|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 23 February 2005
doi: 10.1242/dev.01704
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biological Sciences, Purdue University, West Lafayette, IN
47907, USA
2 Department of Biological Sciences, University of Notre Dame, Notre Dame, IN
46556, USA
3 Graduate School of Frontier Biosciences, Osaka University, Toyonaka, Osaka
560-0043, Japan
* Author for correspondence (e-mail: dready{at}bilbo.bio.purdue.edu)
Accepted 18 January 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Rhodopsin, Rab11, Retina, Drosophila
| Introduction |
|---|
|
|
|---|
Surprisingly, these studies on rhodopsin trafficking identified Rab11 as
active in exocytosis. Rab11 is thought to regulate endosomal/plasma membrane
interactions by controlling membrane traffic through recycling endosomes.
These endosomes receive endocytosed plasma membrane and either return it to
the cell surface or direct it to degradative pathways
(Ullrich et al., 1996
). Rab11
localizes to the pericentriolar recycling endosome, the trans-Golgi
network (TGN), and post-Golgi vesicles
(Chen et al., 1998
;
Deretic, 1997
;
Ullrich et al., 1996
).
Dominant-negative Rab11a inhibits apical recycling and basolateral-to-apical
transcytosis in polarized MDCK cells (Wang
et al., 2000
), blocks stimulus-induced recruitment of
endosome-sequestered H+-K+ ATPase-rich membrane to the
apical membrane of acid-secreting parietal cells
(Duman et al., 1999
), and
inhibits exosome release in human leukemic K562 cells
(Savina et al., 2002
). During
cellularization of Drosophila embryos, apical membrane recycled to
the expanding lateral membranes trafficks through Rab11-dependent recycling
endosomes (Pelissier et al.,
2003
).
In addition to these extensive reports linking Rab11 activity to endocytic
pathways, other reports suggest a role for Rab11 in biosynthetic exocytic
membrane traffic. In PC12 cells, Rab11 was detected in association with TGN
and TGN-derived secretory vesicles (Urbe
et al., 1993
). In baby hamster kidney cells, overexpression of
dominant-negative Rab11S25N decreased delivery of the basolaterally targeted
vesicular stomatitis virus (VSV) G protein to the cell surface
(Chen et al., 1998
), and
expression of wild-type Rab11a accelerated delivery of new protease activated
receptors to kidney epithelial cell surfaces following trypsin exposure
(Roosterman et al., 2003
). Of
particular interest to this study, the movement of rhodopsin to the apical
surface may also be dependent on Rab11. Rhodopsin has been detected in
Rab11-positive post-Golgi vesicles of Xenopus retina cell-free
extracts (Deretic, 1997
).
Immature rhodopsin, which is indicative of defective rhodopsin transport,
accumulated in Drosophila photoreceptors that expressed
dominant-negative Rab11N124I
(Satoh, 1998
).
In this study, we characterize the movement of rhodopsin and other rhabdomeric membrane proteins in the developing Drosophila photoreceptor. This experimental system allows us to define the role of Rab11 in this process. We find that vigorous light-dependent endocytosis competes with exocytosis from the outset of rhabdomere morphogenesis. We show that, independent of a requirement in endosomal recycling, Rab11 activity is essential for the initial exocytic rhodopsin delivery to the growing rhabdomere. We also show that loss of Rab11 activity disrupts endocytic pathways, but this is likely to be a secondary consequence of attenuated exocytic delivery. Thus, our results demonstrate Rab11 promotes the trans-Golgi to rhabdomere membrane traffic responsible for elaboration of the sensory membranes of these cells.
| Materials and methods |
|---|
|
|
|---|
Construction of transgenic flies expressing dominant-negative Rab11N124I, Rab11 dsRNA and CFP-Golgi
Rab11N124I substitutes isoleucine for asparagine at amino acid
124 within the third conserved region required for guanine nucleotide binding.
A similar substitution in mammalian Rab11 acts as an inhibitor for Rab11 when
expressed in gastric parietal or MDCK cells
(Duman et al., 1999
;
Wang et al., 2000
). To create
the Rab11N124I gene, Quick Change site-directed
mutagenesis (Stratagene) was used according to the manufacturer's manual using
primers: DRab11 M1-F1, CTGGTGGGCATCAAGTCCGAC; and DRab11 M1-R1,
GTCGGACTTGATGCCCACCAG. The Rab11N124I mutant cDNA
was inserted into pUAST. For Rab11 RNAi, complementary 403 bp fragments of
Rab11 cDNA were amplified using primers: RAB11-D,
GGGCTCGAGGTGAGCCAACGACAAACGC; RAB11-F, GGGCCTAGGGGCACCGCGGTAGTAGGCAG; RAB11-E,
GGGGCTAGCGTGAGCCAACGACAAACGC; and RAB11-F. The resulting fragments were
inserted into the RNAi vector, pWIZ, a kind gift from Dr Richard Carthew
(Northwestern University) (Lee and
Carthew, 2003
). To make Golgi-marked flies, the
NheI/NotI fragment containing the entire coding sequence of
CFP-Golgi fusion protein was cut from CFP-Golgi vector (Clontech) and inserted
to pUAST. pUAST-Rab11N124I and pUAST-CFP-Golgi
were transformed into Drosophila and insertion strains containing a
single copy of each transgene were generated by standard means
(Spradling, 1986
). Immunoblot
analysis and immunohistochemistry (data not shown) confirmed Rab11N124I
protein expression by hs-Gal4. CFP-galactosyl transferase colocalized with a
Drosophila Golgi-specific antibody
(Stanley et al., 1997
) (data
not shown).
