|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 9 February 2005
doi: 10.1242/dev.01706
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Laboratory of Molecular Vertebrate Embryology, The Rockefeller University, 1230 York Avenue, New York, NY 10021, USA
* Author for correspondence (e-mail: brvnlou{at}mail.rockefeller.edu)
Accepted 18 January 2005
| SUMMARY |
|---|
|
|
|---|
Key words: TGFß signaling, Human embryonic stem cells (hESCs), SMAD2/3
| Introduction |
|---|
|
|
|---|
Little is known about the signaling pathways that govern the unique
properties of hESCs. Maintenance of mouse embryonic stem cell (mESC) identity
was initially found to be dependent on extrinsic factors that were produced by
a feeder layer of mouse embryonic fibroblasts (MEFs). Subsequently, it was
found that leukemia inhibitory factor (LIF) was produced by MEFs and was
sufficient to maintain mESC identity in the absence of a feeder layer. LIF,
however, is not the lone factor responsible for the maintenance of stem cell
identity in the mouse, as null mutants in which LIF/Stat3 signaling is
eliminated show no defect in the establishment of the stem cell compartment
(reviewed by Smith, 2001
).
Furthermore, LIF is incapable of maintaining stem cell identity in hESCs
(Thomson et al., 1998
;
Reubinoff et al., 2000
;
Sato et al., 2004
), suggesting
a contribution from other signaling pathways to the establishment and/or
maintenance of stem cell identity in mammalian development.
Models of early vertebrate development have described a role for multiple
signaling cascades in the emergence of pattern and cell identity
(Harland and Gerhart, 1997
;
Gilbert, 2003
). These models
have suggested a prominent role for TGFß signaling in the earliest cell
fate decisions of embryogenesis, including neural induction and mesendoderm
specification in Xenopus (reviewed by
Munoz-Sanjuan and Brivanlou,
2002
), and primitive streak and mesoderm formation in the mouse
(reviewed by Goumans et al., 2000). The TGFß superfamily of ligands,
which contains
40 potential ligands in the human genome, signals through
two main branches: the SMAD1/5 branch, which transduces on behalf of BMP and
GDF ligands via the type I receptors ALK1, ALK2, ALK3 and ALK6 (ACVERL1,
ACVER1, BMPR1A and BMPR1B, respectively - Mouse Genome Informatics); and the
TGFß/activin/nodal branch involves the activation of SMAD2/3 via ALK4,
and ALK5 and ALK7 (TGFBR1 and ACVR1C - Mouse Genome Informatics) (reviewed by
Shi and Massague, 2003
). There
are also two inhibitory SMADs - SMAD6, which selectively inhibits SMAD1/5; and
SMAD7, which inhibits both branches of TGFß signaling - that provide a
repressive input on the pathway. Upon activation by phosphorylation and
association with a common SMAD4, the receptor-activated SMADs translocate to
the nucleus and, in concert with other transcription factors, regulate gene
expression (Shi and Massague,
2003
).
Here we show that activation of the TGFß/activin/nodal branch through SMAD2/3 is associated with pluripotency and is required for the maintenance of the undifferentiated state in hESCs and in ex vivo mouse blastocyst outgrowths. hESCs can be maintained undifferentiated through unknown factors in conditioned medium or through activation of the WNT pathway by BIO, a GSK3ß inhibitor. We show that activin/nodal signaling in required downstream of both conditions, in that inhibition of this pathway with a small molecule inhibitor or soluble receptors results in a loss of the undifferentiated state. Accordingly, we find that exogenous activin A is supportive of the undifferentiated state. In our study of hESCs, we have revealed a crucial role for TGFß signaling in the regulation of ES cell identity.
| Materials and methods |
|---|
|
|
|---|
Cell culture
hESC line H1 was obtained from WiCell research institute and BGN1 and BGN2
lines were obtained from BresaGen. Human embryonic stem cells were maintained
as previously described (Sato et al.,
2003
).
hESC synchronization
BGN1 cell cycle progression was blocked at metaphase by incubation
overnight in conditioned medium with 100 ng/ml demecolcine solution. Cells
were washed four times with PBS to release them from metaphase block and then
harvested for immunoblotting at 15 minutes and 4 hours post-release.
Immunoblotting
Cells were lysed with 100 µl 1x lysis buffer [20 mM Tris (pH 7.5),
150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium
pyrophosphate, 1 mM ß-Glycerophosphate, 1 mM Na3VO4
and complete mini protease inhibitor cocktail (Roche)]. Total protein (20
µg) was loaded for each lane. Membranes were blocked in TBS with 0.1% Tween
and 5% milk. Antibodies used were anti-phospho-SMADs (Cell Signaling);
anti-SMAD2/3 (Transduction Laboratories; 1:1000); anti-SMAD1 (Upstate);
anti-tubulin (Sigma); anti-OCT3/4 (Transduction Laboratories); anti-human
nanog (R&D). Primary antibodies were incubated over night and secondary
antibodies for 2 hours. Proteins were detected with ECL (Amersham
Biosciences).
