|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 2 February 2005
doi: 10.1242/dev.01640
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Pediatrics, Vanderbilt University School of Medicine, Nashville,
TN 37232, USA
2 Department of Cell and Developmental Biology, Vanderbilt University School of
Medicine, Nashville, TN 37232, USA
* Author for correspondence (e-mail: bin.zhou{at}vanderbilt.edu)
Accepted 13 December 2004
 |
SUMMARY |
|---|
TOP
SUMMARY
Introduction
Materials and methods
Results
Discussion
REFERENCES |
|---|
Key words: Mouse, Heart, Endocardium, Nfatc1, Transcription, Enhancer
|
Introduction |
|---|
|
TOP
SUMMARY
Introduction
Materials and methods
Results
Discussion
REFERENCES |
|---|
). During
embryogenesis and in response to local myocardial cues, endocardial cells in
the cardiac outflow tract (OFT) and atrioventricular canal (AVC) undergo an
endocardial-to-mesenchymal transformation (EMT), a morphogenic process
required for cardiac valve formation and chamber septation
(Barnett and Desgrosellier,
2003; Eisenberg and Markwald,
1995; Schroeder et al.,
2003). Despite this, little is known about the molecular
mechanisms that establish this unique pro-valve endocardial subpopulation
during cardiac ontogeny in vivo.
Members of the nuclear factors of activated T cell (Nfat) family, which
mediate transcriptional responses of the Ca2+/calmodulin-dependent
protein phosphatase calcineurin, have been implicated in cardiovascular
development (Bushdid et al.,
2003; Graef et al.,
2001) and cardiac hypertrophy
(Antos et al., 2002;
Molkentin et al., 1998;
Wilkins et al., 2002). Nfatc3
and Nfatc4 are involved in the development of normal myocardium
(Bushdid et al., 2003), and
patterning the vasculature in early mouse embryos
(Graef et al., 2001). Nfatc3
is also required for cardiac hypertrophic response in vivo
(Wilkins et al., 2002). We and
others have studied the function of Nfatc1, in the mouse by genetic
inactivation, and have found that it is required for cardiac valve formation
(de la Pompa et al., 1998;
Ranger et al., 1998).
Consistent with a function in formation of these endocardial-derived
structures, Nfatc1 is exclusively expressed in the endocardium from the
initiation of endocardial differentiation in the primary heart-forming field.
Subsequently, there is accentuation and sustained expression in pro-valve
endocardial cells during EMT and early valve formation followed by rapid
attenuation at the initiation of valve leaflet remodeling
(Chang et al., 2004;
de la Pompa et al., 1998).
Nfatc1 is thus a cell-type-specific transcription factor prevalent in
pro-valve endocardial cells and represents a unique candidate for delineating
the molecular control of endocardial gene transcription during EMT and cardiac
valve development.
In this study, we report the identification and characterization of an autonomous cell-specific transcriptional enhancer for pro-valve endocardial cells. Located in the first intron of the mouse Nfatc1, this 250 bp enhancer sequence contains a cluster of Nfat sites and a single Hox site, which are required for gene expression exclusively in pro-valve endocardial cells of the OFT and AVC during valvulogenesis. We demonstrate that autoregulation of Nfatc1 is essential for maintaining the enhancer activity in pro-valve endocardial cells, while the Hox site is required for suppressing its activity in tissues outside of pro-valve endocardium. Our study suggests that this dual regulation provides a molecular mechanism for restricted and high level expression of Nfatc1 in pro-valve endocardial cells, where Nfatc1 is essential for cardiac valve development.
|
Materials and methods |
|---|
|
TOP
SUMMARY
Introduction
Materials and methods
Results
Discussion
REFERENCES |
|---|
). In vivo
lacZ promoter reporter constructs were based on pWhere (Invivogen).