Generation of anti Drosophila Rab11 and Rh1 antibodies
6xHis-Rab11 fusion proteins were expressed in E. coli cells,
purified on polyhistidine affinity resin (Qiagen) and injected into mice. The
Rab11 antiserum generated in this way recognizes a single 27 kDa protein in
fly head homogenate when assayed on protein blots. This antiserum recognizes
the 6xHis-Rab11 fusion protein but does not recognize E.
coli-expressed 6xHis-Rab1, 6xHis-Rab2, 6xHis-Rab6 or 6xHis-RabRP4. Rabbit
anti-Rab11 was also raised against 6xHis-Rab11. This antibody recognizes Rab11
in western blots. Rabbit affinity-purified anti-Rh1 antibody was raised
against the Rh1 (21-36) peptide GSVVDKVTPDMAHLIS. The antibody recognizes Rh1
in western blots, and, unlike the previously characterized 4C5 anti-Rh1
monoclonal antibody, its epitope is not masked by arrestin binding to
rhodopsin (Orem and Dolph,
2002
).
Immunohistochemistry
Fixation and staining methods are described elsewhere
(Fan and Ready, 1997
). For
fixation of dark-reared flies, eyes were dissected using infrared illumination
and image intensifier eyepieces. Primary antisera were: mouse anti-Rab11
(1:250) (this report), Rabbit anti-Rab11 (1:1000), mouse anti-Rab1 (1:500)
(Satoh et al., 1997
), mouse
monoclonal anti-Rh1 (4C5) (1:50 supernatant) (DSHB), rabbit anti-Rh1 (1:1000)
(this report), rabbit anti-TRP (1:2000) (gift from Dr Craig Montell), guinea
pig anti-Hrs (1:2000) (gift from Dr Hugo Bellen), chicken anti-GFP (Chemicon)
or rabbit anti-GFP (1:2000) (MBL International Corporation). Secondary
antibodies were anti-mouse and/or anti-rabbit labeled with Alexa488, Alexa647
(1:300) (Molecular Probes), Cy2 (1:500) or Cy5 (1:150) (Amersham-Pharmacia).
Samples were examined and images recorded using a BioRad MRC1024 confocal
microscope (Nikon 60x, 1.4NA lens). To minimize bleed through, each
signal in double or triple stained samples was imaged separately using a
single line and then merged. Acquired images were processed by image J and/or
Photoshop 5.5. Anti-Hook (gift from Dr Helmut Kramer) and anti-LBPA (gift from
Dr Jean Gruenberg), antibodies that stain MVBs in other cells, did not show
any signal in photoreceptors. CFP-labeled Golgi were triple immunostained
using mouse anti-Rab1, rabbit anti-Rab11 and chicken anti-GFP to determine
Rab11 cisternal association.
Synchronous release of Rh1 accumulated in the ER
Flies were raised from egg to 2nd or 3rd instar larvae on
carotenoid-deprived food, and then crystalline all-trans-retinal (Sigma) was
added to the media; cultures were kept in constant dark. These conditions
allowed for development of pupae in which the 40 K intermediate of rhodopsin
accumulated within the ER. Late stage, dark-winged pupae were then irradiated
with blue light (410 nm) using a CFP filter on a 50 W Hg lamp to isomerize the
all-trans retinal to the 11-cis-form and initiate rhodopsin maturation.
Electron microscopy
Conventional electron microscopic methods have been described previously
(Satoh et al., 1997
). For
immunoelectron microscopy, heads were dissected and incubated in PLP fixative
(2% paraformaldehyde, 0.075 M lysine, 0.01 M NaIO4, PBS pH 7.4)
with 0.1% glutaraldehyde for 2 hours. The heads were then postfixed in 0.5%
OsO4, in 0.75% K4Fe (CN)6 in 0.1 M cacodylate
buffer (pH 7.4) for 30 minutes on ice, serial dehydrated in alcohol and
embedded in LR-White (Electron Microscopy Sciences). Ultrathin sections
(silver or gray) were etched by saturated solution of sodium meta-periodate
for 30 minutes. For immunogold labeling of the sections, specimens were
reacted overnight at 4°C with mouse anti-Rh1 (4C5) (1:20 ascites), and
then reacted overnight at 4°C with anti-mouse IgG-15 nm gold conjugates
(1:40, British Bio Cell International). Samples were observed on a Philips 300
electron microscope.
Organelle counts
The number of RLVs, defined as rhodopsin-positive, spherical vesicles
>400 nm was counted in 10 flies: wild type, 0.67 (s.d.=0.13);
Rab11N124I photoreceptor, 0.074 (s.d.=0.054). The number
of MVBs, defined as >300nm spherical vesicles with at least four internal
vesicles, was counted in five flies: wild type, 0.49 (s.d.=0.06);
Rab11N124I photoreceptor, 0.0013 (s.d.=0.015).
Endocytic tracer uptake in Garland cells
Garland cells were dissected in the Drosophila standard saline,
and incubated for 10 minutes with 20 mg/ml Texas Red-conjugated avidin
(Molecular Probes). Garland cells were fixed immediately after a brief
wash.
| Results |
|---|
|
|
|---|
50% and 60% of pupal development (% pd), nascent rhabdomeres
begin to load with TRP (Fig.