RT-PCR
Cells were lysed directly with 100 µl RNAbee (Tel-Test) and total RNA
was extracted. Total RNA (1 µg) was reverse transcribed to cDNA and 1/20 of
the RT reaction was used as PCR template. Radioactive amplification was
according to the following conditions: ß-actin, TGGCACCACACCTTCTACAATGAGC
(forward) and GCACAGCTTCTCCTTAATGTCACGC (reverse) (21 cycles); OCT3/4,
GAAGGATGTGGTCCGAGTGT (forward) and GTGACAGAGACAGGGGGAAA (reverse) (19 cycles);
NANOG, ACCAGAACTGTGTTCTCTTCCACC (forward) GGTTGCTCCAGGTTGAATTGTTCC (reverse)
(21 cycles).
Immunofluorescence
BGN2 cells were plated on matrigel coated poly-D lysine/laminin Biocoat
coverslips (Becton-Dickinson) and cultured for 5 days in the described
conditions. Following culture, cells or mouse embryos were fixed in 4%
paraformaldehyde in PBS, washed in PBS + 0.2% bovine serum albumin (BSA),
permeabilized with 0.1% Triton X-100 in PBS/BSA for 20 minutes, and then
blocked in 5% donkey serum in PBS/BSA for 2 hours at room temperature. Cells
were incubated overnight at 4°C with combinations of either rabbit
anti-phospho-SMAD1/5 (1:100 dilution), anti-SMAD2/3 (1:500) or anti-OCT3/4
(1:500). After three 3 washes in PBS/BSA, cells were incubated with
combinations of AlexaFluor488-, AlexaFluor555- or AlexaFluor647-conjugated
donkey anti-rabbit/anti-mouse secondary antibodies for 2 hours at room
temperature. Cells were then washed with PBS/BSA and stained with either 25 nM
SytoxGreen or ToPro3-iodide nucleic acid stain in PBS/BSA. Coverslips were
mounted in glycerol and imaged using a Zeiss LSM 510 confocal microscope.
Blastocyst outgrowth
Pregnant Swiss-Webster mice were sacrificed at embryonic day 3.5 and the
uterus was isolated and flushed with warm culture medium to obtain blastocyst
stage embryos as described previously
(Nagy, 2003
). Embryos were
incubated in culture medium containing 1 mg/ml pronase and observed
continuously until the zona pellucida was digested. Embryos were then rinsed
three times in warm culture medium and incubated on gelatin-coated tissue
culture plastic in mouse embryonic stem cell medium
(Betts et al., 2001
) containing
either 20 µM SB431542 or an equivalent dilution of DMSO. Embryos were not
disturbed during culture in order to allow attachment and outgrowth. Embryos
were fixed in 4% paraformaldehyde in PBS at 4 days post extraction and
processed for immunofluorescence in the same manner as the hESCs. Treated
embryos and outgrowths were imaged using a Zeiss LSM 510 confocal
microscope.
Embryoid bodies formation
Embryoid body formation for BGN2 cells was carried out as previously
described (Sato et al., 2004
).
BGN2 cells grown for 5 days in described conditions, harvested using dispase
(Invitrogen) and plated on bacterial culture plates on which the cells are
unable to attach. Embryoid bodies were allowed to form by growth in suspension
for 7 days. Embryoid bodies were then plated on gelatin-coated tissue culture
grade plastic and further cultured for 7 days in order to allow for terminal
differentiation of cell types. Reattached and terminally differentiated
embryoid bodies were harvested and processed by RT-PCR in order to assay for
the presence of derivatives of primary germ layers.
BrdU incorporation and TUNEL assays
The In Situ Cell Proliferation, FLUOS (cat. No. 1810740) and In Situ Cell
Death Detection, Fluorescein (cat. No. 1684795) kits were obtained from Roche.
H1 cells were cultured for 2 days in CM and then further cultured in the
indicated conditions for 3 days. Following culture, BrdU incorporation and
TUNEL staining was assayed according to the protocols described by the
manufacturer. Cells were imaged and quantified using a Zeiss LSM Pascal
confocal microscope.
| Results |
|---|
|
|
|---|
In the undifferentiated state that is maintained by growth in
MEF-conditioned medium (CM), we found that SMAD2/3 was phosphorylated and
localized to the nucleus of hESCs, indicating activation of the
TGFß/activin/nodal pathways. Furthermore, the phosphorylation and nuclear
localization were reduced in cells that were allowed to differentiate by
growth in non-conditioned medium (nCM)
(Fig. 1A,B). We have previously
shown that BIO is also capable of maintaining hESCs in the undifferentiated
state, even in the absence of CM, through activation of canonical WNT
signaling (Sato et al., 2004
;
Meijer et al., 2003
).