The promoter reporter construct NX-lacZ consists of a 6.3 kb
NheI-XhoI P1 promoter of the murine Nfatc1
(Zhou et al., 2002), and
XS-lacZ contains a 4.5-kb XhoI-SacII intronic P2 promoter,
starting 76 nucleotides downstream of the 3' end of exon 1 and ending 77
nucleotides into exon 2 (Fig.
2A). The enhancer reporter constructs used a heat-shock protein
minimal promoter, HSP68, which, by itself, does not produce detectable
activity in vivo. The parent enhancer reporter construct,
BB-HSP-lacZ, contained a 4.1 kb BssHII-BssHII
intron 1 fragment, starting 214 nucleotides downstream of the 3' end of
exon 1 and ending 199 nucleotides upstream of the 5' end of exon 2
(Fig. 2A). Serial 5'
deletions of BB-HSP-lacZ were achieved by insertion of PCR-amplified
DNA fragments into the pWhere-HSP vector, yielding an additional seven
constructs, named d1 to d7 (Fig.
4A-C). For mutation constructs, a PCR-based mutagenesis was
performed as described before (Zhou et al., 1998). Individual mutation of core
nucleotides for Gata, or Hox- or Smad-binding sites, was introduced into the
conserved putative cis-enhancing elements in d5 construct. All mutations were
confirmed by sequence analysis.
|
|
ß-Galactosidase detection in whole embryos
Embryos were collected in PBS, fixed in 4% paraformaldehyde, and stained in
X-gal solution overnight at 30°C. The stained embryos were cleared in a
gradient of glycerol and photographed in 100% glycerol with a dissecting
photomicroscope. Whole-mount-stained embryos were then processed for sectional
examination. For sections, stained embryos were post-fixed with 4%
paraformaldehyde, dehydrated in ethanol, cleared in xylene and embedded in
paraffin. Continuous cross-sections of 6 µm thickness were cut,
counterstained with Eosin and mounted in Permount.
Primary endocardial cell cultures
We isolated and established primary embryonic endocardial cell cultures
from E11.5 hearts using a magnet-based antibody affinity protocol
(Marelli-Berg et al., 2000).
Briefly, hearts (without large arteries and surrounding tissues) of E11.5
embryos from 10 pregnant ICR animals were dissected and digested with
collagenase (Sigma). Single cell suspensions in PBS plus 2% FBS were incubated
with anti-Pecam1 and anti-endoglin monoclonal antibodies, and
biotinylated-isolectin B-4. Endocardial cells were then isolated using
magnetic bead-conjugated secondary antibodies and magnetic bead-conjugated
avidin, seeded into one-well of a 24-well plate with irradiated OP9 feeder
cells, and cultured with M199 plus 20% FBS for a week. Confluent cells were
then split into one gelatinized well of a 12-well plate without feeders. Using
this method, we obtained enriched (>80% pure) endocardial cell cultures
determined by their nuclear presence of Nfatc1. These cells express various
endothelial markers including Pecam1/CD31, Tie2, endoglin/CD105 and
VE-cadherin, and maintain their endocardial phenotype and morphology over
10-15 passages (one to four splits per passage).
Electrophoresis mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assays
Preparation of nuclear extracts from primary cultured endocardial cells and
subsequent EMSA were performed as described before
(Zhou et al., 2002). ChIP
assays were carried out using commercially available reagents and protocol
from Upstate (Lake Placid, NY) and monoclonal anti-Nfatc1 specific antibodies
(7A6) according to manufacturer's protocol. The primer sets for PCR
amplification include: 5' ChIP primer (5' GGAGAAAAGCAGCCATTGAAAC
3') and 3' ChIP primer (5' CTGAGTAGGTGCTGGGTGTGAC 3'),
which give a 404 bp DNA product containing two conserved regions with multiple
Nfat sites; and 5' control primer (5' GGCCAGGAGCGACGCGGACGAAG
3') and 3' control primer (5' GAGAAAATGAAAGACAGCAAGATAG
3'), which generate a 426 bp product without consensus Nfat sites.
