spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 2 February 2005
doi: 10.1242/dev.01640


Development 132, 1137-1146 (2005)
Published by The Company of Biologists 2005


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01640v1
132/5/1137    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, B.
Right arrow Articles by Baldwin, H. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, B.
Right arrow Articles by Baldwin, H. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Characterization of Nfatc1 regulation identifies an enhancer required for gene expression that is specific to pro-valve endocardial cells in the developing heart

Bin Zhou1,*, Bingruo Wu1, Kevin L. Tompkins1, Kathleen L. Boyer1, Justin C. Grindley1 and H. Scott Baldwin1,2

1 Department of Pediatrics, Vanderbilt University School of Medicine, Nashville, TN 37232, USA
2 Department of Cell and Developmental Biology, Vanderbilt University School of Medicine, Nashville, TN 37232, USA

* Author for correspondence (e-mail: bin.zhou{at}vanderbilt.edu)

Accepted 13 December 2004


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Nfatc1 is an endocardial transcription factor required for development of cardiac valves. Herein, we describe identification and characterization of a tissue-specific enhancer in the first intron of murine Nfatc1 that activates a heterogenic promoter and directs gene expression in a subpopulation of endocardial cells of the developing heart: the pro-valve endocardial cells. This enhancer activity begins on embryonic day (E) 8.5 in endocardial cells at the ventricular end of the atrioventricular canal, intensifies and extends from E9.5 to E11.5 in endocardium along the atrioventricular canal and outflow tract. By E12.5, the enhancer activity is accentuated in endocardial cells of forming valves. Sequential deletion analysis identified that a 250 bp DNA fragment at the 3' end of the intron 1 is required for endocardial-specific activity. This region contains two short conserved sequences hosting a cluster of binding sites for transcription factors, including Nfat and Hox proteins. Electrophoresis mobility shift and chromatin immunoprecipitation assays demonstrated binding of Nfatc1 to the Nfat sites, and inactivation of Nfatc1 downregulated the enhancer activity in pro-valve endocardial cells. By contrast, mutation of the Hox site abolished its specificity, allowing gene expression in non pro-valve endocardium and extracardiac vasculature. Thus, autoregulation of Nfatc1 is required for maintaining high Nfatc1 expression in pro-valve endocardial cells, while suppression through the Hox site prevents its expression outside pro-valve endocardial cells during valve development. Our data demonstrate the first autonomous cell-specific enhancer for pro-valve endocardial cells and delineate a unique transcriptional mechanism that regulates endocardial Nfatc1 expression within developing cardiac valves.

Key words: Mouse, Heart, Endocardium, Nfatc1, Transcription, Enhancer


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Previous studies suggest that pro-valve endocardial cells (endocardial cells lining of developing cardiac valve) are a unique subpopulation of endocardial cells with a distinct developmental potential (Wunsch et al., 1994Go). During embryogenesis and in response to local myocardial cues, endocardial cells in the cardiac outflow tract (OFT) and atrioventricular canal (AVC) undergo an endocardial-to-mesenchymal transformation (EMT), a morphogenic process required for cardiac valve formation and chamber septation (Barnett and Desgrosellier, 2003Go; Eisenberg and Markwald, 1995Go; Schroeder et al., 2003Go). Despite this, little is known about the molecular mechanisms that establish this unique pro-valve endocardial subpopulation during cardiac ontogeny in vivo.

Members of the nuclear factors of activated T cell (Nfat) family, which mediate transcriptional responses of the Ca2+/calmodulin-dependent protein phosphatase calcineurin, have been implicated in cardiovascular development (Bushdid et al., 2003Go; Graef et al., 2001Go) and cardiac hypertrophy (Antos et al., 2002Go; Molkentin et al., 1998Go; Wilkins et al., 2002Go). Nfatc3 and Nfatc4 are involved in the development of normal myocardium (Bushdid et al., 2003Go), and patterning the vasculature in early mouse embryos (Graef et al., 2001Go). Nfatc3 is also required for cardiac hypertrophic response in vivo (Wilkins et al., 2002Go). We and others have studied the function of Nfatc1, in the mouse by genetic inactivation, and have found that it is required for cardiac valve formation (de la Pompa et al., 1998Go; Ranger et al., 1998Go). Consistent with a function in formation of these endocardial-derived structures, Nfatc1 is exclusively expressed in the endocardium from the initiation of endocardial differentiation in the primary heart-forming field. Subsequently, there is accentuation and sustained expression in pro-valve endocardial cells during EMT and early valve formation followed by rapid attenuation at the initiation of valve leaflet remodeling (Chang et al., 2004Go; de la Pompa et al., 1998Go). Nfatc1 is thus a cell-type-specific transcription factor prevalent in pro-valve endocardial cells and represents a unique candidate for delineating the molecular control of endocardial gene transcription during EMT and cardiac valve development.

