|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 March 2005
doi: 10.1242/dev.01712
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Unité Rétrovirus et Transfert Génétique, INSERM
(U622). Institut Pasteur, 28, rue du Dr Roux, Paris 75015, France
2 Department of Molecular and Cellular Biology, Baylor College of Medicine One
Baylor Plaza, Houston, TX 77030, USA
Author for correspondence (e-mail:
bdurand{at}pasteur.fr)
Accepted 25 January 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Barhl, Apoptosis, Shh, Organizer, Diencephalon
| Introduction |
|---|
|
|
|---|
Early in Xenopus development, the major source of secreted
signaling proteins is the Spemann's organizer that give rise to the notochord
underlying the neural plate and tube (reviewed by
Joubin and Stern, 2001
;
Niehrs, 2004
). The Spemann's
organizer secretes the BMPs inhibitors Chordin, Noggin and Follistatin, which
are involved in the decision of ectodermal cells to become epidermal or neural
cells (Munoz-Sanjuan and Brivanlou,
2002
; Stern, 2002
;
Wilson and Edlund, 2001
), and
Sonic Hedgehog (Shh), which is initially produced by the notochord and then
later by the overlying neural floor plate. Both BMPs and Shh act as
concentration-dependent morphogen, and specify the cell types produced in the
neural tube (Barth et al.,
1999
; Dale and Jones,
1999
; Lee et al.,
2000
). Shh also acts as a survival factor and as a mitogen, by
driving the extensive expansion of the early brain
(Britto et al., 2002
;
Dahmane et al., 2001
;
Lee et al., 2000
;
Thibert et al., 2003
;
Wallace, 1999
). In these ways,
BMPs and Shh help to regionalize the DV axis of the developing nervous system
(Jacob et al., 2003
;
Ruiz i Altaba et al.,
2003
).
The position, size and shape of an organizing center has a major influence
on the position, size and shape of the compartment that it patterns
(Agarwala et al., 2001
). It is
less clear, however, how the size of organizing centers themselves is
determined. Apoptosis plays a major role in controlling cell number during
development (Jacobson et al.,
1997
). In Xenopus embryos, apoptosis occurs in a
reproducible pattern in the neuroectoderm and the mesoderm, starting at the
onset of gastrulation (Hensey and Gautier,
1998
; Yeo and Gautier,
2003
). BMP and Shh, have both been reported to have
apoptosis-inducing and apoptosis-inhibiting properties, raising the
possibility that morphogens may regulate apoptosis to help control the size of
the organizing centers (Charrier et al.,
2001
; Golden et al.,
1999
; Litingtung and Chiang,
2000
; Mabie et al.,
1999
).
Among the important target genes regulated by morphogens are homeobox
genes. These genes encode gene regulatory proteins and specify regional
identity by regulating `effector' genes, which influence cell proliferation,
adhesion, shape, migration, differentiation and survival
(Puelles and Rubenstein, 2003
;
Rubenstein et al., 1998
). Two
Drosophila homeobox genes deformed (Dfd) and
abdominal-B (Abd-B), contribute to the maintenance of
intersegmental boundaries through the regional activation of apoptosis
(Lohmann et al., 2002
).
However, it is not known if Hox proteins directly regulate apoptosis during
vertebrate development.
This study describes a novel function for Barhl2 gene, a
vertebrate homologue of Drosophila barH genes. In fly, the
barH genes are expressed in the developing nervous system, act as
pre-patterning genes and are involved in preventing ectopic retinal
neurogenesis (Higashijima et al.,
1992
; Kojima et al.,
2000
; Lim and Choi,
2003
; Sato et al.,
1999
). Vertebrate homologs of the barH genes have been
isolated and their function examined during retina and ear development
(Li et al., 2002
;
Mo et al., 2004
;
Poggi et al., 2004
). In the
vertebrate eye, Barhl2 function appears highly variable depending on the
species. In the mouse retina it helps specify glycinergic amacrine cells from
retinal progenitors (Mo et al.,
2004
); and in the Xenopus retina, it promotes ganglion
cell fate, downstream of the atonal genes Xath3 and Xath5
(Poggi et al., 2004
). We have
isolated the Xenopus and mouse Barhl2 genes, and studied
their functions in Xenopus neurodevelopment. Barhl2
loss-of-function and gain-of-function mutations produce defects in the
establishment of the neural plate. Our data suggest that Barhl2
normally regulates a cell survival pathway in the neural plate and dorsal
mesoderm. Barhl2 overexpression induces apoptosis in these tissues by
a mechanism dependent on transcription, which differs from an unspecific
cellular stress response. Specific inhibition of Barhl2 expression by
morpholinos leads to a decrease in apoptosis and an increase in the number of
chordin- and Xshh-expressing cells. Finally Barhl2-defective
embryos and embryos overexpressing the anti-apoptotic human BCL2 gene
have a similar phenotype. We propose that Barhl2-dependent apoptosis is
necessary for correct formation of the axial organizing center of the
Xenopus neural plate.
| Materials and methods |
|---|
|
|
|---|
FIL.
Barhl2
FIL was fused at its C-terminal end with amino acids 1
to 298 of the Drosophila Engrailed protein
(Jaynes and O'Farrell, 1991
Embryos and injection
Xenopus embryos were obtained by in vitro fertilization, injected
with synthetic RNA or morpholino and staged according to Nieuwkoop and Faber
(Nieuwkoop and Faber, 1967
).
