). Plasmids were selected using ampicillin and the
flanking DNA was sequenced using the M13 primer.
Vector construction and plant transformation
The pSOP3 plasmid contains the promoter and coding sequence for
PFS2. This gene was PCR-amplified from genomic DNA using the
following primers: GTTATGGATCCAAAAATATGTG and GGGACAGAGATCTTTTGAGT. To create
pSOP3, the PCR product was digested using BamHI and BglII
and inserted into the compatible site in pCAMBIA 2200
(Hajdukiewicz et al., 1994
).
This plasmid was moved into Agrobacterium tumefaciens strain AGL by
triparental mating (Figurski and Helinski,
1979
). Plants were transformed with this A. tumefaciens
containing this plasmid using established transformation techniques
(Clough and Bent, 1998
).
Transformants were selected on 50 µg/ml kanamycin. The ovule phenotype of
transformants was evaluated using microscopic techniques described above.
The pSOP2 plasmid contains the PFS2 coding sequence under control
of the cauliflower mosaic virus 35S promoter (35S). Using gene-specific
primers (GTTCGGAATTCCACAACAAC and GGGACAGAGATCTTTTGAGT), and genomic DNA as a
template, the PFS2 coding sequence was PCR-amplified. The PCR product
was digested using EcoRI and BglII, and inserted into these
sites in pBH6 (Hauser et al.,
2000
). The 35S::PFS2 fragment was excised by cleaving the
DNA with NotI and was cloned into this restriction site in pMLBart.
The resulting plasmid, pSOP2, was used to transform Arabidopsis
plants using the floral dip method (Clough
and Bent, 1998
). T1 transformants were selected by spraying
seedlings with Finale (AgrEvo, Wilmington, DE), which had been diluted 1:1000
in water. In resistant plants, the presence of the transgene was verified by
PCR.
The PFS2 cDNA was cloned into by RT-PCR, by the method of Kawasaki
(Kawasaki, 1990
). RNA was
purified from inflorescences using RNeasy spin columns (Qiagen, Valencia, CA).
First-strand template was primed with oligo dT17, then PCR
amplified using the following primers: ATGGGCTACATCTCCAACAA and
TCAGTTCTTCAGAGGCATGA. The PFS2 cDNA was TA cloned into pCRII as
recommended by the manufacturer (Invitrogen, Carlsbad, CA), and the resulting
clones were sequenced to identify one without any mutations. The resulting
plasmid is called pSOP15.
Measuring PFS2 expression
Total RNA was isolated from fresh tissue using the RNeasy plant RNA
isolation kit (Qiagen, Valencia, CA). RNA concentration was measured using
RiboGreen dye (Molecular Probes, Eugene, OR) and a fluorometer. Using
Accupower RT PreMix (Bioneer Corp., Rockville, MD), the RNA template was
primed with dT17 and reversed transcribed. Qualitative differences
in PFS2 transcripts were determined by PCR using the following
gene-specific primers: ATGGGCTACATCTCCAACAA and TCAGTTCTTCAGAGGCATGA. Relative
AG expression levels were determined using the following primers:
ATGGCTGACAAGAAGATTAGG and AACGAAGTCAGTTGAGACAA. For normalization purposes,
the following primers were used to amplify glyceraldehyde-3-phosphate
dehydrogenase C (GAP) transcripts: ATGGCTGACAAGAAGATTAGG and
AACGAAGTCAGTTGAGACAA. Different primers (CTGGAGATGATGCACCAAGA and
GGAAGGTACTGAGTGATGCT) were used to amplify ACTIN11 transcripts.
Amplification of transcripts was evaluated using 25, 30, and 35 PCR cycles to
identify conditions where PCR reagents were not limiting. PCR products were
separated by size using agarose gels, stained with ethidium bromide, and
visualized under a UV light. Images from these gels were captured using a
ChemImager 4400 (Alpha Innotech Corp., San Leandro, CA), and relative band
intensities were measured using the associated software.
In situ hybridization
Except for the modifications noted below, previously described methods for
in situ hybridization were used
(Vielle-Calzada et al., 1999
).