Accordingly, BIO maintained phosphorylation of SMAD2/3 above levels seen in
hESCs grown in nCM alone, and this effect was accompanied by maintenance of
OCT3/4, a marker of pluripotency. To test the ability of hESCs cultured in nCM
to activate SMAD2/3 signaling, we cultured the cells in nCM supplemented with
activin A. Under these conditions, the cells maintained high levels of SMAD2/3
phosphorylation as well as increased OCT3/4 relative to cells cultured in nCM
alone. This suggests that SMAD2/3 activation in the absence of extrinsic
factors present in CM may be supportive of the undifferentiated state, though
not entirely sufficient to maintain typical hESC morphology nor markers of
pluripotency through extended culture (Fig.
1A-C).
|
|
SMAD2/3 activation is necessary for maintenance of the undifferentiated state in hESCs
Having defined the nature of SMAD1/5 and SMAD2/3 activation in
undifferentiated and differentiating hESCs, and having discovered a
correlation between increased SMAD2/3 activation and the undifferentiated
state, we set out to determine whether active SMAD2/3 signaling is necessary
for the maintenance of the pluripotent state
(Fig. 3). The
TGFß/activin/nodal branch of TGFß signaling can be efficiently
inhibited by SB431542, a synthetic compound that precludes SMAD2/3
phosphorylation by type 1 TGFß receptors
(Laping et al., 2002
). We
challenged hESCs cultured in the presence of CM or BIO with SB431542 and
phosphorylation of SMAD2/3 was reduced. Furthermore, upon challenge with
SB431542, the ability of CM or BIO to maintain protein levels of the
pluripotency marker, OCT3/4, was lost. In addition to reducing SMAD2/3
phosphorylation and OCT3/4, SB431542 also has the effect of increasing SMAD1/5
phosphorylation to the levels seen in differentiating hESCs
(Fig. 3A).
|
We next set out to confirm that our observations concerning the effect of SB431542 were specific to its inhibition of TGFß/activin/nodal signaling through SMAD2/3, as the use of a small molecule inhibitor could potentially affect unrelated signal transduction pathways. In order to rule out this possibility, we used an independent means of inhibiting TGFß/activin/nodal signaling by culturing hESCs in CM supplemented with a combination of human recombinant ActRIB, hrActRIIB and hrCripto (Fig. 3C). These three proteins form a complex and bind TGFß/activin/nodal ligands in canonical TGFß signaling, so soluble extracellular domains provide an alternative to SB431542 by competing for TGFß/activin/nodal in the CM. Both OCT3/4 and NANOG were significantly reduced in hESCs cultured in the presence of soluble receptors (Fig. 3C), thus providing corroborative data demonstrating the requirement for this pathway in pluripotent hESCs.
TGFß signaling is involved in many of the more fundamental aspects of
cell biology, including cell viability, adhesion, migration and proliferation
(reviewed by Massague et al.,
2000
). Thus, the global inhibition of ALK4/ALK5/ALK7 activation by
SB431542 could be affecting hESCs in a manner independent of differentiation.
Apart from its role in activating the TGFß/activin/nodal branch of
TGFß signaling, ALK4/ALK5/ALK7 has also been implicated in activation of
MAP kinases, including p38, Jnk and Erk, although the only one of these
kinases to be significantly affected by SB431542 in previously reported in
vitro assays was p38 (Inman et al.,
2002
). In order to address whether SB431542 acts through means
other than inhibition of SMAD2/3 activation, we performed BrdU incorporation
and TUNEL assays to exclude the possibility that SB431542 was affecting cell
viability or proliferation (see Fig. S1A in the supplementary material) and
found no significant effect of SB431542 on these parameters. It has previously
been shown that, at the doses we have used, SB does not significantly affect
activation of other pathways in cell culture
(Inman et al., 2002
). To
confirm this in hESCs, we assessed the phosphorylation of MAP kinases p38, JNK
and Erk in the presence and absence of SB431542, and found that the
phosphorylation of these effector molecules was not regulated upon addition of
SB431542 (data not shown).
Owing to the high passage number of the H1 hESC line used, it is possible that the cells may have acquired an abnormal karyotype that endowed it with an atypical character. In order to exclude this possibility, the cells used in these experiments were karyotyped and found to have a normal complement of chromosomes (data not shown).
Embryoid body formation is inhibited in SB431542 treated hESCs
Embryonic stem cells are defined functionally by their pluripotency - the
ability to give rise to cell types representing all three primary germ layers
of the embryo. In examining the necessity for SMAD2/3 signaling in the
maintenance of the pluripotency, it is important to assay the properties of
hESCs in conditions that more closely approximate in vivo conditions. There
are currently two in vivo assays for hESCs: teratoma formation in the mouse;
and formation of embryoid bodies in culture
(Thomson et al., 1998
).
Embryoid bodies are formed from undifferentiated hESC aggregates cultured in
suspension and they typically contain differentiated cell types of ectodermal,
mesodermal and endodermal lineages. Differentiated hESCs do not form embryoid
bodies.