1A), a light-activated Ca2+ channel that serves
phototransduction (Hardie and Raghu,
2001
|
|
To investigate this possibility, we observed Rh1 transport in dark-reared flies (Fig. 3A). Rh1 begins to accumulate in the rhabdomere just after Rh1 expression starts at 70% pd. There are few RLVs in all stages in dark-reared flies. RLVs form within 30 minutes of light exposure, and disappear within 13 hours of return to dark (Fig. 3B). These observations suggest that in light-reared flies, Rh1 is first transported to the rhabdomere, but light-induced internalization quickly transports Rh1 into RLVs. Thus, even during the developmental period in which the photoreceptor cell is increasing rhabdomeric volume and Rh1 content, vigorous endocytosis can exceed the rate of biosynthetic delivery of Rh1.
|
|
These immunofluorescence results suggest Rh1, upon exit from the ER,
associates first with the Golgi, then within Rab11-positive vesicles, before
being deposited in the rhabdomere. Thus, the Rab11 localization is consistent
with a role in TGN
rhabdomere transport. Transport visualized in these
studies is completed by 180 minutes (Fig.
3D), in good agreement with previous immunoblot data showing
intermediate Rh1 is completely processed into mature 35K Rh1 within 180
minutes (Satoh et al., 1997
).
RLVs are not prominent at any time during ER
rhabdomere transport,
consistent with the proposal that RLVs do not participate in biosynthetic
traffic.
Rab11 activity is essential for Rh1 transport to rhabdomere and MVB formation
To further evaluate the role of Rab11 in Rh1 transport, we investigated Rh1
transport in Rab11 mutants. As animals lacking Rab11 die as embryos
(Dollar et al., 2002
;
Jankovics et al., 2001
), we
made mosaic animals with eyes containing a mixture of normal photoreceptors
and photoreceptors with severely reduced Rab11. Comparatively few Rab11 mutant
photoreceptors were observed in mosaic eyes, probably reflecting a
cell-essential role for the protein. Rab11-reduced photoreceptors fail to
transport Rh1 to the rhabdomere (Fig.
5A). Mutant rhabdomeres are reduced in size and a profusion of
vesicles fills the photoreceptor cytoplasm
(Fig. 5B,C). These cells lack
normal globular MVBs, but contain infrequent, irregular vesicular organelles
resembling defective MVBs (Fig.
5D). Other vesicular compartments, including ER and Golgi, retain
normal appearance.
|
|
|
Simultaneous expression of Rab11N124I and Rab5N142I allowed us to determine if the Rab11N124I phenotype is the result of absence of Rab11 activity prior to TRP and Rh1 delivery to the rhabdomere, or after endocytic removal of these two proteins from the rhabdomere. If the TRP and Rh1 vesicles accumulating in cytoplasm upon Rab11N124I expression are endocytosed from the rhabdomere, Rab5N142I expression should inhibit their biogenesis. Fig. 7D,G show that this is not the case; numerous cytoplasmic TRP- or Rh1-bearing vesicles accumulate and rhabdomeres do not stain for TRP and Rh1.
The interpretation of these results could be complicated by consideration
that guanine-nucleotide-deficient small GTPase dominant negatives sequester
activating GEF proteins (Feig,
1999
), and crosstalk may exist among RabGEF signaling pathways.
However, the fidelity with which Rab11N124I recapitulates
genetic and RNAi Rab11 loss, the observation that
Rab5N142I mutant shows the expected endocytic defect, and
the marked contrast in the Rab11N124I and
Rab5N142I individual phenotypes, suggest these dominant
negatives do generate a specific loss of function for each of these genes.
From this perspective, the failure of Rab5N142I expression
to impact the Rab11N124I phenotype argues Rab11 is
required upstream of Rab5 and prior to the initial delivery of TRP and Rh1 to
the rhabdomere.
We also observed that Golgi morphology visualized by CFP-galactosyl transferase in confocal microscopy was unaffected in Rab11N124I photoreceptors (Fig. 7I,J). These data, in agreement with the localization studies, suggest Rab11 is required for a post-Golgi step in rhodopsin and TRP movement to the rhabdomere.
Rab11 has an indirect role in MVB formation
The proposed role of Rab11 in delivery of membrane proteins to the
rhabdomere does not account for the loss of MVBs in the Rab11 mutant
photoreceptors. It is possible that loss of Rab11 activity depletes the
rhabdomere of Rh1 and other membrane proteins, and the lack of protein in
these membranes limits the rate of endocytosis and MVB formation. To
investigate this possibility more directly, we examined the effect of
Rab11N124I on uptake of an endocytic tracer, Texas Red-conjugated
avidin (TR-avidin), by larval Garland cells, large and easily accessible
endocytic specialists (Chang et al.,
2002
; Kosaka and Ikeda,
1983
). In normal cells, internalized TR-avidin could be seen in
peripheral, vesicular structures 10 minutes after exposure to TR-avidin,
(Fig. 8A). In Garland cells
expressing Rab11N124I, however, TR-avidin is not
internalized (Fig. 8B).
|
| Discussion |
|---|
|
|
|---|
Rab11 has previously been implicated in control of membrane traffic through
the pericentriolar recycling endosome. In cultured baby hamster kidney (BHK)
cells, return of internalized transferrin receptor to the cell surface is
inhibited by dominant-negative Rab11 expression
(Ullrich et al., 1996
). During
cellularization of Drosophila embryos, apical membrane redeployed to
the growing basolateral surface transits a Rab11-dependent recycling endosome
(Pelissier et al., 2003
).