|
Results |
|---|
|
TOP
SUMMARY
Introduction
Materials and methods
Results
Discussion
REFERENCES |
|---|
and Nfatc1.ß isoforms,
respectively. To investigate the function of the P1 and P2 promoters in the
developing heart, we cloned two DNA fragments, a 6.3 kb
NheI-XhoI P1 promoter region and a 4.5 kb
XhoI-SacII P2 promoter region
(Fig. 1A). Using an RT-PCR
strategy with a set of three isoform-specific primers
(Fig. 1B), we observed the
presence of both isoforms in cultured primary E11.5 endocardial cells.
However, consistent with the previous report that the P1 promoter activity
accounts for over 90% Nfatc1 transcripts in T cells
(Chuvpilo et al., 2002),
Nfatc1. was abundant in the endocardial cells as its transcripts were
easily detected with a 35-cycle of amplification while the transcripts of
Nfatc1.ß regulated by the P2 promoter were barely detected using 40
cycles of amplification. Similar findings were obtained from mRNA isolated
from E11.5 embryonic hearts (data not shown).
|
Finding that the Nfatc1. is the major transcript detected in the
endocardium during embryogenesis but that the P1 promoter and its upstream
sequences were insufficient to drive detectable endocardial expression, we
reasoned that enhancers outside the NheI-XhoI fragment must
contribute to P1 activation. In scanning the mouse Nfatc1 locus for
the putative enhancers, we observed that four out of eight conserved domains
(mouse/human) in the 10.8 kb NheI-SacII fragment were
located within intron 1, proximal to the P2 minimal promoter. Therefore, a 4.1
kb BssHII-BssHII fragment, without the P2 minimal promoter,
was tested for the enhancer activity using the HSP68 promoter, and the
enhancer reporter was named BB-HSP-lacZ
(Fig. 2A). When this construct
was used to produce transgenic embryos, X-gal staining revealed strong
ß-galactosidase activity in the endocardial lumen of atrioventricular
canal (AVC) (arrowhead) and outflow tract (OFT) (arrow) of the heart
(Fig. 2B). Nine out of 10 X-gal
stained transient transgenic embryos exhibited endocardial-specific expression
with no staining in the myocardium or in the endothelium outside the heart
(Fig. 2C).
Further transient transgenic analysis indicated that this endocardial-enhancer activity was detectable at E9.5 by whole-mount X-gal staining (Fig. 3A), highlighting the lumen of AVC (arrowhead), and marking the proximal OFT (the broken line indicates the border of the distal and the proximal OFT). Sectioning of the whole-mount-stained E10.5 embryos confirmed the endocardial specificity of this enhancer (Fig. 3B). Importantly, the enhancer was only activated in the pro-valve endocardial cells that overlie the forming endocardial cushions in the AVC (arrowhead) and the proximal OFT (arrow). The enhancer activity was not found in those transformed endocardial cells that were invading the extracellular matrix-rich endocardial cushions. By E11.5 (Fig. 3C), the endocardial activity of the enhancer was persistent in the AVC (arrowhead) and extended from the proximal to distal part of the OFT (arrow), but was continuously inactivated in the mesenchymal cushion cells derived from transformed endocardial cells.
|
A 781 bp sequence in the P2 regulatory region is required for the endocardial-specific gene expression in the developing heart
Comparative sequence analysis of the first intron of the mouse and the
human revealed that, in addition to the conservation of the proximal (core) P2
promoter region, there were two distal highly conserved regions located in the
4.1-kb BssHII-BssHII intron 1 fragment
(Fig. 5A). Furthermore, a 211
bp pyrimidine-rich stretch and 10 copies of a CTTTT repeat were found in this
intron fragment. Using PCR cloning, nucleotide sequences in this P2 fragment
essential for endocardial-specific expression were determined by systematic
and sequential removal of these unique sequences to produce deletions of the
BB-HSP-lacZ reporter construct, named d1-d7
(Fig. 5A). Analysis of this
series of deletion constructs by transient mouse transgenesis and whole-mount
staining of E11.5 embryos demonstrated that constructs d1-d5 were able to
confer endocardial-specific expression identical to that of the parent
BB-HSP-lacZ reporter (Fig.