We examined the efficiency of embryoid body formation in BGN2 hESCs in which SMAD2/3 signaling is activated or inhibited (Fig. 3D). Addition of the inhibitor SB431542 to cells grown in CM significantly reduced the formation of embryoid bodies. Cells grown in the presence of BIO were able to form more embryoid bodies than cells grown in nCM alone, and these embryoid bodies were similar morphologically to those formed of hESCs grown in CM (data not shown). This effect was drastically reduced in the context of SMAD2/3 inhibition and the few embryoid bodies that did form were of an atypical, multi-cystic morphology (data not shown). Activation of SMAD2/3 alone by activin A conferred upon the cells a marginally increased ability to generate embryoid bodies, which is consistent with the ability of activin A to restore OCT3/4 levels in cultured hESCs. These data support the notion that SMAD2/3 activation is necessary but only partially sufficient for maintenance of pluripotency.
In order to assess the character of embryoid bodies formed of hESCs cultured in the above conditions, we assayed the differentiated cell types contained within them by RT-PCR and found that markers of all three primary germ layers were expressed (data not shown).
SMAD2/3 activation is not necessary for maintenance of the undifferentiated state in mESCs
Having found the same requirement for active SMAD2/3 signaling in three
independent lines of hESCs (data not shown), we next assayed the relevance of
SMAD2/3 activation to mouse embryonic stem cell identity. mESCs are typically
cultured in medium containing leukemia inhibitory factor (LIF), a protein that
has been shown to maintain mESCs (Smith,
2001
), but not hESCs (Thomson
et al., 1998
; Reubinoff et
al., 2000
; Sato et al.,
2004
), in the undifferentiated state. However, a role for LIF in
the establishment and maintenance of the stem cell compartment in vivo is
uncertain, as mouse null mutants for components of the LIF/Stat3 pathway have
no stem cell defect (Smith,
2001
). We examined the nature of SMAD2/3 signaling in mESCs with
the expectation that the necessity for SMAD2/3 signaling in mESCs cultured in
medium containing LIF would be similar to that observed for hESCs cultured in
MEF conditioned medium (Fig.
4A).
|
Activation of SMAD2/3 is required for maintenance of pluripotency in the ICM of mouse blastocyst outgrowths
The character of embryonic stem cells in vitro does not necessarily
recapitulate their behavior in an endogenous, in vivo context and a recent
report showing that loss of both SMAD2 and SMAD3 result in reduced epiblast
and OCT3/4 levels (Dunn et al.,
2004
) prompted us to investigate the role of SMAD2/3 activation in
the mouse blastocyst. Mouse blastocyst outgrowths are used to assess the
character and potency of two cell types present in blastocyst stage embryos:
the trophoblast and inner cell mass (ICM). Ex vivo, the trophoblast cells of
the blastocyst adhere to the matrix substrates and migrate across them, while
the inner (ICM) maintains a compact morphology. It is the inner cell mass from
which pluripotent embryonic stem cells are derived, and only these cells
maintain OCT3/4 expression upon outgrowth.
TGFß ligands and receptors are expressed very early in mouse
preimplantation embryos (Albano et al.,
1993
; Mummery et al.,
1993
; Paria and Dey,
1990
; Roelen et al.,
1994
; Roelen et al.,
1998
; Slager et al.,
1991
). In order to assess SMAD2/3 activation in early mouse
development, we performed confocal immunofluorescence microscopy on mouse
embryos from two-cell to late blastocyst stages
(Fig. 4B). SMAD2/3 is
phosphorylated and localized to the nucleus beginning at the four-cell stage
and remains phosphorylated in both the trophoectoderm and ICM up to the
blastocyst stage.
To assess the requirement for SMAD2/3 activation in peri-implantation mouse embryos, we cultured blastocyst stage embryos for 4 days in the presence or absence of SB431542. We assayed the presence of OCT3/4 in outgrowths cultured from the blastocyst stage for 4 days, both in the presence and absence of SB431542 and found that 77% of control outgrowths were positive for OCT3/4 staining, while only 36% of SB431542-treated blastocysts showed OCT3/4 staining; typical control and SB431542 treated embryos in which the OCT3/4 compartment is maintained and lost, respectively, are represented in Fig. 4C. Strikingly, although OCT3/4 protein is present in a majority of outgrowths cultured for 4 days in the presence of DMSO, most of those cultured in SB431542 display a complete loss of OCT3/4 staining. Hence, SMAD2/3 activation is required not only for maintenance of pluripotency of hESCs cultured in vitro, but it is also required for the maintenance of the OCT3/4-positive compartment of the ICM upon blastocyst outgrowth. Mouse blastocyst outgrowths cultured ex vivo in the presence of the soluble receptors hrActRIB, hrActRIIB and hrCripto showed a similar trend towards loss of the OCT3/4 positive compartment, though less consistently than outgrowths cultured in the presence of SB431542 (data not shown).
| Discussion |
|---|
|
|
|---|
The primary cell fate decision of mammalian development occurs in morula
stage embryos when the outer cells of the embryo form trophoectoderm, which
mediates attachment and implantation into uterine tissue, and the inner cells
form the inner cell mass, which contributes to all the tissues of the embryo
and from which embryonic stem cells are derived (reviewed by
Rossant, 2001
). Our results
indicate a role for TGFß signaling in the maintenance of pluripotency in
the cellular derivatives of the inner cell mass. Although TGFß
superfamily ligands have been shown to contribute to primary cell fate
determination in other vertebrate models, such as the establishment of the
dorsal organizer in Xenopus
(Harland and Gerhart, 1997
), an
input for TGFßs in mammalian embryogenesis has not been well described at
pre-gastrula stages. Studies of ligand and receptor expression suggest that
the TGFß cascade is activated in pre-implantation mouse embryos
(Albano et al., 1993
;
Paria et al., 1992
;
de Sousa Lopes et al., 2003
)
and our analysis of SMAD2 phosphorylation at these stages showed SMAD2/3
activation as early as the four-cell stage. Yet, the role of the TGFß
superfamily in early mammalian embryogenesis is not well understood.