Rab11 has also been implicated in trans-Golgi to plasma membrane
transport. In non-polarized BHK cells in culture, expression of
dominant-negative Rab11S25N inhibited transport of a basolateral marker
protein marker, vesicular stomatitis virus G protein, but had no impact on
delivery of an apical marker protein, influenza hemagglutinin
(Chen et al., 1998
). Recent
observation that recycling endosomes can serve as an intermediate during
transport from the Golgi to MDCK cell plasma membranes
(Ang et al., 2004
) raises the
possibility that biosynthetic traffic transits a recycling endosome and the
site of Rab11 action is at the recycling endosome. However, we observed no
pericentriolar endosome in Drosophila photoreceptors, and that Rh1
moved directly from the trans-Golgi to the rhabdomere when released
into the biosynthetic pathway by blue light. Thus, there is no evidence for
Rh1 moving through an intermediate compartment when en route to the
rhabdomere.
Rh1-bearing post-Golgi vesicles and recycling endosome-derived vesicles may
both traffick to the cell surface because they share common Rab11 effectors.
Rab11 interacts with unconventional class V myosins and expression of
dominant-negative Myo-Vb inhibits delivery from early endosomes to the cell
surface (Lapierre et al.,
2001
). An extensive F-actin terminal web, the RTW, extends from
the rhabdomere base into photoreceptor cell cytoplasm
(Chang and Ready, 2000
) and
disruption of the photoreceptor actin cytoskeleton inhibits the vesicular
traffic that builds crab rhabdomeres
(Matsushita and Arikawa,
1996
). Rab11, together with a Myo-V effector, may promote
post-Golgi vesicle motility along the actin RTW to focus delivery to the
rhabdomere.
Loss of Rab11 activity also disrupts normal photoreceptor MVB morphology.
MVBs are often identified as late endosomal compartments, delivering cargo
destined for lysosomal degradation
(Gruenberg, 2001
;
Katzmann et al., 2002
;
Kramer, 2002
). However,
several recent studies show MVBs can be also exocytic carriers, delivering
endosomal contents to the cell surface. Examples include the secretory
lysosomes of immune system cells
(Griffiths, 2002
), melanosomes
of pigment cells (Marks and Seabra,
2001
), exosomes of maturing red blood cells
(Johnstone et al., 1991
) and
secreted vesicles mediating cell-cell signaling
(Denzer et al., 2000
;
Seto et al., 2002
). The
accumulation of newly synthesized MHCII receptors within MVBs of unstimulated
dendritic cells, and the stimulus-induced reorganization of MVBs and
appearance of MHCII receptors at the plasma membrane, led to consideration of
MVBs as an exocytic compartment (Kleijmeer
and Raposo, 2001
). Autoradiography of crayfish eyes following
3H-leucine injection showed newly synthesized protein first in the
cytoplasm, then in MVBs and then in rhabdomere rhabdomeres
(Hafner and Bok, 1977
),
prompting the conjecture that MVBs are a post-Golgi organelle of biosynthetic
traffic (Piekos, 1987
).
The work reported here discounts the possibility that MVBs are exocytic
vesicles in Drosophila photoreceptors. First, we show that appearance
of Rh1 in the MVBs is dependent on light treatment. Previously, light was
shown to trigger endocytosis of rhabdomeric membrane
(Blest, 1980
;
Xu et al., 2004
), so this
light dependency suggests MVBs originate from an endocytic process. Second,
depletion of Rab5 activity, which is known to regulate the fusion between
endocytic vesicles and early endosomes, also eliminates Rh1 and TRP containing
MVBs, without affecting Rh1 and TRP transport to the rhabdomere. Thus, all the
results support the view that MVBs are endocytic vesicles. The early and rapid
appearance of Rh1 and TRP in these vesicles is remarkable, showing that the
machinery of light-dependent receptor internalization is fully operational at
the outset of morphogenesis. Vigorous light-dependent endocytosis competes
with exocytosis from the outset of rhabdomere morphogenesis, internalizing
rhodopsin and TRP from the growing sensory membrane even as exocytosis expands
it.
Rab5 loss-of-function analysis also supports the view that Rab11 acts before Rab5. In Rab5, Rab11 double mutants, photoreceptors retain the Rab11 phenotype. These results are consistent with a role of Rab11 in the exocytic process, but not with an exclusive role in endocytic recycling. Yet, we have also shown that Rab11 activity is required for accumulation of MVBs. We propose that this is an indirect effect of the Rab11 requirement in the exocytic pathway. Rab11 inhibition `starves' the rhabdomere, the target of Rab11-mediated transport, of required proteins, which in turn slows the rate of endocytosis and eliminates endocytosis-dependent MVBs. In support of this view, we have shown that Rab11 activity is required for the presence of labyrinthine channels on Garland cells, membrane specializations that promote vigorous endocytosis. Rab11 loss plausibly depletes membrane components that sustain vigorous endocytosis.
Drosophila and vertebrate photoreceptors share fundamental
cellular and molecular mechanisms and Rab family members and their functions
are strongly conserved across eukaryotes
(Pereira-Leal and Seabra,
2001
). Rab11 has been identified in rhodopsin-containing
post-Golgi vesicles formed within a vertebrate retina cell-free system
(Deretic, 1997
), raising the
likelihood vertebrate photoreceptors also contain a Rab11-dependent vesicular
compartment essential for rhodopsin transport and outer segment development.