5B). Thus, the d5 deletion construct containing a 1.5 kb 3'
end sequence of intron 1 is sufficient for the endocardial-specific
expression. Removal of 781 bp sequence between the 200 bp conserved region and
CTTTT repeats completely abolished this endocardial-specific activity,
indicating the d6 sequence with the CTTTT-repeats alone is insufficient for
the endocardial gene expression. The endocardial specificity of the d5
construct was verified by cross-sectional examination of the
whole-mount-stained embryos (Fig.
5C). At the single cell level of resolution, the expression of
lacZ is exclusively restricted to the endocardial cells in the OFT
(arrow) and AVC (arrowhead). ß-Galactosidase activity is extinguished in
those cells that have undergone mesenchymal transformation and invaded the
matrix-rich cushions, and no ß-galactosidase activity was found in the
endothelial cells outside of the heart. These data clearly demonstrated that a
crucial enhancer sequence for the pro-valve endocardial cells is located
within the 781 bp region.
|
-HSP-lacZ) was generated by PCR cloning to
remove 250 bp of 5' end sequence that contained two short conserved
domains, ECE1 and ECE2, harboring a cluster of putative transcriptional
binding sites (Fig. 6A). The
pro-valve endocardial enhancer activity of these constructs was then evaluated
in transient transgenic analysis. Whole-mount-stained E11.5 embryos
(Fig. 6C,D) and hearts
(Fig. 6E,F) with the
ECE-HSP-lacZ construct demonstrated the expression of lacZ
reporter at the lumen of both OFT (Fig.
6, arrowhead) and AVC (Fig.
6, arrow) region. Thus, the 781 bp ECE was sufficient for
pro-valve endocardial-specific expression, and functioned as an autonomous
tissue-specific enhancer. Deletion of the 250 bp sequence containing ECE1 and
ECE2 completely abolished activity (data not shown), indicating that a crucial
cis-enhancer element(s) is contained in this 250 bp sequence.
|
;
Zhou et al., 2002). We
therefore crossed the BB-HSP-lacZ transgenic reporter line into the
previously described Nfatc1-null mutant mouse line
(Ranger et al., 1998). We
found that, in both whole-mount E11.5 embryos and cross-sections
(Fig. 7), there was a
consistent reduction or absence of endocardial gene expression in both OFT
(arrow) and AVC (arrowhead) of Nfatc1-null embryos
(Fig. 7D-F) compared with their
heterozygous littermates (Fig.
7A-C).
|
, N21, N22 and N3
(Fig. 8B). EMSA showed that
protein-DNA binding complexes formed using N1 or N2
(Fig. 8C, arrow) but not N3
probe (data not shown). Importantly, mutation of any Nfat site in N1 or N2
greatly abolished formation of Nfatc1-DNA complexes, suggesting that these
Nfat sites are functional in situ. We then performed ChIP assays with
chromatin prepared from cultured wild-type or Nfatc1-null endocardial cells in
which the Rel-homology DNA-binding domain has been deleted
(Ranger et al., 1998). A set
of primers (Fig. 8B, arrow)
encompassing ECE1 and ECE2 were used to amplify chromatin pulled down by the
anti-Nfatc1-specific monoclonal antibody 7A6. The results demonstrate that
Nfatc1 binds to this DNA fragment in situ
(Fig. 8D), whereas controls
using either no antibody or chromatin from Nfatc1-null endocardial cells
showed no product after PCR amplification. In addition, irrelevant primers
that flank a non-Nfat site fragment DNA did not produce a PCR product (data
not shown). Together, these data suggest that Nfatc1 expression is
autoregulated during valve formation by interaction of Nfatc1 and the 250 bp
Nfat site-rich region.
|
|
|
Discussion |
|---|
|
TOP
SUMMARY
Introduction
Materials and methods
Results
Discussion
REFERENCES |
|---|
It has been shown that mesenchymal cushion formation results at least
partially from EMT within the heart tube as a consequence of interaction
between both localized myocardial cues and adjacent endocardial responsiveness
(Eisenberg and Markwald, 1995;
Markwald et al., 1996).