Previous analyses of the role of TGFß signal transduction in early
mammalian embryogenesis have mostly arisen from the study of knockout mice. An
array of null mutations of TGFß signaling components have been made in
the mouse, but among these, very few have an effect before gastrulation and
none affect the establishment and/or maintenance of the stem cell compartment
at peri-implantation stages (reviewed by
Goumans and Mummery, 2000
). For
example, null mutants of SMAD2 or the TGFß/activin/nodal receptor ActRIIB
result in failure of mesoderm formation and malformed primitive streak (Song
et al., 1998). Recently, mice were created with null mutations for both SMAD2
and SMAD3 (Dunn et al., 2004
).
These mice displayed a similar, though more severe, developmental phenotype to
SMAD2-null mutants, with complete failure to form mesoderm or gastrulate. A
striking character of these embryos was the loss of pluripotent epiblast by
E7.5, as measured by OCT3/4 expression, while the formation of extra-embryonic
ectoderm was retained. As extra-embryonic ectoderm arises from trophoectoderm
(Nagy et al., 2003), this double mutant phenotype supports the notion that
proper maintenance of the ICM/epiblast requires an intact SMAD2/3 signaling
pathway, because derivatives of this compartment are lost while
trophoectodermal derivatives are able to form. The double mutant phenotype
also agrees with our finding that the OCT3/4-positive compartment of
blastocyst outgrowths is lost, at the equivalent of E7.0, when SMAD2/3
signaling is globally inhibited (Fig.
4C). From these data, in combination with our results describing
the necessity for SMAD2/3 signaling in maintenance of the undifferentiated
state of hESCs, a paradigm emerges in which SMAD2/3 signaling plays a role in
the maintenance of pluripotent cell types in vivo as well as ex vivo and in
vitro.
Mice deficient for SMAD4, the common SMAD that mediates translocation of
effector SMADs to the nucleus, display a similar phenotype to the SMAD2/3
double knockout, failing to gastrulate or form mesoderm, though OCT3/4
expression in the epiblast of these embryos has not been examined
(Sirard et al., 1998
). It will
be interesting to see whether markers of pluripotency are affected for this
and related phenotypes, both in vivo and upon blastocyst outgrowth. Indeed,
many of the null mutations of TGFß superfamily ligands and receptors
should be reconsidered with respect to their effect on the epiblast.
TGFß signaling has recently been shown by many studies to figure
prominently in the maintenance of the undifferentiated state of hESCs. Among
the factors found to be specifically expressed at high levels in
undifferentiated hESCs are Nodal
(Rosler et al., 2004
),
Cripto, Lefty1 and Lefty2
(Sato et al., 2003
), all
components of TGFß signal transduction. Cripto encodes an
EGF-CFC co-receptor that is essential for responsivity to nodal, and LEFTY1
and LEFTY2 are both inhibitors of nodal signaling. Expression of nodal, LEFTY1
and LEFTY2 has been shown to be high in undifferentiated hESCs and reduced
upon differentiation (Besser,
2004
), and hESCs cultured in recombinant nodal exhibit prolonged
expression of pluripotency markers
(Vallier et al., 2004
).
Furthermore, TGFß has recently been shown to contribute to a cocktail of
growth factors that maintain the undifferentiated state of hESCs in
feeder-free culture (Amit et al.,
2004
) and SMAD1/5 activation by BMP4 is known to induce
trophoblast in the context of CM (Xu et
al., 2002
). Our results extend the role of the TGFß pathway
in the maintenance of the undifferentiated state of hESCs, demonstrating a
requirement for the TGFß/activin/nodal branch downstream of canonical WNT
activation or extrinsic factors present in CM.
The correlation between SMAD1/5 phosphorylation and mitosis we have
described suggests a compelling role for ligands of the BMP/GDF branch of the
TGFß superfamily in cell proliferation. This pathway has been linked to
cell proliferation in other developmental contexts. For example, in
Drosophila, overexpression of the BMP4 homologue dpp
promotes primordial germ cell (PGC) proliferation and causes accumulation of
more PGCs in the Drosophila gonad (Xhu and Zie, 2003). In mice, null
mutations of Alk3, the type I TGFß receptor that mediates
SMAD1/5 activation, exhibit reduced cell proliferation in the epiblast
(Mishina et al., 2002
). In
light of these phenotypes, it is not surprising to see that mitosis in two
further developmental contexts (pre-implantation mouse embryos and
undifferentiated hESCs) is coincident with SMAD1/5 phosphorylation, yet there
is no evidence to support any causal link between the two.