In this study, we report the identification and characterization of an autonomous cell-specific transcriptional enhancer for pro-valve endocardial cells. Located in the first intron of the mouse Nfatc1, this 250 bp enhancer sequence contains a cluster of Nfat sites and a single Hox site, which are required for gene expression exclusively in pro-valve endocardial cells of the OFT and AVC during valvulogenesis. We demonstrate that autoregulation of Nfatc1 is essential for maintaining the enhancer activity in pro-valve endocardial cells, while the Hox site is required for suppressing its activity in tissues outside of pro-valve endocardium. Our study suggests that this dual regulation provides a molecular mechanism for restricted and high level expression of Nfatc1 in pro-valve endocardial cells, where Nfatc1 is essential for cardiac valve development.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Transgenic reporter constructs
The mouse bacterial artificial chromosome (BAC) clone containing the murine Nfatc1 was isolated from a 129/SvJ BAC library (Zhou et al., 2002Go). In vivo lacZ promoter reporter constructs were based on pWhere (Invivogen). The promoter reporter construct NX-lacZ consists of a 6.3 kb NheI-XhoI P1 promoter of the murine Nfatc1 (Zhou et al., 2002Go), and XS-lacZ contains a 4.5-kb XhoI-SacII intronic P2 promoter, starting 76 nucleotides downstream of the 3' end of exon 1 and ending 77 nucleotides into exon 2 (Fig. 2A). The enhancer reporter constructs used a heat-shock protein minimal promoter, HSP68, which, by itself, does not produce detectable activity in vivo. The parent enhancer reporter construct, BB-HSP-lacZ, contained a 4.1 kb BssHII-BssHII intron 1 fragment, starting 214 nucleotides downstream of the 3' end of exon 1 and ending 199 nucleotides upstream of the 5' end of exon 2 (Fig. 2A). Serial 5' deletions of BB-HSP-lacZ were achieved by insertion of PCR-amplified DNA fragments into the pWhere-HSP vector, yielding an additional seven constructs, named d1 to d7 (Fig. 4A-C). For mutation constructs, a PCR-based mutagenesis was performed as described before (Zhou et al., 1998). Individual mutation of core nucleotides for Gata, or Hox- or Smad-binding sites, was introduced into the conserved putative cis-enhancing elements in d5 construct. All mutations were confirmed by sequence analysis.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2. (A) Schematic diagram of the Nfatc1 promoter/enhancer reporter constructs. (B) Transient transgenic embryos following X-gal staining documents that the 6.2-kb NheI-XhoI P1 promoter-reporter (NX-lacZ) does not produce endocardial gene expression at E11.5. However, the BB-HSP-lacZ enhancer-reporter, containing 4.1 kb BssHII-BssHII fragment of the P2 (intron 1) regulatory region, linked to the HSP68 minimal promoter, is able to drive expression specifically in the endocardial lumen of the atrioventricular canal (AVC) and in the conal (c) and truncal (t) regions of the developing outflow tract. No expression is detected in the atrium (a) or ventricle (v) or in the extracardiac vasculature. (C) Table summaries this group of transgenic experiments. TG, transgenic embryos; ECS, endocardial-specific expression; ET, ectopic expression.

 



View larger version (109K):
[in this window]
[in a new window]
 
Fig. 4. Analysis of ß-galactosidase activity in embryos from four independent stable transgenic lines shows consistent pro-valve endocardial enhancer activity of the 4.1 kb BssHII-BssHII P2 fragment in whole-mount-stained E8.5 to E12.5 embryos (A-E). X-gal staining is restricted to the endocardial cells in AVC (arrow) and OFT (arrowhead), especially intensified at later stages in the regions of forming valves and septa. (F-J) Sectioning of stained E8.5, E9.5, E12.5 and E14.5 embryos highlights this enhancer activity for the pro-valve endocardial cells of the forming valves. ao, aorta; av, aortic valve; pt, pulmonary trunk; pv, pulmonary valve; la, left atrium; ra, right atrium; lv, left ventricle; rv, right ventricle; mv, mitral valve; tv, tricuspid valve.

 
Transgenic mice
Transgenic fragments were separated from the plasmid vector by electrophoresis of PacI-digested plasmid and purified using Qiaex II (Quiagen). The purified DNA fragments were dissolved in the injection buffer (10 mM Tris HCl, pH 7.5 and 0.1 mM EDTA) at a concentration of 2.5 µg/ml. DNA was then injected into the pronucleus of 0.5-day-old fertilized C57BL/6 eggs and the eggs were transferred into the oviducts of ICR pseudo-pregnant foster females. Embryos were harvested, stained with X-gal to detect ß-galactosidase activity and yolk sacs were processed for PCR genotyping. Transgenic lines were established by breeding B6D2F1 mice with PCR-positive founders, and embryos were harvested at embryonic day (E) E8.5 to 14.5.

ß-Galactosidase detection in whole embryos
Embryos were collected in PBS, fixed in 4% paraformaldehyde, and stained in X-gal solution overnight at 30°C. The stained embryos were cleared in a gradient of glycerol and photographed in 100% glycerol with a dissecting photomicroscope. Whole-mount-stained embryos were then processed for sectional examination. For sections, stained embryos were post-fixed with 4% paraformaldehyde, dehydrated in ethanol, cleared in xylene and embedded in paraffin. Continuous cross-sections of 6 µm thickness were cut, counterstained with Eosin and mounted in Permount.

Primary endocardial cell cultures
We isolated and established primary embryonic endocardial cell cultures from E11.5 hearts using a magnet-based antibody affinity protocol (Marelli-Berg et al., 2000Go). Briefly, hearts (without large arteries and surrounding tissues) of E11.5 embryos from 10 pregnant ICR animals were dissected and digested with collagenase (Sigma). Single cell suspensions in PBS plus 2% FBS were incubated with anti-Pecam1 and anti-endoglin monoclonal antibodies, and biotinylated-isolectin B-4. Endocardial cells were then isolated using magnetic bead-conjugated secondary antibodies and magnetic bead-conjugated avidin, seeded into one-well of a 24-well plate with irradiated OP9 feeder cells, and cultured with M199 plus 20% FBS for a week. Confluent cells were then split into one gelatinized well of a 12-well plate without feeders. Using this method, we obtained enriched (>80% pure) endocardial cell cultures determined by their nuclear presence of Nfatc1. These cells express various endothelial markers including Pecam1/CD31, Tie2, endoglin/CD105 and VE-cadherin, and maintain their endocardial phenotype and morphology over 10-15 passages (one to four splits per passage).