Tgfß/Bmp signaling pathways appear to modulate this
myocardial-endocardial interaction in both the avian and mouse embryos
(Boyer et al., 1999;
Brown et al., 1999). Yet, the
transcriptional circuitry that governs the phenotypic changes of these
specialized endocardial cells during EMT and later valvulogenesis has not been
extensively studied. The enhancer described in our studies could function as a
`genetic switch' that turns on and later turns off Nfatc1 expression in
response to signals elicited, presumably, from myocardium of the endocardial
cushions. Identification of this endocardial enhancer thus provides a novel
genetic marker for the unique pro-valve endocardial cells. It may also serve
as a genetic readout for the inducible myocardial cues allowing the nature of
such signals to be deduced.
Scanning of the 250 bp necessary endocardial enhancer sequence reveals
binding sites for several transcription factors, including Smad, Gata and
Nfat, which mediate signals known to be involved in regulating EMT and/or
later valve formation. We and others have shown an autoregulation of Nfatc1
expression in T cells in the adult animal through the Nfat sites in its P1
promoter (Chuvpilo et al.,
2002; Zhou et al.,
2002). The sustained high expression of nuclear activated Nfatc1
in endocardium during cardiac valve formation suggests that a similar
autoregulatory paradigm may also operate for Nfatc1 expression in the
developing endocardium. Consistent with this notion, there are five consensus
Nfat sites located in the 250 bp sequence necessary for the endocardial
enhancer activity in vivo, and four of them are nested in the two conserved
ECEs. We demonstrated, using a genetic approach, that Nfatc1 expression is
required for maintaining the activity of the endocardial enhancer. We also
determined, using EMSA and ChIP assays, that this Nfatc1-dependent enhancer
activity is probably the direct result of interaction of Nfatc1 with one or
more Nfat sites in the 250 bp sequence.
Tgfß/Bmp-Smad pathways play a prominent role during EMT. Both in vitro
and in vivo studies have indicated that ligands of Tgfß/Bmp receptors are
strong inducers or positive regulators of EMT, and are essential for later
morphogenesis of cardiac valves. However, the nuclear events or targets of
Tgf/Bmp activation in the endocardial cells are not fully characterized.
Recently, Gata transcription factors have emerged as another cohort of
important regulators of EMT. Disruption of Gata4 interaction with its
co-factor, Fog2, by a `knock-in' mutation (Gata4KI/KI)
(Crispino et al., 2001) or
endothelial-specific deletion of Gata co-factor, Fog1, result in both OFT and
AVC defects (Katz et al.,
2003). Furthermore, in vitro data suggest that an interaction
between Gata5 and Nfatc1 may be important for endocardial cell differentiation
(Nemer and Nemer, 2002). In
our study, we found that binding sites of Gata and Smad factors in the
conserved enhancer region are not essential for the specificity of the
enhancer, although we could not rule out their effect on the level of enhancer
activity.
By contrast, the Hox site was found to be required for maintaining the
specificity of the enhancer by suppressing its activity outside the pro-valve
endocardial cells. Thus, the intact Hox-binding site represents a negative
cis-element where its interaction with its binding factors in non pro-valve
endocardial tissues is probably required for limiting Nfatc1 expression
outside of the pro-valve endocardial cells. Hox factors consist of a large
number of homeobox transcription proteins and the binding site for these
factors is relatively diversified, and thus less defined when compared with
the Nfat site. We do not know which Hox factor plays a role in suppression of
the enhancer activity outside the pro-valve endocardial cells, such as
endocardial cells of ventricular trabeculae and transformed endocardial cells.