That SMAD2/3 signaling is not required for the LIF or BIO-mediated
maintenance of the undifferentiated state of mESCs underscores the
dissimilarity between hESCs and mESCs. LIF is sufficient to maintain
pluripotency and self-renewal of mESCs, but these cells differentiate when
cultured with LIF in the absence of serum
(Ying et al., 2003
),
suggesting a necessary input from other extrinsic factors. It has recently
been shown that mESC identity can be maintained in cells cultured in the
absence of serum, as long as LIF is supplemented with either BMP4 or the
forced expression of the downstream BMP4 target, Id
(Ying et al., 2003
). This
suggests an essential contribution of the TGFß superfamily to the
maintenance of mESCs, though this contribution activates the SMAD1/5 signaling
cascade that induces differentiation to trophoblast when it is activated in
hESCs (Xu et al., 2002
).
Considering the disparity between our results describing the necessity for
SMAD2/3 activation in the maintenance of pluipotency in ex vivo blastocyst
outgrowths versus mESCs, it is possible that one or both of these paradigms of
`stemness' may not recapitulate the behavior of embryonic stem cells in vivo.
Indeed, this contradiction raises questions about whether ES cells in culture
are an adequate tool for the study of embryonic development.
We have previously demonstrated the ability of BIO to maintain pluripotency
of mESCs and hESCs (Sato et al.,
2004
), and our results describing the character of SMAD1/5 and
SMAD2/3 activation in hESCs extend these findings to implicate a combinatorial
role for the TGFß and WNT signal transduction pathways in the molecular
events that underlie the undifferentiated state. In other model organisms,
namely Xenopus and zebrafish, WNT and TGFß signaling are
believed to converge on the induction of primary cell types. In
Xenopus embryos, for example, the establishment of the organizer has
been shown to result from the dorsally localized coincidence of three events:
stabilization of ß-catenin; SMAD2/3 activation by Xnr proteins; and
inhibition of SMAD1/5 activation by the BMP inhibitors chordin,
noggin and cerberus (Scialli, 2003). Input from both SMAD2/3 and
WNT signaling has been shown to be required for the expression of the BMP
inhibitory organizer genes (Xanthos et
al., 2002
). Undifferentiated hESCs exhibit the same reciprocal
character with respect to SMAD activation shown here, with SMAD2/3 signaling
being active and SMAD1/5 signaling being inhibited. In light of the ability of
BIO to maintain the undifferentiated state of hESCs and the dependence of this
ability on active SMAD2/3 signaling, it is tempting to speculate that the
molecular basis of pluripotent hESC identity may be rooted in a conserved
mechanism of primary cell fate specification evident in lower vertebrates.
Embryonic stem cells are defined by their ability to self renew indefinitely and give rise to all cell types of the embryo, yet they are present for a relatively narrow window of the mammalian life cycle. Maintenance of pluripotency in cultured hESCs results from the integration of multiple signaling inputs to retain this identity through indefinite passages. In demonstrating a requirement for TGFß signaling, we have defined one of the necessary inputs for the maintenance of pluripotency of hESCs. However, the means by which SMAD2/3 activation has its effect are unclear. It remains to be seen what targets of SMAD2/3 activation are involved in mediating the maintenance of the undifferentiated state; and the manner in which WNT signaling and SMAD2/3 activation collaborate to mediate pluripotency, if at all.
| Supplementary material |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Albano, R. M., Groome, N. and Smith, J. (1993). Activins are expressed in preimplantation mouse embryos and in ES and EC cells and are regulated on their differentiation. Development 117,711 -723.[Abstract]
Amit, M., Shariki, C., Margulets, V. and Itskovitz-Eldor, J.
(2004). Feeder layer- and serum-free culture of human embryonic
stem cells. Biol. Reprod.
70,837
-845.
Besser, D. (2004). Expression of Nodal,
Lefty-A, and Lefty-B in undifferentiated human embryonic stem cells requires
activation of Smad2/3. J. Biol. Chem.
279,45076
-45084.
Betts, D., Bordignon, V., Hill, J., Winger, Q., Westhusin, M.,
Smith, L. and King, W. (2001). Reprogramming of
telomerase activity and rebuilding of telomere length in 425 cloned cattle.
Proc. Natl. Acad. Sci. USA
98,1077
-1082.
de Sousa Lopes, S. M., Carvalho, R., van den Driesche, S., Goumans, M., ten Dijke, P. and Mummery, C. (2003). Distribution of phosphorylated Smad2 identifies target tissues of TGF beta ligands in mouse development. Gene. Expr. Patt. 3, 355-360.
Dunn, N. R., Vincent, S., Oxburgh, L., Robertson, E. and Bikkof,
E. (2004). Combinatorial activities of Smad2 and Smad3
regulate mesoderm formation and patterning in the mouse embryo.