To generate templates for probe synthesis, the insert in pSOP15 was PCR
amplified. The T7 RNA polymerase initiation sequence was placed in front of
one of the gene-specific primers, which allowed direct synthesis of
digoxigenin-labeled probe from PCR products. To PCR-amplify the template for
antisense probe synthesis, the following primers were used:
TTCCACACACAAACCGACCACA and TAATACGACTCACTATAGGGAAAGTCCGGTTGTCCCTCGTTT. The
template for the sense probe was amplified using
TAATACGACTCACTATAGGG-TTCCACACACAAACCGACCACA and AAAGTCCGGTTGTCCCTCGTTT
primers. RNA probes were synthesized using the Dig-RNA labeling kit (Roche
Applied Science, Indianapolis, IN). The 244-bp cRNA products were synthesized
and added to the hybridization solution, so the final concentration was 500
ng/ml. Probes were not hydrolyzed. Slides were hybridized at 45°C and
washed at 50°C. For color detection, 1 mM levamisole (Sigma, St Louis, MO)
was added to Western Blue substrate (Promega, Madison, WI). Slides were
evaluated under bright-field and DIC optics and images were captured and
modified as before.
| Results |
|---|
|
|
|---|
|
|
|
The PFS2 gene
Since the pfs2-1 mutant derives from a T-DNA mutated line, it was
necessary to determine if the T-DNA mapped to the mutant locus. In a
segregating population, genetic data indicated that the T-DNA was tightly
linked with the pfs2 mutation; no recombinants were found in 68
mutant plants. Accordingly, the DNA flanking the T-DNA insert in
pfs2-1 was isolated by plasmid rescue and sequenced (see Materials
and methods). The rescued DNA corresponds to the At2g01500 locus, which
encodes a homeodomain transcriptional factor. In a genome-wide survey of
WUS homeodomain genes, Haecker et al.
(Haecker et al., 2004
)
annotated At2g01500 as WOX6. In the pfs2-1 and
pfs2-2 alleles, T-DNA inserts were incorporated into the second and
third intron of this homeodomain gene, respectively
(Fig. 4A).
|
Fig. 4B shows the alignment of the proteins most similar to PFS2, including PRS, WUS, and PFS2-LIKE (At3g18018). Within the homeodomain and WOX (TL-LFP) domain, these four proteins share 95% amino acid identity (Fig. 4B). The PFS2 and PFS2-LIKE proteins share short motifs at the N- and C-termini (Fig. 4B). Outside these amino acid regions and domains, the similarity among these proteins drops precipitously.
PFS2 mRNA localization
To relate the observed pfs2 mutant phenotype with the expression
of PFS2 in wild-type plants, the relative abundance and localization
of PFS2 was measured using RT-PCR and in situ hybridization
(Fig. 5). In developing seeds,
PFS2 transcripts were found in the embryo, suspensor, and endosperm
nuclei, but were absent in the integuments
(Fig. 5A,B). In seedlings,
PFS2 transcripts were found in the shoot apical meristem and leaf
primordia, but were not expressed in expanded cotyledons or mature leaves
(Fig. 5C and data not shown).
In reproductive structures, transcripts could be detected in floral apical
meristems, floral primordia, stamens, and pistils
(Fig. 5D,E). Although the
pfs2 mutant does not have male defects, the PFS2 gene
expresses in the tapetum in anthers (Fig.
5E). In the gynoecium, PFS2 expression was present
throughout developing ovules (Fig.
5E-G). In addition, PFS2 mRNA was weakly expressed in
petals, sepals, and the walls of carpels
(Fig. 5H,J). In summary,
PFS2 mRNA was expressed in differentiating primordia, but absent in
organs that were nearly mature or fully developed.
|
Ectopic PFS2 expression
To determine if PFS2 was active outside the ovules, this gene was
expressed under the control of the 35S cauliflower mosaic virus promoter. In
transgenic plants overexpressing PFS2 (PFS2 OE), there were
a variety of phenotypes. The most severe phenotypes corresponded to the
highest levels of PFS2 expression many of these plants were
unable to form reproductive structures. In the most severely effected plants,
the apical meristems enlarged, but primordia that formed remained
undifferentiated for weeks (Fig.