Capped RNAs were prepared from pCS2-derivatives (Ambion) and
Bcl2-ß RNA from pRC/CMV (Invitrogen). Antisense oligonucleotides
coupled to the fluorescein were made by Gene Tools
(Fig. 2C) and diluted into
RNAse-free water. For Xbarhl2ASI, we used 10 ng for all experiments.
For Xbarhl2ASII, 50 ng was generally used.
|
,
5'CAGATTGGTGCTGGATATGC-3' and
5'ACTGCCTTGATGACTCCTAG3'; Chordin,
5'GTGGATTATGGCTGTGGATTGCTCTCGC3' and
5'AGCGACATCATCAGAACTCAGATAAGG3'. Ncam
5'GTTGTAGCTAACCAAGCAGGACCACTG3' and
5'GCAGTGGAAGAAACCAGCTCAGAAGC3'
Whole-mount in situ hybridization
In situ hybridization was performed using digoxigenin (DIG)-labeled probes,
as described previously (Harland,
1991
), with modifications
(Turner and Weintraub, 1994
).
Antisense probes were generated for Xbarhl2, Xshh, Xsox3, XK81, Xvent2,
chordin, gli1 and gli3 according to the manufacturer's
instructions (Roche). Specimens were sectioned and embedded in agarose or
Tissu-Tek. Frozen sections (10 µm) were cut on a Leica 2800 Frigocut-E
cryostat at 24°C, thicker sections (50 µm) were cut on a Leica
VT1000E vibratome.
Immunostaining
Immunostaining was performed using either a mouse monoclonal anti-Myc
Cy3-conjugated antibody (Sigma) or a rabbit anti-phosphohistone H3 antibodies
(Euromedex), as described previously (Saka
and Smith, 2001
). The anti-phospho-histone H3 antibody was
detected using anti-rabbit (Ig) antibodies conjugated to alkaline phosphatase
(Roche), followed by a staining using BCIP
(5-bromo-4-chloro-3-indoyl-phosphate) as a substrate.
Protein isolation and western analysis
Total protein from embryos was extracted by shearing through a 22G needle
in lysis buffer (Triton X-100 1%, 5 mM EDTA, 5 mM EGTA, 50 mM Tris, pH 8.0,
0.3 M NaCl and proteases inhibitors from Roche). Samples (3 and 10 µg) were
processed for western analysis, using antibodies against Myc (Roche, #1667149)
or activated Caspase 3 (Cell Signalling Technology, #9661).
Hydroxyurea (HU) treatment
Embryos were allowed to developed to stage 9.5 and grown until fixation in
a solution of 30 mM hydroxyurea (Sigma) in 0.1xMMR, as described
previously (Harris and Hartenstein,
1991
; Saka and Smith,
2001
).
TUNEL staining
Whole-mount TUNEL staining was performed as previously described
(Hensey and Gautier, 1998
;
Yeo and Gautier, 2003
). Early
apoptosis is independent of cell proliferation
(Yeo and Gautier, 2003
);
however, blocking cell division by incubation in HU appears to increase the
number of embryos exhibiting a specific spatiotemporal pattern of cell death
(our data) (Yeo and Gautier,
2003
). The TUNEL analysis shown in
Fig. 4A was performed on
wild-type and Xbarhl2AS-injected embryos grown in HU from stage 9.5
onwards.
|
Microdissection and transplantation
Neurula stage embryos were devitellinized and embedded in a clay-covered
dish in 0.5xMMR. The tip of a 25G needle was used to cut out different
parts of the embryo at the indicated stage. The explant was peeled off,
separated from the embryo and either RNA was extracted or the explant was
inserted into a longitudinal incision made along the presumptive neural plate
midline of the host embryo, down to the blastocoel and held in place for 30
minutes using a curved glass bridge.
X-gal staining
Embryos were fixed in MEMFA for 30 minutes, washed in phosphate buffer and
transferred into X-gal staining solution
(Coffman et al., 1990
).
| Results |
|---|
|
|
|---|
|
Manipulation of the level of XBarhl2 expression interferes with neural plate formation
The N-terminal region of the Barhl2 protein contains two conserved domains,
FIL1 and FIL2, that are composed mainly of phenylalanine, isoleucine and
leucine (Saito et al., 1998
).
A sequence comparison between the FIL domains and the Eh1 repression domain
present in the Engrailed protein established that these domains are similar
(Fig. 2A). Eh1 domains are
present in Engrailed, Goosecoid, Nkx1 and Msh classes of homeoproteins, and
have been shown to repress transcription in vivo and in vitro
(Smith and Jaynes, 1996
). We
removed the eh1 domains from the mouse Barhl2 cDNA,
generating Barhl2
FIL (Fig.