Electrophoresis mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assays
Preparation of nuclear extracts from primary cultured endocardial cells and subsequent EMSA were performed as described before (Zhou et al., 2002Go). ChIP assays were carried out using commercially available reagents and protocol from Upstate (Lake Placid, NY) and monoclonal anti-Nfatc1 specific antibodies (7A6) according to manufacturer's protocol. The primer sets for PCR amplification include: 5' ChIP primer (5' GGAGAAAAGCAGCCATTGAAAC 3') and 3' ChIP primer (5' CTGAGTAGGTGCTGGGTGTGAC 3'), which give a 404 bp DNA product containing two conserved regions with multiple Nfat sites; and 5' control primer (5' GGCCAGGAGCGACGCGGACGAAG 3') and 3' control primer (5' GAGAAAATGAAAGACAGCAAGATAG 3'), which generate a 426 bp product without consensus Nfat sites.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
P1 promoter of Nfatc1 is activated in endocardial cells of the developing heart
Two Nfatc1 promoters, P1 and P2, have been described, which in the mouse T cells direct the synthesis of Nfatc1.{alpha} and Nfatc1.ß isoforms, respectively. To investigate the function of the P1 and P2 promoters in the developing heart, we cloned two DNA fragments, a 6.3 kb NheI-XhoI P1 promoter region and a 4.5 kb XhoI-SacII P2 promoter region (Fig. 1A). Using an RT-PCR strategy with a set of three isoform-specific primers (Fig. 1B), we observed the presence of both isoforms in cultured primary E11.5 endocardial cells. However, consistent with the previous report that the P1 promoter activity accounts for over 90% Nfatc1 transcripts in T cells (Chuvpilo et al., 2002Go), Nfatc1.{alpha} was abundant in the endocardial cells as its transcripts were easily detected with a 35-cycle of amplification while the transcripts of Nfatc1.ß regulated by the P2 promoter were barely detected using 40 cycles of amplification. Similar findings were obtained from mRNA isolated from E11.5 embryonic hearts (data not shown).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. (A) Structure of the 5' regulatory region of mouse Nfatc1, which contains two independent promoters, P1 and P2, for transcription of Nfatc1.{alpha} and Nfatc1.ß isoforms, respectively. (B) RT-PCR analysis using exon (isoform)-specific primers showing that the Nfatc1.{alpha} isoform is abundant in the cultured primary E11.5 endocardial cells (ECC) and its transcripts is detected by a 35-cycle amplification, whereas the Nfatc1.ß isoform is detected only after a 40-cycle amplification. The structures of the isoforms are shown on the left.

 
The first intron of the murine Nfatc1 directs endocardial-specific gene expression during heart development
We next examined whether the 6.3-kb NheI-XhoI P1 promoter contains the essential regulatory elements required for endocardial-specific expression in vivo (Fig. 2A). Although the 6.3-kb NheI-XhoI P1 promoter was able to drive accentuated endothelial-specific gene expression in vitro (data not shown), our transient transgenic analysis in mouse demonstrated that the NX-lacZ reporter with the 6.3-kb NheI-XhoI P1 promoter was unable to confer detectable endocardial expression in vivo (Fig. 2B). We also examined the 4.5 kb XhoI-SacII P2 promoter in transient transgenic experiments (Fig. 2A). Consistent with the RT-PCR results (Fig. 1C), which indicated that the P2 region is at best a weak promoter, the XS-lacZ reporter with the 4.5 kb XhoI-SacII P2 promoter failed to drive endocardial gene expression (data not shown).

Finding that the Nfatc1.{alpha} is the major transcript detected in the endocardium during embryogenesis but that the P1 promoter and its upstream sequences were insufficient to drive detectable endocardial expression, we reasoned that enhancers outside the NheI-XhoI fragment must contribute to P1 activation. In scanning the mouse Nfatc1 locus for the putative enhancers, we observed that four out of eight conserved domains (mouse/human) in the 10.8 kb NheI-SacII fragment were located within intron 1, proximal to the P2 minimal promoter. Therefore, a 4.1 kb BssHII-BssHII fragment, without the P2 minimal promoter, was tested for the enhancer activity using the HSP68 promoter, and the enhancer reporter was named BB-HSP-lacZ (Fig. 2A). When this construct was used to produce transgenic embryos, X-gal staining revealed strong ß-galactosidase activity in the endocardial lumen of atrioventricular canal (AVC) (arrowhead) and outflow tract (OFT) (arrow) of the heart (Fig. 2B). Nine out of 10 X-gal stained transient transgenic embryos exhibited endocardial-specific expression with no staining in the myocardium or in the endothelium outside the heart (Fig. 2C).

Further transient transgenic analysis indicated that this endocardial-enhancer activity was detectable at E9.5 by whole-mount X-gal staining (Fig. 3A), highlighting the lumen of AVC (arrowhead), and marking the proximal OFT (the broken line indicates the border of the distal and the proximal OFT). Sectioning of the whole-mount-stained E10.5 embryos confirmed the endocardial specificity of this enhancer (Fig. 3B). Importantly, the enhancer was only activated in the pro-valve endocardial cells that overlie the forming endocardial cushions in the AVC (arrowhead) and the proximal OFT (arrow). The enhancer activity was not found in those transformed endocardial cells that were invading the extracellular matrix-rich endocardial cushions. By E11.5 (Fig. 3C), the endocardial activity of the enhancer was persistent in the AVC (arrowhead) and extended from the proximal to distal part of the OFT (arrow), but was continuously inactivated in the mesenchymal cushion cells derived from transformed endocardial cells.



View larger version (102K):
[in this window]
[in a new window]
 
Fig. 3. X-gal staining in transient transgenic embryos shows endocardial-specific enhancer activity of the 4.1 kb BssHII-BssHII P2 fragment in whole-mount E9.5 embryos (A) and sections of whole-mount-stained E10.5 (B) and E11.5 (C) embryos. ß-Galactosidase activity is restricted to the pro-valve endocardial cells in AVC (arrowhead) and OFT (arrow). The enhancer is not activated in the mesenchymal cells derived from transformed endocardial cells in the AVC and OFT endocardial cushions. Top row, OFT; bottom row, AVC. a, atrium; c, conus; t, truncus; v, ventricle.