Failure to traffic Rh1 in Drosophila leads to retinal degeneration
(Colley et al., 1995
;
Green et al., 2000
;
Kurada et al., 1998
), and
similar mechanisms are implicated in rhodopsin mutations and other mutations
causing the human disease retinitis pigmentosa
(Sung and Tai, 2000
;
Trudeau and Zagotta, 2002
).
The involvement of Rab11 in the post-Golgi processes provides an entry point
to discover the cellular components and pathways responsible for elaborating
the specialized photosensitive membranes. These events are likely to be key
regulators of normal cellular development and the triggering events of retinal
disease.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ang, A. L., Taguchi, T., Francis, S., Folsch, H., Murrells, L.
J., Pypaert, M., Warren, G. and Mellman, I. (2004).
Recycling endosomes can serve as intermediates during transport from the Golgi
to the plasma membrane of MDCK cells. J. Cell Biol.
167,531
-543.
Bache, K. G., Brech, A., Mehlum, A. and Stenmark, H.
(2003). Hrs regulates multivesicular body formation via ESCRT
recruitment to endosomes. J. Cell Biol.
162,435
-442.
Blest, A. D. (1980). The effects of constant light on visual processes. In Photoreceptor Membrane Turnover in Arthropods: Comparative Studies of Breakdown Processes and their Implications (ed. P. Williams and N. Baker), pp.217 -245. New York: Plenum Press.
Chang, H. C., Newmyer, S. L., Hull, M. J., Ebersold, M., Schmid,
S. L. and Mellman, I. (2002). Hsc70 is required for
endocytosis and clathrin function in Drosophila. J. Cell
Biol. 159,477
-487.
Chang, H. Y. and Ready, D. F. (2000). Rescue of
photoreceptor degeneration in rhodopsin-null Drosophila mutants by activated
Rac1. Science 290,1978
-1980.
Chen, W., Feng, Y., Chen, D. and Wandinger-Ness, A.
(1998). Rab11 is required for trans-golgi network-to-plasma
membrane transport and a preferential target for GDP dissociation inhibitor.
Mol. Biol. Cell 9,3241
-3257.
Colley, N. J., Cassill, J. A., Baker, E. K. and Zuker, C. S.
(1995). Defective intracellular transport is the molecular basis
of rhodopsin-dependent dominant retinal degeneration. Proc. Natl.
Acad. Sci. USA 92,3070
-3074.
Deneka, M., Neeft, M. and van der Sluijs, P. (2003). Regulation of membrane transport by rab GTPases. Crit. Rev. Biochem. Mol. Biol. 38,121 -142.[Medline]
Denzer, K., Kleijmeer, M. J., Heijnen, H. F., Stoorvogel, W. and Geuze, H. J. (2000). Exosome: from internal vesicle of the multivesicular body to intercellular signaling device. J. Cell Sci. 113,3365 -3374.[Abstract]
Deretic, D. (1997). Rab proteins and post-Golgi trafficking of rhodopsin in photoreceptor cells. Electrophoresis 18,2537 -2541.[CrossRef][Medline]
Deretic, D., Huber, L. A., Ransom, N., Mancini, M., Simons, K. and Papermaster, D. S. (1995). rab8 in retinal photoreceptors may participate in rhodopsin transport and in rod outer segment disk morphogenesis. J. Cell Sci. 108,215 -224.[Abstract]
Dollar, G., Struckhoff, E., Michaud, J. and Cohen, R. S. (2002). Rab11 polarization of the Drosophila oocyte: a novel link between membrane trafficking, microtubule organization, and oskar mRNA localization and translation. Development 129,517 -526.
Duman, J. G., Tyagarajan, K., Kolsi, M. S., Moore, H. P. and Forte, J. G. (1999). Expression of rab11a N124I in gastric parietal cells inhibits stimulatory recruitment of the H+-K+-ATPase. Am. J. Physiol. 277,361 -372.
Entchev, E. V., Schwabedissen, A. and Gonzalez-Gaitan, M. (2000). Gradient formation of the TGF-beta homolog Dpp. Cell 103,981 -991.[CrossRef][Medline]
Fan, S. S. and Ready, D. F. (1997). Glued participates in distinct microtubule-based activities in Drosophila eye development. Development 124,1497 -1507.[Abstract]
Feig, L. A. (1999). Tools of the trade: use of dominant-inhibitory mutants of Ras-family GTPases. Nat. Cell Biol. 1,E25 -E27.[CrossRef][Medline]
Green, E. S., Menz, M. D., LaVail, M. M. and Flannery, J. G.
(2000). Characterization of rhodopsin mis-sorting and
constitutive activation in a transgenic rat model of retinitis pigmentosa.
Invest. Ophthalmol. Vis. Sci.
41,1546
-1553.
Griffiths, G. (2002). What's special about secretory lysosomes? Semin. Cell Dev. Biol. 13,279 -284.[CrossRef][Medline]
Gruenberg, J. (2001). The endocytic pathway: a mosaic of domains. Nat. Rev. Mol. Cell Biol. 2, 721-730.[CrossRef][Medline]
Hafner, G. S. and Bok, D. (1977). Distribution of leucine-H-3 labeled protein in retinula cells of crayfish retina. J. Comp. Neurol. 174,397 -416.[CrossRef][Medline]
Hardie, R. C. and Raghu, P. (2001). Visual transduction in Drosophila. Nature 413,186 -193.[CrossRef][Medline]
Jankovics, F., Sinka, R. and Erdelyi, M.