2B). We fused the repressor domain of the Drosophila
Engrailed protein to Barhl2
FIL (Barhl2
FIL-enR,
Fig. 2B). We used two different
Xbarhl2 antisense morpholinos (Xbarhl2ASI and
Xbarhl2ASII) to inhibit Xbarhl2 activity, together with a
control morpholino (Xbarhl2ASIII). These oligonucleotides were
designed in a region overlapping the translational initiation site, so that
they do not bind to mouse Barhl2 or Xbarhl1 mRNA
(Fig. 2C). We used
Xsox3 as an early marker of neural induction
(Penzel et al., 1997
) and
epidermal keratin 81 (XK81)
(Jamrich et al., 1987
) as an
epidermal marker. For all constructs we injected the specified RNA together
with GFP RNA used as a tracer.
We injected Xbarhl2 or mouse Barhl2 RNA or antisense
morpholinos into one dorsal blastomere of four-cell embryos. Results were
similar with mouse Barhl2 and Xbarhl2, and we mostly used
mouse Barhl2 for further experiments. At stage 14, we observed a
dose-dependent decrease in the width of the Xsox3 expression domain
on embryos injected with mouse Barhl2
(Fig. 2D, part b). Injection of
over 50 pg of mouse Barhl2 caused the Xsox3 expression
domain to partially disappear (Fig.
2D, part c). The effects on XK81 expression were
complementary to those seen with Xsox3
(Fig. 2D, part d). Injection of
Barhl2
FIL produced embryos similar to control siblings
(Fig. 2D, part e), when
injection of Barhl2
FIL-enR produced a phenotype similar to
that produced by injections of mouse Barhl2
(Fig. 2D, part f), indicating
that Barhl2 functions as a repressor at these stages. In contrast to the
effect produced by mouse Barhl2, the neural plate of
Xbarhl2ASI- or Xbarhl2ASII-treated embryos was larger on the
injected side than on the control side
(Fig. 2D, parts g,h). This
effect was observed along the entire AP axis at all stages analyzed. The
expansion of the neural plate was dose dependent, as shown by injection of 20
ng (no effect, Fig. 2D, part
i), 50 ng (a 30% increase in size, Fig.
2D, part j) and 100 ng (50%,
Fig. 2D, part k) of
Xbarhl2ASII. Conversely, the extent of the epidermal territory was
decreased in Xbarhl2ASI or Xbarhl2ASII-treated embryos
(Fig. 2D, part l). We did not
detect any changes in expression pattern of either Xsox3 or
XK81 upon injection of Xbarhl2ASIII (data not shown,
n=60).
To establish the specificity of the morpholino effect, we tested the ability of Xbarhl2ASII to inhibit translation of the Xbarhl2 mRNA. Myc-tagged Xbarhl2 (Xbarhl2-myc, Fig. 2B) was co-injected with Xbarhl2ASII or Xbarhl2ASIII as a control. Immunostaining of the embryos revealed that Xbarhl2ASII inhibited the translation of Xbarhl2-myc mRNA (Fig. 2E, part b), while Xbarhl2ASIII did not (Fig. 2E, part c). A specific dose-dependent inhibition of Xbarhl2-myc messenger translation by the Xbarhl2ASII in embryos was confirmed by western blot analysis on extracts from embryos injected with increasing doses of Xbarhl2ASII (Fig. 2F).
We tested Xbarhl2ASII as a specific inhibitor of endogenous XBarhl2 activity by co-injecting 10 pg mouse Barhl2 (Fig. 2G, part a) with 50 ng (Fig. 2G, part b) of Xbarhl2ASII. When Xsox3 was used to assess neural plate development, we observed that Xbarhl2ASII rescued the phenotype induced by mouse Barhl2 overexpression in 60% of the embryos (Fig. 2G, part c). These data provide strong evidence that the Xbarhl2ASII were acting by specifically inhibiting endogenous XBarhl2 activity in our injection experiments. As the effects of Xbarhl2ASI and Xbarhl2ASII were similar, we refer to it as Xbarhl2AS.
Thus, increasing Barhl2 activity reduces the neural plate territory, whereas reducing Barhl2 activity increases it. The effect of Barhl2 depends on its two Eh1 domains, and is likely to involve Barhl2-mediated transcriptional repression.
Barhl2 induces apoptosis in neuroectodermal cells of the neural plate
In principle, Barhl2 overexpression may decrease neural plate formation by
inhibiting neural induction, inhibiting neuroectodermal cell proliferation or
increasing neuroectodermal cell death or by some combination of these.
The neuroectodermal expression pattern of Barhl2 argues against a
role for Barhl2 as a direct inhibitor of neural induction. We assessed whether
Barhl2 regulates neuroectodermal cell proliferation. Embryos injected with
Xbarhl2AS were immunostained using an antibody against phosphorylated
histone H3, which specifically recognizes mitotic chromosomes
(Saka and Smith, 2001
). We did
not observe a significant change in the number of mitotic cells on the
Xbarhl2AS-injected side compared with the control side
(Fig. 3A, part a). When
similarly injected embryos were allowed to develop from the gastrula stage
onwards in hydroxyurea (HU), which effectively blocks DNA replication and cell
division (Newport and Dasso,
1989
), Xbarhl2AS-injected side exhibited a typical
increase in the Xsox3 expression domain compared with the control
size (Fig. 3A, part b). These
observations argue against a role for Barhl2 as a modulator of cell
proliferation at these early stages.
|
We injected different quantities of mouse Barhl2, Xbarhl2 or, as a
control, RNA encoding GFP or XPax6, and followed apoptosis by TUNEL analysis
in Xenopus neuroectoderm (Fig.