 
To confirm the finding of transient transgenic analysis and to study in detail the temporal and spatial activity of this endocardial-enhancer, four independent transgenic mouse lines were established with the BB-HSP-lacZ reporter construct. Fig. 4 shows representative findings of endocardial enhancer reporter activity during cardiogenesis. Expression was first detectable at E8.5 (Fig. 4A), where lacZ expression was observed in few isolated cells located at the ventricular entrance of the AVC (arrowheads). By E9.5 (Fig. 4B), well-defined endocardial-specific expression of lacZ was seen in the AVC of whole-mount-stained embryos (arrowhead). At E10.5 (Fig. 4C), lacZ expression extended into the proximal region of OFT (arrow). At E11.5 (Fig. 4D), ß-galactosidase-positive endocardial cells were evident in the septating OFT (arrow) and AVC (arrowhead), with expression accentuated at the proximal ventricular region of the forming aortic and pulmonary trunk as well as at the ventricular ends of AVC. By E12.5 (Fig. 4E), the endocardial staining was intensified in the newly septated OFT and AVC, as well as the valvulogenic areas. Sectioning of whole-mount-stained embryos indicated that the enhancer is initially activated, between E8.5 or E9.5, in the endocardial cells of the AVC and OFT (Fig. 4F,G); and that its activity increases reaching maximal expression at E12.5 in the endocardial cells lining AVC and recently separated OFT (aortic and pulmonary outlets) (Fig. 4H). In particular, activity was concentrated in those endocardial cells of the forming cardiac valves, marking only the pro-valve endocardium at the endocardial-endothelial junction of ventricular outlets and distal arterial root (Fig. 4I). By E14.5 when the remodeled endocardial cushions begin to assume the morphology of discrete valve leaflets, the enhancer activity was significantly diminished and detectable only in a few endocardial cells lining the newly formed valve leaflets (Fig. 4J).

A 781 bp sequence in the P2 regulatory region is required for the endocardial-specific gene expression in the developing heart
Comparative sequence analysis of the first intron of the mouse and the human revealed that, in addition to the conservation of the proximal (core) P2 promoter region, there were two distal highly conserved regions located in the 4.1-kb BssHII-BssHII intron 1 fragment (Fig. 5A). Furthermore, a 211 bp pyrimidine-rich stretch and 10 copies of a CTTTT repeat were found in this intron fragment. Using PCR cloning, nucleotide sequences in this P2 fragment essential for endocardial-specific expression were determined by systematic and sequential removal of these unique sequences to produce deletions of the BB-HSP-lacZ reporter construct, named d1-d7 (Fig. 5A). Analysis of this series of deletion constructs by transient mouse transgenesis and whole-mount staining of E11.5 embryos demonstrated that constructs d1-d5 were able to confer endocardial-specific expression identical to that of the parent BB-HSP-lacZ reporter (Fig. 5B). Thus, the d5 deletion construct containing a 1.5 kb 3' end sequence of intron 1 is sufficient for the endocardial-specific expression. Removal of 781 bp sequence between the 200 bp conserved region and CTTTT repeats completely abolished this endocardial-specific activity, indicating the d6 sequence with the CTTTT-repeats alone is insufficient for the endocardial gene expression. The endocardial specificity of the d5 construct was verified by cross-sectional examination of the whole-mount-stained embryos (Fig. 5C). At the single cell level of resolution, the expression of lacZ is exclusively restricted to the endocardial cells in the OFT (arrow) and AVC (arrowhead). ß-Galactosidase activity is extinguished in those cells that have undergone mesenchymal transformation and invaded the matrix-rich cushions, and no ß-galactosidase activity was found in the endothelial cells outside of the heart. These data clearly demonstrated that a crucial enhancer sequence for the pro-valve endocardial cells is located within the 781 bp region.



View larger version (83K):
[in this window]
[in a new window]
 
Fig. 5. Deletional analysis of the endocardial enhancer. (A) Schematic depicting the unique features of the 4.1 kb BssHII-BssHII intron 1 region and the deletional reporter constructs (d1-d7). (B) Representative whole-mount staining of E11.5 embryos demonstrates the presence of the pro-valve endocardial enhancer activity in d1-d5 but not d6 and d7. (C) Cross-sectional analysis of d5 transgenic embryos (E11.5) shows that the enhancer activity is exclusively restricted to the pro-valve endocardial cells in AVC (arrow) and OFT (arrowhead). The enhancer is not activated in the transformed cells of the endocardial cushions and endothelial cells outside of the heart.

 
The 781 bp sequence is sufficient for the endocardial-specific gene expression in the developing heart
Together, the data revealed that transcription of Nfatc1 in the pro-valve endocardium is positively regulated by cis-acting elements located in the 781 bp intron 1 sequence (Fig. 6A). To further determine whether this region was sufficient, in isolation, to direct pro-valve endocardial-specific expression, the 781 bp sequence was cloned into the pWhere-HSP reporter and the construct was named ECE (endocardial cell enhancer)-HSP-lacZ (Fig. 6B). An additional construct (ECE{Delta}-HSP-lacZ) was generated by PCR cloning to remove 250 bp of 5' end sequence that contained two short conserved domains, ECE1 and ECE2, harboring a cluster of putative transcriptional binding sites (Fig. 6A). The pro-valve endocardial enhancer activity of these constructs was then evaluated in transient transgenic analysis. Whole-mount-stained E11.5 embryos (Fig. 6C,D) and hearts (Fig. 6E,F) with the ECE-HSP-lacZ construct demonstrated the expression of lacZ reporter at the lumen of both OFT (Fig. 6, arrowhead) and AVC (Fig. 6, arrow) region. Thus, the 781 bp ECE was sufficient for pro-valve endocardial-specific expression, and functioned as an autonomous tissue-specific enhancer. Deletion of the 250 bp sequence containing ECE1 and ECE2 completely abolished activity (data not shown), indicating that a crucial cis-enhancer element(s) is contained in this 250 bp sequence.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 6. (A) The activation of P1 promoter by the 781 bp sequence of the P2 regulatory region. Two short conserved elements (mouse/human) are located in this sequence with a cluster of binding sites for known transcription factors. (B) A schematic shows deletional analysis of the conserved putative endocardial enhancers (ECEs). (C-F) Whole-mount staining of E11.5 embryos (C,D) or isolated hearts (E,F) demonstrates that the ECE-HSP-lacZ, but not the ECE{Delta}-HSP-lacZ reporter (data not shown), is sufficient to direct gene expression specifically in the pro-valve endocardial cells of forming valves and septa. ao, aorta; pt, pulmonary trunk; la, left atrium; ra, right atrium; lv, left ventricle; rv, right ventricle; avc, atrioventricular canal; arrow, AVC; arrowhead, OFT.