6A). Occasionally a leaf primordium emerged, but it did not mature
into a leaf (Fig. 6B). Other
transformants showed disorganized or irregular leaf orientations or phyllotaxy
(Fig. 6C). These plants often
became highly fasciated because of the inability of the primordia to separate
from the apical meristem and adjacent primordia. Most transformants failed to
reproduce because plant development terminated before reproductive structures
formed.
|
PFS2 activity represses AG expression
The leaf phenotype of pfs2 mutants resembles the previously
reported phenotypes for curly leaf (clf) mutants
(Goodrich et al., 1997
) and
transgenic plants that overexpress AG
(Kempin et al., 1993
;
Mizukami and Ma, 1992
). CLF
activity represses AG transcription in leaves. In the clf
mutant, ectopic expression of AG in the leaves induced leaf curling
(Goodrich et al., 1997
). Since
the leaves in pfs2 mutants also curl
(Fig. 7C), the relative
expression of AG was assayed in various genetic backgrounds. RT-PCR
data demonstrated that, as PFS activity increases, the relative
abundance of AG transcripts decreases
(Fig. 7E). The leaf phenotype
of ag pfs2 double mutants was examined to determine if AG activity
was necessary for leaf curling. In ag pfs2 double mutants, leaf
curling diminished but was not completely eliminated
(Fig. 7D). Thus, analyses of
these single- and double-mutant phenotypes reveal that AG activity was
partially responsible for leaf curling
(Fig. 7).
|
| Discussion |
|---|
|
|
|---|
Defects in patterning of the nucellus in ovule primordia, not only affect
development of the distal portion of ovule primordia, but also the chalaza and
integuments. In nzz ovule primordia, the distal nucellus domain is
not established, which results in inappropriate expression of chalaza-specific
genes in this region (Sieber et al.,
2004
). Similarly in the nucellus of pfs2 mutants, defects
in the patterning of the ovule primordia were observed; parenchyma cells often
proliferate in the area normally occupied by the MMC
(Park et al., 2004
). This
could result either from the failure to form a boundary between the nucellus
and chalaza or a breakdown in ovule patterning. Since PFS2
transcripts were present in the chalaza and the nucellus
(Fig. 5), PFS2 could
not act alone to (1) establish a boundary between the chalaza and nucellus or
(2) specify the identity of the nucellus or MMC during patterning. If PFS2
regulates one of these functions, its activity would need to be modulated by a
region-specific factor.
While patterning defects are found in pfs2 mutants, these could
derive from defects in regulating the timing of differentiation. In
pfs2 mutant ovules, the decreased size of the MMC, gametophyte, and
integuments may be due to premature maturation of cells. In pfs2
mutants, the integuments are shorter than wild type, which could result from
premature differentiation of integument primordia. The cell in the center of
the nucellus normally develops into the MMC, but if this cell differentiates
before this identity is specified, then meiosis will not occur. Similarly,
defects in megagametogenesis occur if the functional megaspore or one of its
mitotic products differentiates too early. This is consistent with
observations of the mutant phenotype and accounts for both decreased
integument length and defects in MMC and gametophyte differentiation. In
addition, maintenance of cells in an undifferentiated state by PFS2 explains
the overexpression phenotypes. Differential growth of the outer integument is
regulated by the INNER NO OUTER (INO) locus, which
establishes abaxial polarity (Baker et al.,
1997
; Balasubramanian and
Schneitz, 2002
; Villanueva et
al., 1999
). As a result of PFS2 overexpression, abaxial
polarity in the outer integument was disrupted, which led to reduced growth of
the outer integument. This often induced a phenocopy of the ino
mutant (Fig. 6F). In
PFS2 OE plants, the MMC did not differentiate and small cells filled
this region (Fig. 6G). Thus,
analyses of these data led to the hypothesis that PFS2 helps to
maintain cells in an undifferentiated state.
The genes that share the highest similarity to PFS2 are NS,
PRS, and WUS, which have been proposed to recruit meristematic
cells into emerging primordia, promote cell proliferation, and establish a
pluripotent population of stem cells (Laux
et al., 1996
; Matsumoto and
Okada, 2001
; Nardmann et al.,
2004
). Each of these processes affects cell proliferation or
inhibition of cellular differentiation or both. PFS2 is expressed in
developing primordia, but is absent from mature tissues
(Fig. 5). PFS2
overexpression interfered with differentiation and maturation of leaves, outer
integuments, and floral primordia (Fig.