In the developing heart, Msx1, previously known as Hox7, is expressed in the
developing endocardium (Lyons et al.,
1992; Robert et al.,
1989), while a closely related gene, Msx2, is highly expressed in
the cushion cells that are transformed from endocardial cells
(Abdelwahid et al., 2001). In
addition, other homeobox genes, iroquois 5 and iroquois 6, are only expressed
in the E11.5 endocardial cells lining the trabeculated myocardium
(Christoffels et al., 2000).
Whether any or all of these factors are upstream regulators of this enhancer
is currently under investigation.
In summary, mesenchymalization of the endocardial cushions by EMT, and the later remodeling of the cushions into the mature valves and septa are crucial morphogenic processes susceptible to environment and genetic alterations that result in common congenital heart diseases. These processes must require the coordinated regulation of several signaling pathways. Our data provide initial in vivo identification and characterization of a crucial enhancer required for cell-specific autoregulation of Nfatc1 expression in the pro-valve endocardial cells as well as suppression of its expression in those non-valve endocardial cells. This work should facilitate further delineation of how multiple signals are integrated at the transcriptional level to orchestrate valvulogenesis and should provide valuable in vivo models to specifically investigate gene function in pro-valve endocardium required for normal cardiac valve formation.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
Introduction
Materials and methods
Results
Discussion
REFERENCES |
|---|
Abdelwahid, E., Rice, D., Pelliniemi, L. J. and Jokinen, E.
(2001). Overlapping and differential localization of Bmp-2,
Bmp-4, Msx-2 and apoptosis in the endocardial cushion and adjacent tissues of
the developing mouse heart. Cell Tissue Res.
305, 67-78.[CrossRef][Medline]
Antos, C. L., McKinsey, T. A., Frey, N., Kutschke, W., McAnally,
J., Shelton, J. M., Richardson, J. A., Hill, J. A. and Olson, E. N.
(2002). Activated glycogen synthase-3 beta suppresses cardiac
hypertrophy in vivo. Proc. Natl. Acad. Sci. USA
99,907
-912.
Barnett, J. V. and Desgrosellier, J. S. (2003).
Early events in valvulogenesis: a signaling perspective. Birth
Defects Research. Part C, Embryo Today: Reviews
69, 58-72.
Boyer, A. S., Ayerinskas, II, Vincent, E. B., McKinney, L. A.,
Weeks, D. L. and Runyan, R. B. (1999). TGFbeta2 and TGFbeta3
have separate and sequential activities during epithelial-mesenchymal cell
transformation in the embryonic heart. Dev. Biol.
208,530
-545.[CrossRef][Medline]
Brown, C. B., Boyer, A. S., Runyan, R. B. and Barnett, J. V.
(1999). Requirement of type III TGF-beta receptor for endocardial
cell transformation in the heart. Science
283,2080
-2082.
Bushdid, P. B., Osinska, H., Waclaw, R. R., Molkentin, J. D. and
Yutzey, K. E. (2003). NFATc3 and NFATc4 are required for
cardiac development and mitochondrial function. Circ.
Res. 92,1305
-1313.
Chang, C. P., Neilson, J. R., Bayle, J. H., Gestwicki, J. E.,
Kuo, A., Stankunas, K., Graef, I. A. and Crabtree, G. R.
(2004). A field of myocardial-endocardial NFAT signaling
underlies heart valve morphogenesis. Cell
118,649
-663.[CrossRef][Medline]
Christoffels, V. M., Keijser, A. G., Houweling, A. C., Clout, D.
E. and Moorman, A. F. (2000). Patterning the embryonic heart:
identification of five mouse Iroquois homeobox genes in the developing heart.