 
The 250 bp Nfat site-rich region directs autoregulation of Nfatc1 expression during valve formation
The presence of multiple Nfat sites in ECE1 and ECE2 of the 250 bp sequence prompted us to examine whether Nfatc1 expression is required for activation of the enhancer as previously described for its P1 promoter in T cells (Chuvpilo et al., 2002Go; Zhou et al., 2002Go). We therefore crossed the BB-HSP-lacZ transgenic reporter line into the previously described Nfatc1-null mutant mouse line (Ranger et al., 1998Go). We found that, in both whole-mount E11.5 embryos and cross-sections (Fig. 7), there was a consistent reduction or absence of endocardial gene expression in both OFT (arrow) and AVC (arrowhead) of Nfatc1-null embryos (Fig. 7D-F) compared with their heterozygous littermates (Fig. 7A-C).



View larger version (106K):
[in this window]
[in a new window]
 
Fig. 7. Autoregulation of Nfatc1 enhancer activity. The BB-HSP-lacZ reporter transgenic line was crossed into the existing Nfatc1-null mutant line. Compared to the heterozygous littermates (A-C), inactivation of Nfatc1 greatly reduced the pro-valve endocardial enhancer activity of the BB-HSP-lacZ reporter construct (D-F). A consistent reduction of endocardial lacZ expression is shown in the OFT (arrow) and AVC (arrowhead) of the E11.5 heart when crossed into Nfatc1-null background

 
We further analyzed whether Nfatc1-dependent expression was dependent on a direct interaction of Nfatc1 and the Nfat sites in ECE1 and ECE2 in situ. This required that we develop a new primary embryonic endocardial cell culture from E11.5 embryos as isolation of a sufficient number of endocardial cells directly from wild-type and Nfatc1-null mutant embryos was not technically feasible. As shown in Fig. 8, these primary endocardial cells (ECCs) have a uniform endothelial-like morphology and express nuclear localized Nfatc1 (Fig. 8A), as well as multiple endothelial cell markers, such as Tie2, Pecam1/CD31, endoglin/CD105 and VE-cadherin (data not shown). We then performed EMSA analysis using nuclear extracts prepared from these primary ECCs. Three oligonucleotide probes (N1, N2 and N3) were generated with or without the deletion of core dinucleotides, GG or CC, that are characteristic of the Nfat-binding site; mutated probes were named N1{Delta}, N2{Delta}1, N2{Delta}2 and N3{Delta} (Fig. 8B). EMSA showed that protein-DNA binding complexes formed using N1 or N2 (Fig. 8C, arrow) but not N3 probe (data not shown). Importantly, mutation of any Nfat site in N1 or N2 greatly abolished formation of Nfatc1-DNA complexes, suggesting that these Nfat sites are functional in situ. We then performed ChIP assays with chromatin prepared from cultured wild-type or Nfatc1-null endocardial cells in which the Rel-homology DNA-binding domain has been deleted (Ranger et al., 1998Go). A set of primers (Fig. 8B, arrow) encompassing ECE1 and ECE2 were used to amplify chromatin pulled down by the anti-Nfatc1-specific monoclonal antibody 7A6. The results demonstrate that Nfatc1 binds to this DNA fragment in situ (Fig. 8D), whereas controls using either no antibody or chromatin from Nfatc1-null endocardial cells showed no product after PCR amplification. In addition, irrelevant primers that flank a non-Nfat site fragment DNA did not produce a PCR product (data not shown). Together, these data suggest that Nfatc1 expression is autoregulated during valve formation by interaction of Nfatc1 and the 250 bp Nfat site-rich region.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 8. (A) Primary culture of embryonic (E11.5) endocardial cells (ECCs). ECCs form a colonized monolayer surrounded by fibroblastic-like OP9 feeder cells at passage 1 (p1). At p3, ECCs exhibit uniform, endothelial-like morphology with a typical `cobblestone' appearance. Approximately 80% of the ECCs expresses nuclear localized Nfatc1 (green; negative cells are indicated by arrowheads in DAPI staining). Negative control (no primary antibody) is shown in ECC(-Ab). (B) The 781 bp enhancer region. Two short stretch conserved sequences, ECE1 and ECE2, are shown with Nfat-binding sites highlighted in red and deleted GG or CC bi-nucleotides of core binding site are underlined. The arrows indicate the location of primers for the ChIP assays. (C) EMSA demonstrating that mutation of the Nfat-binding sites in either the N1 or N2 regions results in attenuation of Nfatc1 binding (arrows). (D) Results of the ChIP assay document PCR amplification of the chromatin region encompassing ECE1 and ECE2 from wild-type ECCs following immunoprecipitation with an Nfatc1 antibody (7A6) (arrow) and absence of chromatin amplification without antibody or using cultured Nfatc1-null ECCs.

 
The Hox site is required for suppression of the enhancer activity in non pro-valve endocardial cells
To determine the function of other transcription factor-binding sites adjacent to the Nfat sites, constructs containing deletion of core nucleotides for Gata, Hox and Smad sites were used in transient transgenic assays. Although mutation of the Gata and Smad sites did not alter the specificity of in vivo lacZ expression (data not shown), mutation of the Hox site resulted in activation of the enhancer in endocardial cells outside of the valve forming region or non pro-valve endocardial cell and vascular bed outside of the heart (Fig. 9). In whole-mount-stained E11.5 and E12.5 embryos, activity of the enhancer was readily observed in umbilical cord, intersomitic (Fig. 9A, arrows) and head vasculature (Fig. 9C). Sectional analysis confirmed that the enhancer is activated in the endothelium of peripheral vasculature, such as in the head (Fig. 9C, inset), and endothelial cells of ductus venous of E12.5 (Fig. 9F, arrow) and E11.5 embryos (Fig. 9H, arrowhead in inset). Within the heart, aberrant enhancer activity was observed in the endocardial cells of the trabeculated ventricular outlet in E12.5 (Fig. 9E, arrowhead in the inset) and E11.5 hearts (Fig. 9G, marked by a star), and sinus venous valves (Fig. 9H, arrow). The dysregulated enhancer activity was also observed in the cushion mesenchymal cells (Fig. 9E, inset). In addition to its abnormal non pro-valve endocardial activity, activity of the mutated enhancer appeared to be increased in the pro-valve endocardial cells (Fig. 9B,D, arrowheads), although the transient transgenic approach did not allow us to compare relative activity between the wild-type and mutated enhancer. Thus, these data suggested that the Hox site is required for maintaining the pro-valve endocardial specificity of the enhancer by suppression of its activity in non pro-valve endocardial tissues.



