Supplemental Figure
-
Fig. S1. aPKC MO
disrupts epithelial integrity in post-MBT embryos. (A) Western blot of gastrula
stage embryos showing that a MO against aPKCl reduces the aPKCl
protein level in a dose dependent way (arrow). A MO against aPKCz has no effect and the two together have no
additive effect. (B-E) Early gastrula stage embryos injected with various MOs,
as indicated. Only embryos injected with PKC l
MO show ectodermal disruption, (D) Embryo with vitelline membrane, (E) embryo
with vitelline membrane removed. (F) Time lapse of aPKC l MO-injected embryo showing the development and progression of
an ectodermal tear. (G-I) TUNEL assay of control (G) and aPKC l MO-injected (H,I) embryo. There is
increased cell death in the aPKC l MO
embryo but it is mostly confined to the deep layer of cells (section, I). The
ectodermal disintegration does not appear to correlate with increased cell
death in the superficial cells. PKCl
morpholino sequence, tggtgttgtccctctgtgtcggcat; PKCz morpholino sequence, tttttgaccccatcttgcttggcat.