3B,C). We observed a reproducible increase of 2.6 in the number of
TUNEL-positive nuclei on the injected side of stage 15 embryos treated with
mouse Barhl2 or Xbarhl2 compared with the control side
(Fig. 3B,C). No difference was
detected when RNA encoding GFP or XPax6 was injected as a control (data not
shown), or with ventral injections of mouse Barhl2 (n=53,
data not shown). Interestingly, we observed a specific pattern of apoptotic
nuclei in embryos injected with the lowest dose of mouse Barhl2: over
50% of the TUNEL-positive cells were located within a narrow stripe bordering
the midline of the posterior neural plate
(Fig. 3B, part c), suggesting
that these cells were most sensitive to the apoptosis-promoting effect of
Barhl2. We did not detect any increase in the frequency of apoptotic cells in
embryos dorsally injected with Barhl2
FIL
(Fig. 3C), showing that
Barhl2 transcriptional activity is strictly necessary for the
pro-apoptotic effect of Barhl2. Finally we co-injected mouse Barhl2
and BCL2, and studied these embryos by TUNEL analysis. As shown in
Fig. 3C, there was no
significant difference between the number of apoptotic nuclei in embryos
injected with both mouse Barhl2 and BCL2, when compared with
the controls, confirming that Barhl2 overexpression promotes
apoptosis.
To see if the pro-apoptotic effect of Barhl2 correlated with the observed phenotype of Barhl2-overexpressing embryos, we studied the expression of Xsox3 in embryos injected with mouse Barhl2, BCL2 or mouse Barhl2 together with BCL2 at the same doses as those used for TUNEL analysis. We observed that hbcl2 expression rescued the Barhl2-induced phenotype in over 60% of the embryos at this stage (Fig. 3D).
Thus, Barhl2 can induce apoptosis in dorsal cells through its transcriptional regulatory function. Cells localized along the midline appear to be most sensitive to the pro-apoptotic activity of Barhl2, and the reduction in neural plate territory caused by Barhl2 overexpression can be rescued by overexpression of the apoptotic inhibitor Bcl2.
Inhibition of endogenous Barhl2 activity partially inhibits endogenous apoptosis
To assess the normal function of Barhl2 pro-apoptotic activity we first
used the TUNEL assay to follow endogenous apoptosis from stage 12 to stage 18.
At stage 12, apoptotic nuclei were mainly detected around the blastopore and
along the axial midline as it forms (Fig.
4A, part a) (Hensey and
Gautier, 1998
; Yeo and
Gautier, 2003
). At stage 15, the apoptotic cells were detected in
two stripes along the midline (Fig.
4A, part b). At stage 18, we observed apoptotic cells in the
neural grove and in the anterior part of the neural plate
(Fig. 4A, parts c,d). As
described by others, we observed an asymmetric pattern of apoptotic cells
between the right and left sides of the embryo. Double in situ hybridization
analysis with Xshh (Fig.
4A, part e), which is expressed in midline structures and the
prechordal plate (Ekker et al.,
1995
), and Xpax6 (Fig.
4A, part f), which is expressed in the forebrain
(Hirsch and Harris, 1997
),
suggested that this anterior neural plate area containing apoptotic cells
could correspond to the domain of Xbarhl2 expression. In agreement
with this hypothesis, we observed a dramatic expansion of the Xpax6
expression domain, most strikingly in the dorsal diencephalic area where its
expression overlaps with that of Xbarhl2, in embryos injected with
Xbarhl2AS (Fig. 4A,
part g). These data are consistent with the possibility that Barhl2 can
promote apoptosis at these early developmental stages.
We examined whether inhibition of Barhl2 activity could change the level of endogenous apoptosis. Using the TUNEL assay, we compared apoptosis in stage 15 wild-type embryos and embryos injected with Xbarhl2AS. When Barhl2 activity was inhibited in this way, we observed a reproducible decrease in the number of apoptotic cells per embryo (Fig. 4B), strengthening the hypothesis that Barhl2 normally acts on a cell survival pathway.
The zygotic apoptotic program in the Xenopus embryo comes into
play at the onset of gastrulation, when Xbarhl2 transcripts are first
detected. We assessed whether Barhl2 pro-apoptotic activity was dependent on
the endogenous apoptotic program. Embryos were injected with Xbarhl2,
GFP or Xbarhl2, together with Xbarhl2AS. Apoptosis was
measured in extracts from stage 8 to stage 13 embryo using an ELISA assay for
cytoplasmic histone-associated mono- and oligonucleosomes that are
specifically released during the apoptotic process
(Veenstra et al., 1998
). As
shown in Fig. 4C, we observed,
from stage 10.5 onwards, a steady increase in the apoptotic enrichment factor
(EF) that is the number of dying/dead cells in a specimen over the number of
dying/dead cells in the control GFP-injected embryos
(Fig. 4C, EF=9 at stage 13).
Co-injection of Xbarhl2AS with Xbarhl2 completely inhibited
apoptosis. The measured EF in embryos injected with Xbarhl2 and
Xbarhl2AS was less then one (Fig.
4C, EF=0.8 at stage13), in agreement with our observation that
Xbarhl2AS can partly inhibit endogenous apoptosis.