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 9. Whole-mount (A-D) and section (E-H) analysis reveals that mutation of the Hox site results in activation of the enhancer outside the pro-valve endocardial cells. Activity of the mutated enhancer is observed in umbilical cord (uc), intersomitic artery (isa) (A) and the head vasculature (C). Sectional analysis shows lacZ expression in the endothelial cells of head vasculature (inset in C), ductus venous of E12.5 (F, arrow) and E11.5 embryos (H, arrowhead in inset). Within the heart, aberrant enhancer activity was observed in the endocardial cells of the trabeculated ventricular outlet in E12.5 (E, arrowhead in the inset) and E11.5 hearts (G, marked by an asterisk), and sinus venous valves (G, arrowhead). The dysregulated enhancer activity was also observed in the cushion mesenchymal cells (E, inset). Activity of the mutated enhancer appeared to be increased in the pro-valve endocardial cells (B and D, arrowheads). (I) A table summarizes transient transgenic experiments with the mutated constructs. TG, transgenic embryos; EC, endocardial cell expression; ET, ectopic expression.

 

    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The results of this study offer an initial elucidation of how endocardial-specific gene expression can be achieved during valvulogenesis and cardiac septation. We demonstrate that a sequence of 781 bp within the first intron of the murine Nfatc1 functions as an autonomous cell-specific enhancer to direct strong and highly specific expression in pro-valve endocardium during cardiac development in vivo. Activation of this enhancer element is only observed in the endocardial cells of the AVC and OFT. It is not detected during initial differentiation of the endocardium from the mesoderm in the E7.5 embryo, nor does it drive expression in the transformed endocardial cells at the time when the endocardial cushions are forming and subsequently remodeled into cardiac valves.

It has been shown that mesenchymal cushion formation results at least partially from EMT within the heart tube as a consequence of interaction between both localized myocardial cues and adjacent endocardial responsiveness (Eisenberg and Markwald, 1995Go; Markwald et al., 1996Go). Tgfß/Bmp signaling pathways appear to modulate this myocardial-endocardial interaction in both the avian and mouse embryos (Boyer et al., 1999Go; Brown et al., 1999Go). Yet, the transcriptional circuitry that governs the phenotypic changes of these specialized endocardial cells during EMT and later valvulogenesis has not been extensively studied. The enhancer described in our studies could function as a `genetic switch' that turns on and later turns off Nfatc1 expression in response to signals elicited, presumably, from myocardium of the endocardial cushions. Identification of this endocardial enhancer thus provides a novel genetic marker for the unique pro-valve endocardial cells. It may also serve as a genetic readout for the inducible myocardial cues allowing the nature of such signals to be deduced.

Scanning of the 250 bp necessary endocardial enhancer sequence reveals binding sites for several transcription factors, including Smad, Gata and Nfat, which mediate signals known to be involved in regulating EMT and/or later valve formation. We and others have shown an autoregulation of Nfatc1 expression in T cells in the adult animal through the Nfat sites in its P1 promoter (Chuvpilo et al., 2002Go; Zhou et al., 2002Go). The sustained high expression of nuclear activated Nfatc1 in endocardium during cardiac valve formation suggests that a similar autoregulatory paradigm may also operate for Nfatc1 expression in the developing endocardium. Consistent with this notion, there are five consensus Nfat sites located in the 250 bp sequence necessary for the endocardial enhancer activity in vivo, and four of them are nested in the two conserved ECEs. We demonstrated, using a genetic approach, that Nfatc1 expression is required for maintaining the activity of the endocardial enhancer. We also determined, using EMSA and ChIP assays, that this Nfatc1-dependent enhancer activity is probably the direct result of interaction of Nfatc1 with one or more Nfat sites in the 250 bp sequence.

Tgfß/Bmp-Smad pathways play a prominent role during EMT. Both in vitro and in vivo studies have indicated that ligands of Tgfß/Bmp receptors are strong inducers or positive regulators of EMT, and are essential for later morphogenesis of cardiac valves. However, the nuclear events or targets of Tgf/Bmp activation in the endocardial cells are not fully characterized. Recently, Gata transcription factors have emerged as another cohort of important regulators of EMT. Disruption of Gata4 interaction with its co-factor, Fog2, by a `knock-in' mutation (Gata4KI/KI) (Crispino et al., 2001Go) or endothelial-specific deletion of Gata co-factor, Fog1, result in both OFT and AVC defects (Katz et al., 2003Go). Furthermore, in vitro data suggest that an interaction between Gata5 and Nfatc1 may be important for endocardial cell differentiation (Nemer and Nemer, 2002Go). In our study, we found that binding sites of Gata and Smad factors in the conserved enhancer region are not essential for the specificity of the enhancer, although we could not rule out their effect on the level of enhancer activity.