(2001). An interaction type of genetic screen reveals a role of
the Rab11 gene in oskar mRNA localization in the developing Drosophila
melanogaster oocyte. Genetics
158,1177
-1188.
Johnstone, R. M., Mathew, A., Mason, A. B. and Teng, K. (1991). Exosome formation during maturation of mammalian and avian reticulocytes: evidence that exosome release is a major route for externalization of obsolete membrane proteins. J. Cell Physiol. 147,27 -36.[CrossRef][Medline]
Karagiosis, S. A. and Ready, D. F. (2004).
Moesin contributes an essential structural role in Drosophila photoreceptor
morphogenesis. Development
131,725
-732.
Katzmann, D. J., Odorizzi, G. and Emr, S. D. (2002). Receptor downregulation and multivesicular-body sorting. Nat. Rev. Mol. Cell Biol. 3, 893-905.[CrossRef][Medline]
Kleijmeer, M. J. and Raposo, G. (2001). Endocytosis and antigen presentation. In Endocytosis (ed. M. Marsh), pp. 168-203. Oxford, UK: Oxford University Press.
Kosaka, T. and Ikeda, K. (1983). Reversible
blockage of membrane retrieval and endocytosis in the garland cell of the
temperature-sensitive mutant of Drosophila melanogaster, shibirets1.
J. Cell Biol. 97,499
-507.
Kramer, H. (2002). Sorting out signals in fly endosomes. Traffic 3,87 -91.[CrossRef][Medline]
Kurada, P., Tonini, T. D., Serikaku, M. A., Piccini, J. P. and O'Tousa, J. E. (1998). Rhodopsin maturation antagonized by dominant rhodopsin mutants. Vis. Neurosci. 15,693 -700.[CrossRef][Medline]
Lapierre, L. A., Kumar, R., Hales, C. M., Navarre, J., Bhartur,
S. G., Burnette, J. O., Provance, D. W., Jr, Mercer, J. A., Bahler, M.
and Goldenring, J. R. (2001). Myosin vb is associated with
plasma membrane recycling systems. Mol. Biol. Cell
12,1843
-1857.
Lee, Y. S. and Carthew, R. W. (2003). Making a better RNAi vector for Drosophila: use of intron spacers. Methods 30,322 -329.[CrossRef][Medline]
Li, H. S. and Montell, C. (2000). TRP and the
PDZ protein, INAD, form the core complex required for retention of the
signalplex in Drosophila photoreceptor cells. J. Cell
Biol. 150,1411
-1422.
Li, T., Snyder, W. K., Olsson, J. E. and Dryja, T. P.
(1996). Transgenic mice carrying the dominant rhodopsin mutation
P347S: evidence for defective vectorial transport of rhodopsin to the outer
segments. Proc. Natl. Acad. Sci. USA
93,14176
-14181.
Liu, X., Wu, T. H., Stowe, S., Matsushita, A., Arikawa, K., Naash, M. I. and Williams, D. S. (1997). Defective phototransductive disk membrane morphogenesis in transgenic mice expressing opsin with a mutated N-terminal domain. J. Cell Sci. 110,2589 -2597.[Abstract]
Lloyd, T. E., Atkinson, R., Wu, M. N., Zhou, Y., Pennetta, G. and Bellen, H. J. (2002). Hrs regulates endosome membrane invagination and tyrosine kinase receptor signaling in Drosophila. Cell 108,261 -269.[CrossRef][Medline]
Longley, R. L., Jr and Ready, D. F. (1995). Integrins and the development of three-dimensional structure in the Drosophila compound eye. Dev. Biol. 171,415 -433.[CrossRef][Medline]
Marks, M. S. and Seabra, M. C. (2001). The melanosome: membrane dynamics in black and white. Nat. Rev. Mol. Cell Biol. 2,738 -748.[CrossRef][Medline]
Matsushita, A. and Arikawa, K. (1996). Disruption of actin filament organization by cytochalasin D inhibits rhabdome synthesis in the compound eye of the crab Hemigrapsus sanguineus. Cell Tiss. Res. 286,167 -174.[CrossRef]
Moritz, O. L., Tam, B. M., Hurd, L. L., Peranen, J., Deretic, D.
and Papermaster, D. S. (2001). Mutant rab8 Impairs
docking and fusion of rhodopsin-bearing post-Golgi membranes and causes cell
death of transgenic Xenopus rods. Mol. Biol.
Cell 12,2341
-2351.
Orem, N. R. and Dolph, P. J. (2002). Epitope masking of rhabdomeric rhodopsin during endocytosis-induced retinal degeneration. Mol. Vis. 8, 455-461.[Medline]
Ozaki, K., Nagatani, H., Ozaki, M. and Tokunaga, F. (1993). Maturation of major Drosophila rhodopsin, ninaE, requires chromophore 3-hydroxyretinal. Neuron 10,1113 -1119.[CrossRef][Medline]
Pelham, R. J., Jr and Chang, F. (2001). Role of actin polymerization and actin cables in actin-patch movement in Schizosaccharomyces pombe. Nat. Cell Biol. 3, 235-244.[CrossRef][Medline]
Pelissier, A., Chauvin, J. P. and Lecuit, T. (2003). Trafficking through Rab11 endosomes is required for cellularization during Drosophila embryogenesis. Curr. Biol. 13,1848 -1857.[CrossRef][Medline]
Pereira-Leal, J. B. and Seabra, M. C. (2001). Evolution of the Rab family of small GTP-binding proteins. J. Mol. Biol. 313,889 -901.[CrossRef][Medline]
Piekos, W. B. (1987). Multivesicular body formation and function in the light-adapted crayfish retina a new interpretation. Cell Tiss. Res. 249,541 -546.