Cellular stress, including that caused by the overexpression of
transcription factors, can trigger apoptosis in an unspecific way
(Kumar and Cakouros, 2004
). As
a control, we measured the apoptotic EF in embryos injected with
Xpax6. We observed only a slight increase in the apoptotic EF in the
Xpax6-injected embryos (Fig.
4C, EF=1.2 at stage 13). We conclude that the apoptotic response
of cells upon Barhl2 overexpression is not due to an unspecific
stress response.
We followed the presence of activated Caspase 3, the trademark of an
apoptotic process (Adams,
2003
), in embryos injected with Xbarhl2, with
Xbarhl2 and Xbarhl2AS, or with Xpax6. We observed a
specific induction of Caspase 3 cleavage in stage 12 embryos injected with
Xbarhl2, which was totally inhibited in the presence of
Xbarhl2AS (Fig.
4D).
We conclude that Barhl2 normally promotes apoptosis at the same time as the endogenous zygotic apoptotic program comes into play.
Embryos defective for Barhl2 activity exhibit an increase in the number of both chordin- and Xshh-expressing cells
Cell death occurs along the forming axial structures in neurulating
Xenopus embryos (our data) (Yeo
and Gautier, 2003
). To assess which cells undergo
Barhl2-mediated apoptosis, we followed the development of the
prospective notochord and the floorplate territories in embryos in which
Barhl2 expression was experimentally modified.
We used chordin as a marker of axial mesoderm territory
(Sasai et al., 1994
). The
pattern of chordin expression was normal at stage 10 in both mouse
Barhl2- and Xbarhl2AS-injected embryos, showing that the
Spemann's organizer developed normally
(Fig. 5A). At stage 15, we
observed the disappearance of chordin-expressing cells in mouse
Barhl2-injected embryos (Fig.
5B, part b). Conversely, in Xbarhl2AS-injected embryos,
the area of expression of chordin was broader
(Fig. 5B, part c). To test if
the increase in chordin-expressing area might be due to a decrease in
the pro-apoptotic effect of Barhl2, we injected human BCL2 instead of
the morpholino. Similar to what we observed with Xbarhl2AS, we did
not detect any defect in chordin expression at stage 10
(Fig. 5A, part d), but an
increase in the area of chordin expression at stage 15
(Fig. 5B, part d).
|
Chordin acts as a BMP inhibitor. An increase in the number of
chordin-expressing cells should generate an overall decrease in BMP
signaling. We followed changes in the expression pattern of Xvent2
that is under the control of BMP signaling
(Onichtchouk et al., 1996
). As
shown in Fig. 5E, in stage 12
mouse Barhl2-injected embryos Xvent2 area of expression was
shifted dorsally towards the midline compared with control embryos
(Fig. 5E, part b). Whereas in
stage 12 Xbarhl2AS-injected embryos, the Xvent2 expression
area was shifted ventrally (Fig.
5E, part c). We concluded that Barhl2 indirectly modulates BMP
signaling.
We studied the expression of Shh that is expressed in the prospective notochord and in the floorplate (Fig. 5F). One side injection of mouse Barhl2 caused a decrease of about 50% in the size of the floorplate (Fig. 5F, parts b,f), while a similar injection of Xbarhl2AS caused an increase in this territory (Fig. 5F, parts c,g). We confirmed the increase in the number of Xshh-expressing cells in the mesoderm and the neuroectoderm by examination of sections (Fig. 5F, part i). The Gli transcription factors mediate the effects of the Shh signaling. We followed the expression of gli1, which is a direct target of Shh signaling, and gli3, which is repressed by Shh. Embryos injected with Xbarhl2AS showed increased Shh activity in the posterior neural plate, as judged by an increase in the area of gli1 expression on the injected side (Fig. 5F, part j) and a decrease in gli3 expression (Fig. 5F, part k).
In embryos where apoptosis was inhibited by injecting BCL2, we observed a similar enlargement of the Xshh territory of expression (Fig. 5F, parts d,h), and an increase in Shh activity in the posterior neural plate, indicated by an increase in gli1 expression (Fig. 5F, part l).
We conclude that endogenous Barhl2 normally plays an important role in limiting the number of cells expressing chordin and cells expressing Xshh and indirectly in regulating BMP and Shh signaling.
Barhl2 gain-of-function embryonic defects are partially rescued by notochord and floor-plate grafts
Our observations are consistent with the possibility that Barhl2
overexpression decreases the number of notochord and floorplate cells. The
resulting decrease in their organizing activity could be partly responsible
for the observed developmental defects. We assessed the ability of a grafted
notochord and floor plate from wild-type embryos to rescue
Barhl2-injected embryos. Embryos were injected with either
ß-galactosidase or mouse Barhl2, together with GFP as a tracer.
Between stage 12 and stage 14, the prospective midline of wild-type donor
embryos was grafted to mouse Barhl2-injected host embryos as shown in
Fig. 6A. Embryos were allowed
to develop until stage 40 and stained for ß-galactosidase activity.