By contrast, the Hox site was found to be required for maintaining the specificity of the enhancer by suppressing its activity outside the pro-valve endocardial cells. Thus, the intact Hox-binding site represents a negative cis-element where its interaction with its binding factors in non pro-valve endocardial tissues is probably required for limiting Nfatc1 expression outside of the pro-valve endocardial cells. Hox factors consist of a large number of homeobox transcription proteins and the binding site for these factors is relatively diversified, and thus less defined when compared with the Nfat site. We do not know which Hox factor plays a role in suppression of the enhancer activity outside the pro-valve endocardial cells, such as endocardial cells of ventricular trabeculae and transformed endocardial cells. In the developing heart, Msx1, previously known as Hox7, is expressed in the developing endocardium (Lyons et al., 1992Go; Robert et al., 1989Go), while a closely related gene, Msx2, is highly expressed in the cushion cells that are transformed from endocardial cells (Abdelwahid et al., 2001Go). In addition, other homeobox genes, iroquois 5 and iroquois 6, are only expressed in the E11.5 endocardial cells lining the trabeculated myocardium (Christoffels et al., 2000Go). Whether any or all of these factors are upstream regulators of this enhancer is currently under investigation.

In summary, mesenchymalization of the endocardial cushions by EMT, and the later remodeling of the cushions into the mature valves and septa are crucial morphogenic processes susceptible to environment and genetic alterations that result in common congenital heart diseases. These processes must require the coordinated regulation of several signaling pathways. Our data provide initial in vivo identification and characterization of a crucial enhancer required for cell-specific autoregulation of Nfatc1 expression in the pro-valve endocardial cells as well as suppression of its expression in those non-valve endocardial cells. This work should facilitate further delineation of how multiple signals are integrated at the transcriptional level to orchestrate valvulogenesis and should provide valuable in vivo models to specifically investigate gene function in pro-valve endocardium required for normal cardiac valve formation.


    ACKNOWLEDGMENTS
 
We thank Dr. M. A. Brown for providing the mouse Nfatc1.ß plasmid, and Drs P. Robson and S. Brandt for critical reading and helpful discussion. This work was supported by a Scientist Development Grant from American Heart Association (B.Z.) and funding from the National Institute of Health (H.S.B.).