6). The broad expression pattern of PFS2 transcripts and
the overexpression phenotypes indicate that the PFS2 locus is active
in these regions. While different plant regions were affected in PFS
OE plants, these data are consistent with the observation that PFS2
delays differentiation and maturation of primordia. This proposed function is
similar to the functions of other members of the WUS clade of genes.
Comparable WUS and PFS2 overexpression phenotypes lend
further support to this hypothesis. When WUS was expressed under control of
the APETALA3 promoter, the result was the development of
supernumerary stamens and carpelloid stamens
(Lenhard et al., 2001
;
Lohmann et al., 2001
).
Overexpression of PFS2 in flowers yielded a similar phenotype
(Fig. 6E). Depending on the
stage of development and location in the floral meristem, WUS both activates
and represses AG expression
(Lenhard et al., 2001
;
Lohmann et al., 2001
). The
repression of WUS expression by the AG protein establishes a complex
feedback loop that correctly establishes stem cell identity and floral
determinacy during floral development
(Lenhard et al., 2001
;
Lohmann et al., 2001
). Since
AG establishes and maintains determinant growth of floral primordia, its
relative decrease in abundance in PFS2 OE plants could account for
the emergence of extra organ primordia from developing flowers. This proposal
will be rigorously tested in future work.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Baker, S. C., Robinson-Beers, K., Villanueva, J. M., Gaiser, J.
C. and Gasser, C. S. (1997). Interactions among genes
regulating ovule development in Arabidopsis thaliana.Genetics 145,1109
-1124.[Abstract]
Balasubramanian, S. and Schneitz, K. (2002).
NOZZLE links proximal-distal and adaxial-abaxial pattern formation
during ovule development in Arabidopsis thaliana.Development 129,4291
-4300.
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M.
(1989). Genes directing flower development in Arabidopsis.Plant Cell 1,37
-52.
Bowman, J. L., Drews, G. N. and Meyerowitz, E. M.
(1991a). Expression of the Arabidopsis floral homeotic
gene AGAMOUS is restricted to specific cell types late in flower
development. Plant Cell
3, 749-758.
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M.
(1991b). Genetic interactions among floral homeotic genes of
Arabidopsis. Development
112, 1-20.[Abstract]
Broadhvest, J., Baker, S. C. and Gasser, C. S.
(2000). SHORT INTEGUMENTS 2 promotes growth during
Arabidopsis reproductive development.
Genetics 155,899
-907.
Clough, S. J. and Bent, A. F. (1998). Floral
dip: a simplified method for Agrobacterium-mediated transformation of
Arabidopsis thaliana. Plant J.
16,735
-743.[CrossRef][Medline]
Elliott, R. C., Betzner, A. S., Huttner, E., Oakes, M. P.,
Tucker, W. Q. J., Gerentes, D., Perez, P. and Smyth, D. R.
(1996). AINTEGUMENTA, an APETALA2-like gene of
Arabidopsis with pleiotropic roles in ovule development and floral
organ growth. Plant Cell
8, 155-168.[Abstract]
Figurski, D. H. and Helinski, D. R. (1979).
Replication of an origin-containing derivative of plasmid RK2 dependent on a
plasmid function provided in trans. Proc. Natl. Acad. Sci.
USA 76,1648
-1652.
Gallois, J.-L., Woodward, C., Reddy, G. V. and Sablowski, R.
(2002). Combined SHOOT MERISTEMLESS and WUSCHEL trigger ectopic
organogenesis in Arabidopsis. Development
129,3207
-3217.
Gallois, J. L., Nora, F. R., Mizukami, Y. and Sablowski, R.
(2004). WUSCHEL induces shoot stem cell activity and
developmental plasticity in the root meristem. Genes
Dev. 18,375
-380.
Gasser, C. S., Broadhvest, J. and Hauser, B. A.
(1998). Genetic analysis of ovule development. Ann.
Rev. Plant Physiol. Plant Mol. Biol.
49, 1-24.[CrossRef]
Goodrich, J., Puangsomlee, P., Martin, M., Long, D., Meyerowitz,
E. M. and Coupland, G. (1997). A polycomb-group gene
regulates homeotic gene expression in Arabidopsis.