Dev. Biol. 224,263
-274.[CrossRef][Medline]
Chuvpilo, S., Jankevics, E., Tyrsin, D., Akimzhanov, A., Moroz,
D., Jha, M. K., Schulze-Luehrmann, J., Santner-Nanan, B., Feoktistova, E.,
Konig, T. et al. (2002). Autoregulation of NFATc1/A
expression facilitates effector T cells to escape from rapid apoptosis.
Immunity 16,881
-895.[CrossRef][Medline]
Crispino, J. D., Lodish, M. B., Thurberg, B. L., Litovsky, S.
H., Collins, T., Molkentin, J. D. and Orkin, S. H. (2001).
Proper coronary vascular development and heart morphogenesis depend on
interaction of GATA-4 with FOG cofactors. Genes Dev.
15,839
-844.
de la Pompa, J. L., Timmerman, L. A., Takimoto, H., Yoshida, H.,
Elia, A. J., Samper, E., Potter, J., Wakeham, A., Marengere, L., Langille, B.
L. et al. (1998). Role of the NF-ATc transcription factor in
morphogenesis of cardiac valves and septum. Nature
392,182
-186.[CrossRef][Medline]
Eisenberg, L. M. and Markwald, R. R. (1995).
Molecular regulation of atrioventricular valvuloseptal morphogenesis.
Circ. Res. 77,1
-6.
Graef, I. A., Chen, F., Chen, L., Kuo, A. and Crabtree, G.
R. (2001). Signals transduced by Ca(2+)/calcineurin and
NFATc3/c4 pattern the developing vasculature. Cell
105,863
-875.[CrossRef][Medline]
Katz, S. G., Williams, A., Yang, J., Fujiwara, Y., Tsang, A. P.,
Epstein, J. A. and Orkin, S. H. (2003). Endothelial
lineage-mediated loss of the GATA cofactor Friend of GATA 1 impairs cardiac
development. Proc. Natl. Acad. Sci. USA
100,14030
-14035.
Lyons, G. E., Houzelstein, D., Sassoon, D., Robert, B. and
Buckingham, M. E. (1992). Multiple sites of Hox-7 expression
during mouse embryogenesis: comparison with retinoic acid receptor mRNA
localization. Mol. Reprod. Dev.
32,303
-314.[CrossRef][Medline]
Marelli-Berg, F. M., Peek, E., Lidington, E. A., Stauss, H. J.
and Lechler, R. I. (2000). Isolation of endothelial cells
from murine tissue. J. Immunol. Methods
244,205
-215.[CrossRef][Medline]
Markwald, R., Eisenberg, C., Eisenberg, L., Trusk, T. and Sugi,
Y. (1996). Epithelial-mesenchymal transformations in early
avian heart development. Acta Anat.
156,173
-186.[Medline]
Molkentin, J. D., Lu, J. R., Antos, C. L., Markham, B.,
Richardson, J., Robbins, J., Grant, S. R. and Olson, E. N.
(1998). A calcineurin-dependent transcriptional pathway for
cardiac hypertrophy. Cell
93,215
-228.[CrossRef][Medline]
Nemer, G. and Nemer, M. (2002). Cooperative
interaction between GATA5 and NF-ATc regulates endothelial-endocardial
differentiation of cardiogenic cells. Development
129,4045
-4055.
Ranger, A. M., Grusby, M. J., Hodge, M. R., Gravallese, E. M.,
de la Brousse, F. C., Hoey, T., Mickanin, C., Baldwin, H. S. and Glimcher, L.
H. (1998). The transcription factor NF-ATc is essential for
cardiac valve formation. Nature
392,186
-190.[CrossRef][Medline]
Robert, B., Sassoon, D., Jacq, B., Gehring, W. and Buckingham,
M. (1989). Hox-7, a mouse homeobox gene with a novel pattern
of expression during embryogenesis. EMBO J.
8, 91-100.[Medline]
Schroeder, J. A., Jackson, L. F., Lee, D. C. and Camenisch, T.