Control embryos exhibited only slight developmental defects and had normal
heads (Fig. 6B). Injections of
mouse Barhl2 inhibited the formation of dorsal structures, with the
eye and cement gland failing to form in 90% of embryos
(Fig. 6C). By contrast, over
50% of Barhl2-injected embryos with wild-type graft developed head
structures (Fig. 6D). As shown
by ß-galactosidase staining, most of the rescued structures did not
derived from the graft. These observations suggest that the phenotype of mouse
Barhl2-overexpressing embryos is mainly due to decrease axial
organizing activity during neurulation.
|
| Discussion |
|---|
|
|
|---|
Barhl2-regulated apoptosis plays a role in limiting the size of the forming axial neural organizer
As morphogenetic gradients of both BMP and Shh are essential for outgrowth
and patterning of the neural plate, the number of cells producing these
morphogens must be tightly regulated. Barhl2-regulated apoptosis appears as
part of the system that controls both the size and correct establishment of
the axial organizer during the rapid growth of the gastrulating embryo. A
similar role for apoptosis has been described in vertebrate limb development.
There a Shh-producing polarizing region acts as an organizing center and
apoptosis regulates the number of Shh-expressing cells
(Sanz-Ezquerro and Tickle,
2000
). The location, size and shape of an organizing center
determines the size, shape and orientation of the target tissue
(Agarwala et al., 2001
).
Xbarhl2AS-injected embryos phenotype is similar to the phenotype seen
in BMP4 loss-of-function (Dale and Jones,
1999
; Gamse and Sive,
2000
) and in Bcl2 gain-of-function
(Yeo and Gautier, 2003
)
experiments. Conversely, Barhl2 overexpression causes a
ventralization phenotype similar to that seen in BMP4 gain-of-function
experiments (Dale and Jones,
1999
; Gamse and Sive,
2000
). A neurula stage graft of notochord and floor-plate cells
into an mouse Barhl2 overexpressing embryo partially rescues the
formation of head structures, strongly arguing that the Barhl2
gain-of-function and loss-of-function phenotypes are mainly caused by
interference with correct signaling from the forming neural organizing centers
(see Fig. 7).
|
Barhl2 could act directly on a survival program or indirectly on a survival pathway
During development, higher animals cells require signals from other cells
to avoid apoptosis (reviewed by Raff,
1996
). Our data suggest that Barhl2 could act either directly
though transcriptional regulation of a cell death program, or indirectly
through transcriptional modulation of the survival pathways controlling
EPCD.
Studies in C. elegans and Drosophila have demonstrated
the importance of transcriptional control of developmental cell death
(Kumar and Cakouros, 2004
).
Hox-dependent regulation of apoptosis, for example, appears to be a conserved
mechanism in vertebrate development. Bix3, a Xenopus homeobox gene,
regulates apoptosis during development, but this activity does not depend on
its ability to regulate transcription
(Trindade et al., 2003
).
Hoxa13 may be involved in eliminating cells located between the
forming digits in mice (Stadler et al.,
2001
), and a direct role for Engrailed genes in the regulation of
apoptosis has been suggested in mesencephalic dopaminergic neurons
(Alberi et al., 2004
). Targeted
deletion of Barhl1, the closest homologue of Barhl2 in
vertebrates, caused degeneration of mouse cochlear hair cells. Analysis of
this phenotype showed that Barhl1 plays an essential role in the
maintenance of cochlear hair cells whereas it had little role in specification
and differentiation of these cells (Li et
al., 2002
). The BH3-only protein, Egl-1, a pro-apoptotic member of
the Bcl2 family is transcriptionally controlled in C. elegans
(Metzstein and Horvitz, 1999
).
Therefore, Barhl2 could directly or indirectly regulate the
transcription of a gene that encodes a BH3-only protein.
In the neural plate, Shh regulates apoptosis in various ways: it acts as a
cell survival signal (Charrier et al.,
2001
; Chiang et al.,
1996
; Litingtung and Chiang,
2000
), and has a apoptotic promoting activity in chick ventral
neuronal precursors and floor-plate cells
(Oppenheim et al., 1999
).
Similarly, several BMPs have been shown to promote apoptosis on developing
neural cells (Golden et al.,
1999
; Mabie et al.,
1999
). Therefore, Barhl2 could modulate directly or
indirectly the cellular production of these apoptosis-modulating signals
and/or their cellular responses, and indirectly control cell survival of the
chordin- and shh-expressing cells. It is foreseeable that
determining if this new function is conserved for the fly barH and/or
for the ceh-30 and ceh-31 genes in C. elegans would
probably help our understanding of Barhl2 mechanisms of action in
vertebrates.
Finally, the main area of expression of Barhl2 appears to be the
dorsal diencephalic primordium. Caspase 3-deficient mice exhibit hyperplasia
in the diencephalic walls (Kuida et al.,
1996
), and genetic studies in zebrafish have shown that the dorsal
diencephalic domain specifically expands in the absence of BMP signaling
(Barth et al., 1999
). We
observe that the area of Xpax6 expression at the dorsal diencephalic
level is dramatically expanded when Barhl2 activity is inhibited. Further
studies are necessary to address the role of Barhl2 in the anterior
neural plate, but it is possible that the Barhl2 pro-apoptotic
function is involved in dorsal diencephalic formation.
In any case, our results argue that a role for Hox proteins as
transcriptional regulators of apoptosis and a role for apoptosis in regulating
the size of organizing centers appear to be conserved in animal development
(Alonso, 2002
;
Lohmann et al., 2002
;
Sanz-Ezquerro and Tickle,
2000
).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Adams, J. M. (2003). Ways of dying: multiple
pathways to apoptosis. Genes Dev.