Nature 386,44
-51.[CrossRef][Medline]
Groß-Hardt, R., Lenhard, M. and Laux, T.
(2002). WUSCHEL signaling functions in interregional
communication during Arabidopsis ovule development. Genes
Dev. 16,1129
-1138.
Haecker, A., Gross-Hardt, R., Geiges, B., Sarkar, A.,
Breuninger, H., Herrmann, M. and Laux, T. (2004). Expression
dynamics of WOX genes mark cell fate decisions during early embryonic
patterning in Arabidopsis thaliana. Development
131,657
-668.
Hajdukiewicz, P., Svab, Z. and Maliga, P.
(1994). The small, versatile pPZP family of
Agrobacterium binary vectors for plant transformation.
Plant Mol. Biol. 25,989
-994.[CrossRef][Medline]
Hauser, B. A., He, J. Q., Park, S. O. and Gasser, C. S.
(2000). TSO1 is a novel protein that modulates cytokinesis and
cell expansion in Arabidopsis. Development
127,2219
-2226.[Abstract]
Herr, J. M. (1971). A new clearing technique
for the study of ovule development in angiosperms. Am. J.
Bot. 58,785
-790.[CrossRef]
Kawasaki, E. S. (1990). Amplification of RNA.
In PCR Protocols (ed. M. A. Innis, D. H. Gelfand, J.
J. Sninsky and T. J. White), pp. 21-27. San Diego,
CA: Academic Press.
Kempin, S. A., Mandel, M. A. and Yanofsky, M. F.
(1993). Conversion of perianth into reproductive organs by
ectopic expression of the tobacco floral homeotic gene NAG1. Plant
Physiol. 103,1041
-1046.[Abstract]
Kranz, A. R. and Kirchheim, B. (1987). Handling
of Arabidopsis. In Arabidopsis Information Service, v. 24:
Genetic Resources in Arabidopsis, (ed. A. R. Kranz), pp.4.1.1
-4.2.7. Frankfurt: Arabidopsis Information
Service.
Larkin, J. C., Oppenheimer, D. G., Pollock, S. and Marks, M.
D. (1993). Arabidopsis GLABROUS1 gene requires
downstream sequences for function. Plant Cell
5,1739
-1748.[Abstract]
Laux, T., Mayer, K. F. X., Berger, J. and Jürgens, G.
(1996). The WUSCHEL gene is required for shoot and
floral meristem integrity in Arabidopsis. Development
122, 87-96.[Abstract]
Lenhard, M., Bohnert, A., Jurgens, G. and Laux, T.
(2001). Termination of stem cell maintenance in
Arabidopsis floral meristems by interactions between WUSCHEL
and AGAMOUS. Cell 105,805
-814.[CrossRef][Medline]
Lohmann, J. U., Hong, R. L., Hobe, M., Busch, M. A., Parcy, F.,
Simon, R. and Weigel, D. (2001). A molecular link between
stem cell regulation and floral patterning in Arabidopsis.Cell 105,793
-803.[CrossRef][Medline]
Matsumoto, N. and Okada, K. (2001). A homeobox
gene, PRESSED FLOWER, regulates lateral axis-dependent development of
Arabidopsis flowers. Genes Dev.
15,3355
-3366.
Mayer, K. F. X., Schoof, H., Haecker, A., Lenhard, M., Jurgens,
G. and Laux, T. (1998). Role of WUSCHEL in regulating stem
cell fate in the Arabidopsis shoot meristem.
Cell 95,805
-815.[CrossRef][Medline]
Mizukami, Y. and Ma, H. (1992). Ectopic
expression of the floral homeotic gene AGAMOUS in transgenic
Arabidopsis plants alters floral organ identity.
Cell 71,119
-131.[CrossRef][Medline]
Nardmann, J., Ji, J., Werr, W. and Scanlon, M. J.
(2004). The maize duplicate genes narrow sheath1 and
narrow sheath2 encode a conserved homeobox gene function in a lateral
domain of shoot apical meristems. Development
131,2827
-2839.
Park, S. O., Hwang, S. and Hauser, B. A.
(2004). The phenotype of Arabidopsis ovule mutants
mimics the morphology of primitive seed plants. Proc. R. Soc. Lond.