Raiborg, C., Rusten, T. E. and Stenmark, H. (2003). Protein sorting into multivesicular endosomes. Curr. Opin. Cell Biol. 15,446 -455.[CrossRef][Medline]
Roosterman, D., Schmidlin, F. and Bunnett, N. W.
(2003). Rab5a and rab11a mediate agonist-induced trafficking of
protease-activated receptor 2. Am. J. Physiol. Cell
Physiol. 284,C1319
-C1329.
Rozelle, A. L., Machesky, L. M., Yamamoto, M., Driessens, M. H., Insall, R. H., Roth, M. G., Luby-Phelps, K., Marriott, G., Hall, A. and Yin, H. L. (2000). Phosphatidylinositol 4,5-bisphosphate induces actin-based movement of raft-enriched vesicles through WASP-Arp2/3. Curr. Biol. 10,311 -320.[CrossRef][Medline]
Satoh, A. K. (1998). Rab proteins involved in the rhodopsin transport in Drosophila. In Department of Biology, pp. 124. Osaka: Osaka University.
Satoh, A. K., Tokunaga, F., Kawamura, S. and Ozaki, K. (1997). In situ inhibition of vesicle transport and protein processing in the dominant negative Rab1 mutant of Drosophila. J. Cell Sci. 110,2943 -2953.[Abstract]
Savina, A., Vidal, M. and Colombo, M. I.
(2002). The exosome pathway in K562 cells is regulated by Rab11.
J. Cell Sci. 115,2505
-2515.
Seto, E. S., Bellen, H. J. and Lloyd, T. E.
(2002). When cell biology meets development: endocytic regulation
of signaling pathways. Genes Dev.
16,1314
-1336.
Shetty, K. M., Kurada, P. and O'Tousa, J. E.
(1998). Rab6 regulation of rhodopsin transport in Drosophila.
J. Biol. Chem. 273,20425
-20430.
Shimizu, H., Kawamura, S. and Ozaki, K. (2003).
An essential role of Rab5 in uniformity of synaptic vesicle size.
J. Cell Sci. 116,3583
-3590.
Spradling, A. C. (1986). P element-mediated transformation. In Drosophila a Practical Approach (ed. D. B. Roberts), pp.175 -196. Oxford, UK: IRL Press.
Sriram, V., Krishnan, K. S. and Mayor, S.
(2003). deep-orange and carnation define distinct stages in late
endosomal biogenesis in Drosophila melanogaster. J. Cell
Biol. 161,593
-607.
Stanley, H., Botas, J. and Malhotra, V. (1997).
The mechanism of Golgi segregation during mitosis is cell type-specific.
Proc. Natl. Acad. Sci. USA
94,14467
-14470.
Stowers, R. S. and Schwarz, T. L. (1999). A
genetic method for generating Drosophila eyes composed exclusively of mitotic
clones of a single genotype. Genetics
152,1631
-1639.
Sung, C. H., Makino, C., Baylor, D. and Nathans, J. (1994). A rhodopsin gene mutation responsible for autosomal dominant retinitis pigmentosa results in a protein that is defective in localization to the photoreceptor outer segment. J. Neurosci. 14,5818 -5833.[Abstract]
Sung, C. H. and Tai, A. W. (2000). Rhodopsin trafficking and its role in retinal dystrophies. Int. Rev. Cytol. 195,215 -267.[Medline]
Trudeau, M. C. and Zagotta, W. N. (2002). An intersubunit interaction regulates trafficking of rod cyclic nucleotide-gated channels and is disrupted in an inherited form of blindness. Neuron 34,197 -207.[CrossRef][Medline]
Ullrich, O., Reinsch, S., Urbe, S., Zerial, M. and Parton, R.
G. (1996). Rab11 regulates recycling through the
pericentriolar recycling endosome. J. Cell Biol.
135,913
-924.
Urbe, S., Huber, L. A., Zerial, M., Tooze, S. A. and Parton, R. G. (1993). Rab11, a small GTPase associated with both constitutive and regulated secretory pathways in PC12 cells. FEBS Lett. 334,175 -182.[CrossRef][Medline]
Wang, X., Kumar, R., Navarre, J., Casanova, J. E. and
Goldenring, J. R. (2000). Regulation of vesicle trafficking
in madin-darby canine kidney cells by Rab11a and Rab25. J. Biol.
Chem. 275,29138
-29146.