17,2481
-2495.
Agarwala, S., Sanders, T. A. and Ragsdale, C. W.
(2001). Sonic hedgehog control of size and shape in midbrain
pattern formation. Science
291,2147
-2150.
Alberi, L., Sgado, P. and Simon, H. H. (2004).
Engrailed genes are cell-autonomously required to prevent apoptosis in
mesencephalic dopaminergic neurons. Development
131,3229
-3236.
Alonso, C. R. (2002). Hox proteins: sculpting body parts by activating localized cell death. Curr. Biol. 12,R776 -R778.[CrossRef][Medline]
Barlow, A. J. and Francis-West, P. H. (1997). Ectopic application of recombinant BMP-2 and BMP-4 can change patterning of developing chick facial primordia. Development 124,391 -398.[Abstract]
Barth, K. A., Kishimoto, Y., Rohr, K. B., Seydler, C., Schulte-Merker, S. and Wilson, S. W. (1999). Bmp activity establishes a gradient of positional information throughout the entire neural plate. Development 126,4977 -4987.[Abstract]
Britto, J., Tannahill, D. and Keynes, R. (2002). A critical role for sonic hedgehog signaling in the early expansion of the developing brain. Nat. Neurosci. 5, 103-110.[CrossRef][Medline]
Bulfone, A., Menguzzato, E., Broccoli, V., Marchitiello, A.,
Gattuso, C., Mariani, M., Consalez, G. G., Martinez, S., Ballabio, A. and
Banfi, S. (2000). Barhl1, a gene belonging to a new subfamily
of mammalian homeobox genes, is expressed in migrating neurons of the CNS.
Hum. Mol. Genet. 9,1443
-1452.
Charrier, J. B., Lapointe, F., le Douarin, N. M. and Teillet, M. A. (2001). Anti-apoptotic role of Sonic hedgehog protein at the early stages of nervous system organogenesis. Development 128,4011 -4020.
Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H. and Beachy, P. A. (1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383,407 -413.[CrossRef][Medline]
Coffman, C., Harris, W. and Kintner, C. (1990).
Xotch, the Xenopus homolog of Drosophila notch.
Science 249,1438
-1441.
Dahmane, N., Sanchez, P., Gitton, Y., Palma, V., Sun, T., Beyna, M., Weiner, H. and Ruiz i Altaba, A. (2001). The Sonic Hedgehog-Gli pathway regulates dorsal brain growth and tumorigenesis. Development 128,5201 -5212.
Dale, L. and Jones, C. M. (1999). BMP signalling in early Xenopus development. BioEssays 21,751 -760.[CrossRef][Medline]
de la Rosa, E. J. and de Pablo, F. (2000). Cell death in early neural development: beyond the neurotrophic theory. Trends Neurosci. 23,454 -458.[CrossRef][Medline]
Edelman, D. B., Meech, R. and Jones, F. S.
(2000). The homeodomain protein Barx2 contains activator and
repressor domains and interacts with members of the CREB family. J.
Biol. Chem. 275,21737
-21745.
Ekker, S. C., McGrew, L. L., Lai, C. J., Lee, J. J., von Kessler, D. P., Moon, R. T. and Beachy, P. A. (1995). Distinct expression and shared activities of members of the hedgehog gene family of Xenopus laevis. Development 121,2337 -2347.[Abstract]
Gamse, J. and Sive, H. (2000). Vertebrate anteroposterior patterning: the Xenopus neurectoderm as a paradigm. BioEssays 22,976 -986.[CrossRef][Medline]
Golden, J. A., Bracilovic, A., McFadden, K. A., Beesley, J. S.,
Rubenstein, J. L. and Grinspan, J. B. (1999). Ectopic bone
morphogenetic proteins 5 and 4 in the chicken forebrain lead to cyclopia and
holoprosencephaly. Proc. Natl. Acad. Sci. USA
96,2439
-2444.
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685 -695.[Medline]
Harris, W. A. and Hartenstein, V. (1991). Neuronal determination without cell division in Xenopus embryos. Neuron 6,499 -515.[CrossRef][Medline]
Hensey, C. and Gautier, J. (1998). Programmed cell death during Xenopus development: a spatio-temporal analysis. Dev. Biol. 203,36 -48.[CrossRef][Medline]
Higashijima, S., Kojima, T., Michiue, T., Ishimaru, S., Emori,
Y. and Saigo, K. (1992). Dual Bar homeo box genes of
Drosophila required in two photoreceptor cells, R1 and R6, and primary pigment
cells for normal eye development. Genes Dev.
6, 50-60.
Hirsch, N. and Harris, W. A. (1997). Xenopus Pax-6 and retinal development. J. Neurobiol. 32, 45-61.[CrossRef][Medline]
Hjalt, T. A. and Murray, J. C. (1999). The human BARX2 gene: genomic structure, chromosomal localization, and single nucleotide polymorphisms. Genomics 62,456 -459.[CrossRef][Medline]
Jacob, J., Briscoe, J., Britto, J., Tannahill, D. and Keynes, R. (2003). Gli proteins and the control of spinal-cord patterning. EMBO Rep. 4,761 -765.[CrossRef][Medline]
Jacobson, M. D., Weil, M. and Raff, M. C. (1997). Programmed cell death in animal development. Cell 88,347 -354.[CrossRef][Medline]
Jamrich, M., Sargent, T. D. and Dawid, I. B.