Development 131,1717
-1728.
Gilbert, S. F. (2003). In Developmental Biology, 7th edn (ed. S. F. Gilbert), pp. 305-343. Sunderland, MA: Sinauer Associates.
Goumans, M. J. and Mummery, C. (2000). Functional analysis of the TGFbeta receptor/Smad pathway through gene ablation in mice. Int. J. Dev. Biol. 44,253 -265.[Medline]
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol. 13,611 -667.[CrossRef][Medline]
Inman, G., Nicolas, F., Callahan, J., Harling, J., Gaster, L.,
Reith, A., Laping, N. and Hill, C. (2002). SB-431542
is a potent and specific inhibitor of transforming growth factor-B superfamily
Type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7.
Mol. Pharmacol. 62,65
-74.
Laping, N. J., Grygielko, E., Mathur, A., Butter, S., Bomberger,
J., Tweed, C., Martin, W., Fornwald, J., Lehr, R., Harling, J. et
al. (2002). Inhibition of transforming growth factor
(TGF)-beta1-induced extracellular matrix with a novel inhibitor of the
TGF-beta type I receptor kinase activity: SB-431542. Mol.
Pharmacol. 62,58
-64.
Massague, J., Blain, S. and Lo, R. (2000). TGFbeta signaling in growth control, cancer, and heritable disorders. Cell 103,295 -309.[CrossRef][Medline]
Meijer, L., Skaltsounis, A., Magiatis, P., Polychronopoulos, P., Knockaert, M., Leost, M., Ryan, X., Vonica, C., Brivanlou, A., Dajani, R. et al. (2003). GSK-3-selective inhibitors derived from Tyrian purple indirubins. Chem. Biol. 10,1255 -1266.[CrossRef][Medline]
Mishina, Y., Hanks, M., Miura, S., Tallquist, M. and Behringer, R. (2002). Generation of Bmpr/Alk3 conditional knockout mice. Genesis 32,69 -72.[CrossRef][Medline]
Mummery, C. L. and van den Eijnden-van Raaij, A. J. (1993). Type beta transforming growth factors and activins in differentiating embryonal carcinoma cells, embryonic stem cells and early embryonic development. Int. J. Dev. Biol. 37,169 -182.[Medline]
Munoz-Sanjuan, I. and Brivanlou, A. H. (2002). Neural induction, the default model and embryonic stem cells. Nat. Rev. Neurosci. 3,271 -280.[CrossRef][Medline]
Nagy, A. (2003). Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Paria, B. C. and Dey, S. K. (1990).
Preimplantation embryo development in vitro: cooperative interactions among
embryos and role of growth factors. Proc. Natl. Acad. Sci.
USA 87,4756
-4760.
Paria, B. C., Jones, K., Flanders, K. and Dey, S. (1992). Localization and binding of transforming growth factor-beta isoforms in mouse preimplantation embryos and in delayed and activated blastocysts. Dev. Biol. 151,91 -104.[CrossRef][Medline]
Qi, X., Li, T., Hao, J., Hu, J., Wang, J., Simmons, H., Miura,
S., Mishina, Y. and Zhao, G. (2004). BMP4 supports
self-renewal of embryonic stem cells by inhibiting mitogen-activated protein
kinase pathways. Proc. Natl. Acad. Sci. USA
101,6027
-6032.
Reubinoff, B. E., Pera, M., Fong, C., Trounson, A. and Bongso, A. (2000). Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat. Biotechnol. 18,399 -404.[CrossRef][Medline]
Roelen, B. A., Lin, H., Knezevic, V., Freund, E. and Mummery, C. (1994). Expression of TGF-beta s and their receptors during implantation and organogenesis of the mouse embryo. Dev. Biol. 166,716 -728.[CrossRef][Medline]
Roelen, B. A., Goumans, M., Zwijsen, A. and Mummery, C. (1998). Identification of two distinct functions for TGF-beta in early mouse development. Differentiation 64, 19-31.[CrossRef][Medline]
Rosler, E., Fisk, G., Ares, X., Irving, J., Miura, T., Rao, M. and Carpenter, M. (2004). Long-term culture of human embryonic stem cells in feeder-free conditions. Dev. Dyn. 229,259 -274.[CrossRef][Medline]
Rossant, J. (2001). Stem cells from the
mammalian blastocyst. Stem Cells
19,477
-482.
Sato, N., Sanjuan, I., Heke, M., Uchida, M., Naef, F. and Brivanlou, A. (2003). Molecular signature of human embryonic stem cells and its comparison with the mouse. Dev. Biol. 260,404 -413.[CrossRef][Medline]
Sato, N., Meijer, L., Skaltsounis, L., Greengard, P. and Brivanlou, A. (2004). Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat. Med. 10, 55-63.[CrossRef][Medline]
Shi, Y. and Massague, J. (2003). Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113,685 -700.[CrossRef][Medline]
Sirard, C., de la Pompa, J., Elia, A., Itie, A., Mirtsos, C.,
Cheung, A., Hahn, S., Wakeham, A., Schwartz, L., Kern, S. et al.