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 


Abdelwahid, E., Rice, D., Pelliniemi, L. J. and Jokinen, E. (2001). Overlapping and differential localization of Bmp-2, Bmp-4, Msx-2 and apoptosis in the endocardial cushion and adjacent tissues of the developing mouse heart. Cell Tissue Res. 305, 67-78.[CrossRef][Medline]
Antos, C. L., McKinsey, T. A., Frey, N., Kutschke, W., McAnally, J., Shelton, J. M., Richardson, J. A., Hill, J. A. and Olson, E. N. (2002). Activated glycogen synthase-3 beta suppresses cardiac hypertrophy in vivo. Proc. Natl. Acad. Sci. USA 99,907 -912.[Abstract/Free Full Text]
Barnett, J. V. and Desgrosellier, J. S. (2003). Early events in valvulogenesis: a signaling perspective. Birth Defects Research. Part C, Embryo Today: Reviews 69, 58-72.
Boyer, A. S., Ayerinskas, II, Vincent, E. B., McKinney, L. A., Weeks, D. L. and Runyan, R. B. (1999). TGFbeta2 and TGFbeta3 have separate and sequential activities during epithelial-mesenchymal cell transformation in the embryonic heart. Dev. Biol. 208,530 -545.[CrossRef][Medline]
Brown, C. B., Boyer, A. S., Runyan, R. B. and Barnett, J. V. (1999). Requirement of type III TGF-beta receptor for endocardial cell transformation in the heart. Science 283,2080 -2082.[Abstract/Free Full Text]
Bushdid, P. B., Osinska, H., Waclaw, R. R., Molkentin, J. D. and Yutzey, K. E. (2003). NFATc3 and NFATc4 are required for cardiac development and mitochondrial function. Circ. Res. 92,1305 -1313.[Abstract/Free Full Text]
Chang, C. P., Neilson, J. R., Bayle, J. H., Gestwicki, J. E., Kuo, A., Stankunas, K., Graef, I. A. and Crabtree, G. R. (2004). A field of myocardial-endocardial NFAT signaling underlies heart valve morphogenesis. Cell 118,649 -663.[CrossRef][Medline]
Christoffels, V. M., Keijser, A. G., Houweling, A. C., Clout, D. E. and Moorman, A. F. (2000). Patterning the embryonic heart: identification of five mouse Iroquois homeobox genes in the developing heart. Dev. Biol. 224,263 -274.[CrossRef][Medline]
Chuvpilo, S., Jankevics, E., Tyrsin, D., Akimzhanov, A., Moroz, D., Jha, M. K., Schulze-Luehrmann, J., Santner-Nanan, B., Feoktistova, E., Konig, T. et al. (2002). Autoregulation of NFATc1/A expression facilitates effector T cells to escape from rapid apoptosis. Immunity 16,881 -895.[CrossRef][Medline]
Crispino, J. D., Lodish, M. B., Thurberg, B. L., Litovsky, S. H., Collins, T., Molkentin, J. D. and Orkin, S. H. (2001). Proper coronary vascular development and heart morphogenesis depend on interaction of GATA-4 with FOG cofactors. Genes Dev. 15,839 -844.[Abstract/Free Full Text]
de la Pompa, J. L., Timmerman, L. A., Takimoto, H., Yoshida, H., Elia, A. J., Samper, E., Potter, J., Wakeham, A., Marengere, L., Langille, B. L. et al. (1998). Role of the NF-ATc transcription factor in morphogenesis of cardiac valves and septum. Nature 392,182 -186.[CrossRef][Medline]
Eisenberg, L. M. and Markwald, R. R. (1995). Molecular regulation of atrioventricular valvuloseptal morphogenesis. Circ. Res. 77,1 -6.[Free Full Text]
Graef, I. A., Chen, F., Chen, L., Kuo, A. and Crabtree, G. R. (2001). Signals transduced by Ca(2+)/calcineurin and NFATc3/c4 pattern the developing vasculature. Cell 105,863 -875.[CrossRef][Medline]
Katz, S. G., Williams, A., Yang, J., Fujiwara, Y., Tsang, A. P., Epstein, J. A. and Orkin, S. H. (2003). Endothelial lineage-mediated loss of the GATA cofactor Friend of GATA 1 impairs cardiac development. Proc. Natl. Acad. Sci. USA 100,14030 -14035.[Abstract/Free Full Text]
Lyons, G. E., Houzelstein, D., Sassoon, D., Robert, B. and Buckingham, M. E. (1992). Multiple sites of Hox-7 expression during mouse embryogenesis: comparison with retinoic acid receptor mRNA localization. Mol. Reprod. Dev. 32,303 -314.[CrossRef][Medline]
Marelli-Berg, F. M., Peek, E., Lidington, E. A., Stauss, H. J. and Lechler, R. I. (2000). Isolation of endothelial cells from murine tissue. J. Immunol. Methods 244,205 -215.[CrossRef][Medline]
Markwald, R., Eisenberg, C., Eisenberg, L., Trusk, T. and Sugi, Y. (1996). Epithelial-mesenchymal transformations in early avian heart development. Acta Anat. 156,173 -186.[Medline]
Molkentin, J. D., Lu, J. R., Antos, C. L., Markham, B., Richardson, J., Robbins, J., Grant, S. R. and Olson, E. N. (1998). A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 93,215 -228.[CrossRef][Medline]
Nemer, G. and Nemer, M. (2002). Cooperative interaction between GATA5 and NF-ATc regulates endothelial-endocardial differentiation of cardiogenic cells. Development 129,4045 -4055.[Abstract/Free Full Text]
Ranger, A. M., Grusby, M. J., Hodge, M. R., Gravallese, E. M., de la Brousse, F. C., Hoey, T., Mickanin, C., Baldwin, H. S. and Glimcher, L. H. (1998). The transcription factor NF-ATc is essential for cardiac valve formation. Nature 392,186 -190.[CrossRef][Medline]
Robert, B., Sassoon, D., Jacq, B., Gehring, W. and Buckingham, M. (1989). Hox-7, a mouse homeobox gene with a novel pattern of expression during embryogenesis. EMBO J. 8, 91-100.[Medline]
Schroeder, J. A., Jackson, L. F., Lee, D. C. and Camenisch, T. D. (2003). Form and function of developing heart valves: coordination by extracellular matrix and growth factor signaling. J. Mol. Med. 81,392 -403.[CrossRef][Medline]
Wilkins, B. J., de Windt, L. J., Bueno, O. F., Braz, J. C., Glascock, B. J., Kimball, T. F. and Molkentin, J. D. (2002). Targeted disruption of NFATc3, but not NFATc4, reveals an intrinsic defect in calcineurin-mediated cardiac hypertrophic growth. Mol. Cell. Biol. 22,7603 -7613.[Abstract/Free Full Text]
Wunsch, A. M., Little, C. D. and Markwald, R. R. (1994). Cardiac endothelial heterogeneity defines valvular development as demonstrated by the diverse expression of JB3, an antigen of the endocardial cushion tissue. Dev. Biol. 165,585 -601.[CrossRef][Medline]
Zhou, B., Cron, R. Q., Wu, B., Genin, A., Wang, Z., Liu, S., Robson, P. and Baldwin, H. S. (2002). Regulation of the murine Nfatc1 gene by NFATc2. J. Biol. Chem. 277,10704 -10711.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
T. R. Torgerson, A. Genin, C. Chen, M. Zhang, B. Zhou, S. Anover-Sombke, M. B. Frank, I. Dozmorov, E. Ocheltree, P. Kulmala, et al.
FOXP3 Inhibits Activation-Induced NFAT2 Expression in T Cells Thereby Limiting Effector Cytokine Expression
J. Immunol., July 15, 2009; 183(2): 907 - 915.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Langworthy, B. Zhou, M. de Caestecker, G. Moeckel, and H. S. Baldwin
NFATc1 Identifies a Population of Proximal Tubule Cell Progenitors
J. Am. Soc. Nephrol., February 1, 2009; 20(2): 311 - 321.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Snider, R. B. Hinton, R. A. Moreno-Rodriguez, J. Wang, R. Rogers, A. Lindsley, F. Li, D. A. Ingram, D. Menick, L. Field, et al.
Periostin Is Required for Maturation and Extracellular Matrix Stabilization of Noncardiomyocyte Lineages of the Heart
Circ. Res., April 11, 2008; 102(7): 752 - 760.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Wu, S.-c. Kao, T. Barrientos, S. H. Baldwin, E. N. Olson, G. R. Crabtree, B. Zhou, and C.-P. Chang
Down Syndrome Critical Region-1 Is a Transcriptional Target of Nuclear Factor of Activated T Cells-c1 within the Endocardium during Heart Development
J. Biol. Chem., October 19, 2007; 282(42): 30673 - 30679.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. Song, W. Yan, X. Chen, C.-x. Deng, Q. Wang, and K. Jiao
Myocardial Smad4 Is Essential for Cardiogenesis in Mouse Embryos
Circ. Res., August 3, 2007; 101(3): 277 - 285.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Khandekar, W. Brandt, Y. Zhou, S. Dagenais, T. W. Glover, N. Suzuki, R. Shimizu, M. Yamamoto, K.-C. Lim, and J. D. Engel
A Gata2 intronic enhancer confers its pan-endothelia-specific regulation
Development, May 1, 2007; 134(9): 1703 - 1712.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Zubair, S. Ishihara, S. Oka, K. Okumura, and K.-i. Morohashi
Two-Step Regulation of Ad4BP/SF-1 Gene Transcription during Fetal Adrenal Development: Initiation by a Hox-Pbx1-Prep1 Complex and Maintenance via Autoregulation by Ad4BP/SF-1.
Mol. Cell. Biol., June 1, 2006; 26(11): 4111 - 4121.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
D. Beis, T. Bartman, S.-W. Jin, I. C. Scott, L. A. D'Amico, E. A. Ober, H. Verkade, J. Frantsve, H. A. Field, A. Wehman, et al.
Genetic and cellular analyses of zebrafish atrioventricular cushion and valve development
Development, September 15, 2005; 132(18): 4193 - 4204.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.01640v1
132/5/1137    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, B.
Right arrow Articles by Baldwin, H. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, B.
Right arrow Articles by Baldwin, H. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?