(1987). Cell-type-specific expression of epidermal cytokeratin
genes during gastrulation of Xenopus laevis. Genes
Dev. 1,124
-132.
Jaynes, J. B. and O'Farrell, P. H. (1991). Active repression of transcription by the engrailed homeodomain protein. EMBO J. 10,1427 -1433.[Medline]
Joubin, K. and Stern, C. D. (2001). Formation and maintenance of the organizer among the vertebrates. Int. J. Dev. Biol. 45,165 -175.[Medline]
Keller, R. (2002). Shaping the vertebrate body
plan by polarized embryonic cell movements. Science
298,1950
-1954.
Kiecker, C. and Niehrs, C. (2001). A morphogen
gradient of Wnt/beta-catenin signalling regulates anteroposterior neural
patterning in Xenopus. Development
128,4189
-4201.
Kojima, T., Sato, M. and Saigo, K. (2000). Formation and specification of distal leg segments in Drosophila by dual Bar homeobox genes, BarH1 and BarH2. Development 127,769 -778.[Abstract]
Kuan, C. Y., Roth, K. A., Flavell, R. A. and Rakic, P. (2000). Mechanisms of programmed cell death in the developing brain. Trends Neurosci. 23,291 -297.[CrossRef][Medline]
Kuida, K., Zheng, T. S., Na, S., Kuan, C., Yang, D., Karasuyama, H., Rakic, P. and Flavell, R. A. (1996). Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature 384,368 -372.[CrossRef][Medline]
Kumar, S. and Cakouros, D. (2004). Transcriptional control of the core cell-death machinery. Trends Biochem. Sci. 29,193 -199.[CrossRef][Medline]
Lee, K. J., Dietrich, P. and Jessell, T. M. (2000). Genetic ablation reveals that the roof plate is essential for dorsal interneuron specification. Nature 403,734 -740.[CrossRef][Medline]
Leise, W. F., 3rd and Mueller, P. R. (2004).
Inhibition of the cell cycle is required for convergent extension of the
paraxial mesoderm during Xenopus neurulation.
Development 131,1703
-1715.
Li, S., Price, S. M., Cahill, H., Ryugo, D. K., Shen, M. M. and Xiang, M. (2002). Hearing loss caused by progressive degeneration of cochlear hair cells in mice deficient for the Barhl1 homeobox gene. Development 129,3523 -3532.
Lim, J. and Choi, K. W. (2003). Bar homeodomain
proteins are anti-proneural in the Drosophila eye: transcriptional repression
of atonal by Bar prevents ectopic retinal neurogenesis.
Development 130,5965
-5974.
Litingtung, Y. and Chiang, C. (2000). Specification of ventral neuron types is mediated by an antagonistic interaction between Shh and Gli3. Nat. Neurosci. 3, 979-985.[CrossRef][Medline]
Lohmann, I., McGinnis, N., Bodmer, M. and McGinnis, W. (2002). The Drosophila Hox gene deformed sculpts head morphology via direct regulation of the apoptosis activator reaper. Cell 110,457 -466.[CrossRef][Medline]
Mabie, P. C., Mehler, M. F. and Kessler, J. A.
(1999). Multiple roles of bone morphogenetic protein signaling in
the regulation of cortical cell number and phenotype. J.
Neurosci. 19,7077
-7088.
Metzstein, M. M. and Horvitz, H. R. (1999). The C. elegans cell death specification gene ces-1 encodes a snail family zinc finger protein. Mol. Cell 4, 309-319.[CrossRef][Medline]
Mo, Z., Li, S., Yang, X. and Xiang, M. (2004).
Role of the Barhl2 homeobox gene in the specification of glycinergic amacrine
cells. Development 131,1607
-1618.
Muhr, J., Andersson, E., Persson, M., Jessell, T. M. and Ericson, J. (2001). Groucho-mediated transcriptional repression establishes progenitor cell pattern and neuronal fate in the ventral neural tube. Cell 104,861 -873.[CrossRef][Medline]
Munoz-Sanjuan, I. and Brivanlou, A. H. (2002). Neural induction, the default model and embryonic stem cells. Nat. Rev. Neurosci. 3,271 -280.[CrossRef][Medline]
Newport, J. and Dasso, M. (1989). On the coupling between DNA replication and mitosis. J. Cell Sci. Suppl. 12,149 -160.[Medline]
Niehrs, C. (2004). Regionally specific induction by the Spemann-Mangold organizer. Nat. Rev. Genet. 5,425 -434.[Medline]
Nieuwkoop, P. D. and Faber, J. (1967).Normal Table of Xenopus laevis (Daudin) . Amsterdam, The Netherlands: Elsevier/North Holland Publishing.
Onichtchouk, D., Gawantka, V., Dosch, R., Delius, H., Hirschfeld, K., Blumenstock, C. and Niehrs, C. (1996). The Xvent-2 homeobox gene is part of the BMP-4 signalling pathway controlling [correction of controling] dorsoventral pa