(1998). The tumor suppressor gene Smad4/Dpc4 is required for
gastrulation and later for anterior development of the mouse embryo.
Genes Dev. 12,107
-119.
Slager, H. G., Lawson, K., van den Eijnden-van Raaij, A., de Laat, S. and Mummery, C. (1991). Differential localization of TGF-beta 2 in mouse preimplantation and early postimplantation development. Dev. Biol. 145,205 -218.[CrossRef][Medline]
Smith, A. G. (2001). Embryo-derived stem cells: of mice and men. Annu. Rev. Cell Dev. Biol. 17,435 -462.[CrossRef][Medline]
Song, J., Oh, S., Schrewe, H., Nomura, M., Lei, H., Okano, M., Gridley, T. and Li, E. (1999). The type II activin receptors are essential for egg cylinder growth, gastrulation, and rostral head development in mice. Dev. Biol. 213,157 -169.[CrossRef][Medline]
Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S., Waknitz, M.,
Swiergiel, J., Marshall, V. and Jones, J. (1998).
Embryonic stem cell lines derived from human blastocysts.
Science 282,1145
-1147.
Vallier, L., Reynolds, D. and Pedersen, R. A. (2004). Nodal inhibits differentiation of human embryonic stem cells along the neuroectodermal default pathway. Dev. Biol. 275,403 -421.[CrossRef][Medline]
Weinstein, M., Yang, X., Li, C., Xu, X., Gotay, J. and Deng,
C. (1998). Failure of egg cylinder elongation and mesoderm
induction in mouse embryos lacking the tumor suppressor smad2.
Proc. Natl. Acad. Sci. USA
95,9378
-9383.
Xanthos, J. B., Kofron, M., Tao, Q., Schaible, K., Wylie, C. and
Heasman, J. (2002). The roles of three signaling
pathways in the formation and function of the Spemann Organizer.
Development 129,4027
-4043.
Xu, R. H., Chen, X., Li, D., Li, R., Addicks, G., Glennon, C., Zwaka, T. and Thomson, J. (2002). BMP4 initiates human embryonic stem cell differentiation to trophoblast. Nat. Biotechnol. 20,1261 -1264.[CrossRef][Medline]
Ying, Q. L., Nichols, J., Chambers, I. and Smith, A. (2003). BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115,281 -292.[CrossRef][Medline]
Zhu, C. H. and Xie, T. (2003). Clonal expansion
of ovarian germline stem cells during niche formation in Drosophila.
Development 130,2579
-2588.
This article has been cited by other articles:
![]() |
Z. Wu, W. Zhang, G. Chen, L. Cheng, J. Liao, N. Jia, Y. Gao, H. Dai, J. Yuan, L. Cheng, et al. Combinatorial Signals of Activin/Nodal and Bone Morphogenic Protein Regulate the Early Lineage Segregation of Human Embryonic Stem Cells J. Biol. Chem., September 5, 2008; 283(36): 24991 - 25002. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Meng, X. Cheng, L. Yang, N. Hou, X. Yang, and A. Meng Accelerated re-epithelialization in Dpr2-deficient mice is associated with enhanced response to TGF{beta} signaling J. Cell Sci., September 1, 2008; 121(17): 2904 - 2912. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sumi, N. Tsuneyoshi, N. Nakatsuji, and H. Suemori Defining early lineage specification of human embryonic stem cells by the orchestrated balance of canonical Wnt/{beta}-catenin, Activin/Nodal and BMP signaling Development, September 1, 2008; 135(17): 2969 - 2979. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yu and J. A. Thomson Pluripotent stem cell lines Genes & Dev., August 1, 2008; 22(15): 1987 - 1997. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Saha, L. Ji, J. J. de Pablo, and S. P. Palecek TGF{beta}/Activin/Nodal Pathway in Inhibition of Human Embryonic Stem Cell Differentiation by Mechanical Strain Biophys. J., May 15, 2008; 94(10): 4123 - 4133. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-M. Postovit, N. V. Margaryan, E. A. Seftor, D. A. Kirschmann, A. Lipavsky, W. W. Wheaton, D. E. Abbott, R. E. B. Seftor, and M. J. C. Hendrix Human embryonic stem cell microenvironment suppresses the tumorigenic phenotype of aggressive cancer cells PNAS, March 18, 2008; 105(11): 4329 - 4334. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Mayshar, E. Rom, I. Chumakov, A. Kronman, A. Yayon, and N. Benvenisty Fibroblast Growth Factor 4 and Its Novel Splice Isoform Have Opposing Effects on the Maintenance of Human Embryonic Stem Cell Self-Renewal Stem Cells, March 1, 2008; 26(3): 767 - 774. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Zhu, J. Q. Boone, P. A. Jensen, S. Hanna, L. Podemski, J. Locke, C. Q. Doe, and M. B. O'Connor Drosophila Activin- and the Activin-like product Dawdle function redundantly to regulate proliferation in the larval brain Development, February 1, 2008; 135(3): 513 - 521. [Abstract] [Full Text] [PDF] |
||||