D. (2003). Form and function of developing heart valves:
coordination by extracellular matrix and growth factor signaling.
J. Mol. Med. 81,392
-403.[CrossRef][Medline]
Wilkins, B. J., de Windt, L. J., Bueno, O. F., Braz, J. C.,
Glascock, B. J., Kimball, T. F. and Molkentin, J. D. (2002).
Targeted disruption of NFATc3, but not NFATc4, reveals an intrinsic defect in
calcineurin-mediated cardiac hypertrophic growth. Mol. Cell.
Biol. 22,7603
-7613.
Wunsch, A. M., Little, C. D. and Markwald, R. R.
(1994). Cardiac endothelial heterogeneity defines valvular
development as demonstrated by the diverse expression of JB3, an antigen of
the endocardial cushion tissue. Dev. Biol.
165,585
-601.[CrossRef][Medline]
Zhou, B., Cron, R. Q., Wu, B., Genin, A., Wang, Z., Liu, S.,
Robson, P. and Baldwin, H. S. (2002). Regulation of the
murine Nfatc1 gene by NFATc2. J. Biol. Chem.
277,10704
-10711.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  T. R. Torgerson, A. Genin, C. Chen, M. Zhang, B. Zhou, S. Anover-Sombke, M. B. Frank, I. Dozmorov, E. Ocheltree, P. Kulmala, et al. FOXP3 Inhibits Activation-Induced NFAT2 Expression in T Cells Thereby Limiting Effector Cytokine Expression J. Immunol., July 15, 2009; 183(2): 907 - 915. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Langworthy, B. Zhou, M. de Caestecker, G. Moeckel, and H. S. Baldwin NFATc1 Identifies a Population of Proximal Tubule Cell Progenitors J. Am. Soc. Nephrol., February 1, 2009; 20(2): 311 - 321. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Snider, R. B. Hinton, R. A. Moreno-Rodriguez, J. Wang, R. Rogers, A. Lindsley, F. Li, D. A. Ingram, D. Menick, L. Field, et al. Periostin Is Required for Maturation and Extracellular Matrix Stabilization of Noncardiomyocyte Lineages of the Heart Circ. Res., April 11, 2008; 102(7): 752 - 760. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Wu, S.-c. Kao, T. Barrientos, S. H. Baldwin, E. N. Olson, G. R. Crabtree, B. Zhou, and C.-P. Chang Down Syndrome Critical Region-1 Is a Transcriptional Target of Nuclear Factor of Activated T Cells-c1 within the Endocardium during Heart Development J. Biol. Chem., October 19, 2007; 282(42): 30673 - 30679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Song, W. Yan, X. Chen, C.-x. Deng, Q. Wang, and K. Jiao Myocardial Smad4 Is Essential for Cardiogenesis in Mouse Embryos Circ. Res., August 3, 2007; 101(3): 277 - 285. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Khandekar, W. Brandt, Y. Zhou, S. Dagenais, T. W. Glover, N. Suzuki, R. Shimizu, M. Yamamoto, K.-C. Lim, and J. D. Engel A Gata2 intronic enhancer confers its pan-endothelia-specific regulation Development, May 1, 2007; 134(9): 1703 - 1712. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zubair, S. Ishihara, S. Oka, K. Okumura, and K.-i. Morohashi Two-Step Regulation of Ad4BP/SF-1 Gene Transcription during Fetal Adrenal Development: Initiation by a Hox-Pbx1-Prep1 Complex and Maintenance via Autoregulation by Ad4BP/SF-1. Mol. Cell. Biol., June 1, 2006; 26(11): 4111 - 4121. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Beis, T. Bartman, S.-W. Jin, I. C. Scott, L. A. D'Amico, E. A. Ober, H. Verkade, J. Frantsve, H. A. Field, A. Wehman, et al. Genetic and cellular analyses of zebrafish atrioventricular cushion and valve development Development, September 15, 2005; 132(18): 4193 - 4204. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