Xu, H., Lee, S. J., Suzuki, E., Dugan, K. D., Stoddard, A., Li, H. S., Chodosh, L. A. and Montell, C. (2004). A lysosomal tetraspanin associated with retinal degeneration identified via a genome-wide screen. EMBO J. 23,811 -822.[CrossRef][Medline]
Xu, T. and Rubin, G. M. (1993). Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117,1223 -1237.[Abstract]
Zerial, M. and McBride, H. (2001). Rab proteins as membrane organizers. Nat. Rev. Mol. Cell Biol. 2, 107-117.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
P. Raghu, E. Coessens, M. Manifava, P. Georgiev, T. Pettitt, E. Wood, I. Garcia-Murillas, H. Okkenhaug, D. Trivedi, Q. Zhang, et al. Rhabdomere biogenesis in Drosophila photoreceptors is acutely sensitive to phosphatidic acid levels J. Cell Biol., April 6, 2009; 185(1): 129 - 145. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. Harris and U. Tepass Cdc42 and Par proteins stabilize dynamic adherens junctions in the Drosophila neuroectoderm through regulation of apical endocytosis J. Cell Biol., December 15, 2008; 183(6): 1129 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Khandelwal, W. G. Ruiz, E. Balestreire-Hawryluk, O. A. Weisz, J. R. Goldenring, and G. Apodaca Rab11a-dependent exocytosis of discoidal/fusiform vesicles in bladder umbrella cells PNAS, October 14, 2008; 105(41): 15773 - 15778. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sato, B. D. Grant, A. Harada, and K. Sato Rab11 is required for synchronous secretion of chondroitin proteoglycans after fertilization in Caenorhabditis elegans J. Cell Sci., October 1, 2008; 121(19): 3177 - 3186. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Nilsen, S. Deininger, U. Nonstad, F. Skjeldal, H. Husebye, D. Rodionov, S. von Aulock, T. Hartung, E. Lien, O. Bakke, et al. Cellular trafficking of lipoteichoic acid and Toll-like receptor 2 in relation to signaling; role of CD14 and CD36 J. Leukoc. Biol., July 1, 2008; 84(1): 280 - 291. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Bulgakova, O. Kempkens, and E. Knust Multiple domains of Stardust differentially mediate localisation of the Crumbs-Stardust complex during photoreceptor development in Drosophila J. Cell Sci., June 15, 2008; 121(12): 2018 - 2026. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. I. Miura, J.-Y. Roignant, M. Wassef, and J. E. Treisman Myopic acts in the endocytic pathway to enhance signaling by the Drosophila EGF receptor Development, June 1, 2008; 135(11): 1913 - 1922. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Giansanti, G. Belloni, and M. Gatti Rab11 Is Required for Membrane Trafficking and Actomyosin Ring Constriction in Meiotic Cytokinesis of Drosophila Males Mol. Biol. Cell, December 1, 2007; 18(12): 5034 - 5047. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Luo, Y. Wang, and G. Reiser p24A, a Type I Transmembrane Protein, Controls ARF1-dependent Resensitization of Protease-activated Receptor-2 by Influence on Receptor Trafficking J. Biol. Chem., October 12, 2007; 282(41): 30246 - 30255. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Devergne, C. Ghiglione, and S. Noselli The endocytic control of JAK/STAT signalling in Drosophila J. Cell Sci., October 1, 2007; 120(19): 3457 - 3464. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bogard, L. Lan, J. Xu, and R. S. Cohen Rab11 maintains connections between germline stem cells and niche cells in the Drosophila ovary Development, October 1, 2007; 134(19): 3413 - 3418. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. T. Blankenship, M. T. Fuller, and J. A. Zallen The Drosophila homolog of the Exo84 exocyst subunit promotes apical epithelial identity J. Cell Sci., September 1, 2007; 120(17): 3099 - 3110. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, K. L. Schulze, P. R. Hiesinger, K. Suyama, S. Wang, M. Fish, M. Acar, R. A. Hoskins, H. J. Bellen, and M. P. Scott Thirty-One Flavors of Drosophila Rab Proteins Genetics, June 1, 2007; 176(2): 1307 - 1322. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Simonsen, R. C. Cumming, K. Lindmo, V. Galaviz, S. Cheng, T. E. Rusten, and K. D. Finley Genetic Modifiers of the Drosophila Blue Cheese Gene Link Defects in Lysosomal Transport With Decreased Life Span and Altered Ubiquitinated-Protein Profiles Genetics, June 1, 2007; 176(2): 1283 - 1297. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. X. Li, A. K. Satoh, and D. F. Ready Myosin V, Rab11, and dRip11 direct apical secretion and cellular morphogenesis in developing Drosophila photoreceptors J. Cell Biol., May 21, 2007; 177(4): 659 - 669. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Khodosh, A. Augsburger, T. L. Schwarz, and P. A. Garrity Bchs, a BEACH domain protein, antagonizes Rab11 in synapse morphogenesis and other developmental events Development, December 1, 2006; 133(23): 4655 - 4665. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liegeois, A. Benedetto, J.-M. Garnier, Y. Schwab, and M. Labouesse The V0-ATPase mediates apical secretion of exosomes containing Hedgehog-related proteins in Caenorhabditis elegans J. Cell Biol., June 19, 2006; 173(6): 949 - 961. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Marois, A. Mahmoud, and S. Eaton The endocytic pathway and formation of the Wingless morphogen gradient Development, January 15, 2006; 133(2): 307 - 317. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. J. van de Graaf, Q. Chang, A. R. Mensenkamp, J. G. J. Hoenderop, and R. J. M. Bindels Direct Interaction with Rab11a Targets the Epithelial Ca2+ Channels TRPV5 and TRPV6 to the Plasma Membrane Mol. Cell. Biol., January 1, 2006; 26(1): 303 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Beronja, P. Laprise, O. Papoulas, M. Pellikka, J. Sisson, and U. Tepass Essential function of Drosophila Sec6 in apical exocytosis of epithelial photoreceptor cells J. Cell Biol., May 23, 2005; 169(4): 635 - 646. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||