B Biol. Sci. 271,311
-316.[Medline]
Paul, R. M. (1980). The use of thionin and
acridine orange in staining semithin sections of plant material embedded in
epoxy resin. Stain Technol.
55,195
-196.[Medline]
Pinyopich, A., Ditta, G. S., Savidge, B., Liljegren, S. J.,
Baumann, E., Wisman, E. and Yanofsky, M. F. (2003). Assessing
the redundancy of MADS-box genes during carpel and ovule development.
Nature 424,85
-88.[CrossRef][Medline]
Robinson-Beers, K., Pruitt, R. E. and Gasser, C. S.
(1992). Ovule development in wild-type Arabidopsis and
two female-sterile mutants. Plant Cell
4,1237
-1249.
Sieber, P., Gheyselinck, J., Gross-Hardt, R., Laux, T.,
Grossniklaus, U. and Schneitz, K. (2004). Pattern formation
during early ovule development in Arabidopsis thaliana. Dev.
Biol. 273,321
-334.[CrossRef][Medline]
Skinner, D. J., Hill, T. A. and Gasser, C. S.
(2004). Regulation of ovule development. Plant
Cell 16,S32
-45.
Spurr, R. A. (1969). A low viscosity epoxy
resin embedding medium for electron microscopy. J. Ultrastruct.
Res. 26,31
-43.[CrossRef][Medline]
Vielle-Calzada, J.-P., Thomas, J., Spillane, C. and
Grossniklaus, U. (1999). Maintenance of genomic imprinting at
the Arabidopsis MEDEA locus requires zygotic DDM1 activity.
Genes Dev. 13,2971
-2982.
Villanueva, J. M., Broadhvest, J., Hauser, B. A., Meister, R.
J., Schneitz, K. and Gasser, C. S. (1999). INNER NO
OUTER regulates abaxial-adaxial patterning in Arabidopsis
ovules. Genes Dev. 13,3160
-3169.
Western, T. L. and Haughn, G. W. (1999).
BELL1 and AGAMOUS genes promote ovule identity in
Arabidopsis thaliana. Plant J.
18,329
-336.[CrossRef][Medline]
Yanofsky, M. F., Ma, H., Bowman, J. L., Drews, G. N., Feldmann,
K. A. and Meyerowitz, E. M. (1990). The protein encoded by
the Arabidopsis homeotic gene AGAMOUS resembles
transcription factors. Nature
346, 35-39.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. Vandenbussche, A. Horstman, J. Zethof, R. Koes, A. S. Rijpkema, and T. Gerats Differential Recruitment of WOX Transcription Factors for Lateral Development and Organ Fusion in Petunia and Arabidopsis PLANT CELL, August 1, 2009; 21(8): 2269 - 2283. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nardmann, P. Reisewitz, and W. Werr Discrete Shoot and Root Stem Cell-Promoting WUS/WOX5 Functions Are an Evolutionary Innovation of Angiosperms Mol. Biol. Evol., August 1, 2009; 26(8): 1745 - 1755. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Shimizu, J. Ji, E. Kelsey, K. Ohtsu, P. S. Schnable, and M. J. Scanlon Tissue Specificity and Evolution of Meristematic WOX3 Function Plant Physiology, February 1, 2009; 149(2): 841 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakagawa, T. Kajitani, S. Togo, N. Masuko, H. Ohdan, Y. Hishikawa, T. Koji, T. Matsuyama, T. Ikura, M. Muramatsu, et al. Deubiquitylation of histone H2A activates transcriptional initiation via trans-histone cross-talk with H3K4 di- and trimethylation Genes & Dev., January 1, 2008; 22(1): 37 - 49. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Pillitteri, S. M. Bemis, E. D. Shpak, and K. U. Torii Haploinsufficiency after successive loss of signaling reveals a role for ERECTA-family genes in Arabidopsis ovule development Development, September 1, 2007; 134(17): 3099 - 3109. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kieffer, Y. Stern, H. Cook, E. Clerici, C. Maulbetsch, T. Laux, and B. Davies Analysis of the Transcription Factor WUSCHEL and Its Functional Homologue in Antirrhinum Reveals a Potential Mechanism for Their Roles in Meristem Maintenance PLANT CELL, March 1, 2006; 18(3): 560 - 573. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||