|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 23 March 2005
doi: 10.1242/dev.01781
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Department of Development and Differentiation, Institute for Frontier Medical
Sciences, Kyoto University, Kyoto 606-8507, Japan
2 Center for Basic Neuroscience, University of Texas Southwestern Medical
Center, 5323 Harry Hines Boulevard, Dallas, TX 75390-9111, USA
Author for correspondence (e-mail:
tesaito{at}frontier.kyoto-u.ac.jp)
Accepted 11 February 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Math1 (Atoh1), Proneural, Mbh1 (Barhl2), Homeobox, Spinal cord, Mouse
| Introduction |
|---|
|
|
|---|
In the developing dorsal spinal cord, domains of progenitor cells are
distinguished by the expression of bHLH genes, which are initially established
by TGFß-like signals (reviewed by Lee
and Jessell, 1999
; Caspary and
Anderson, 2003
; Helms and
Johnson, 2003
). Each domain produces a distinct set of neurons,
which are marked by combinatorial expression of homeobox genes. Math1
is expressed by dorsalmost cells adjacent to the roof plate, which give rise
to dI1 cells positive for LIM-class homeodomain proteins, Lhx2 (LH2A) and Lhx9
(LH2B). dI1 cells are lost in Math1 knockout mice
(Bermingham et al., 2001
;
Gowan et al., 2001
), whereas
misexpression of Math1 increases the number of dI1 cells and
commissural neurons (Gowan et al.,
2001
). A Bar-class homeobox gene, Mbh1 (Barhl2
Mouse Genome Informatics), is also expressed by dI1 cells, and
Mbh1-positive cells give rise to commissural neurons
(Saba et al., 2003
). Dorsal
cells that express Mbh1 ectopically are transfated to commissural
neurons in the spinal cord, suggesting that Mbh1 is sufficient for
the specification of commissural neuron identity
(Saba et al., 2003
).
In this study, we identified an enhancer directing Mbh1 expression in the spinal cord by analyzing transgenic mice that carried lacZ with Mbh1-flanking genome sequences. An E-box, which was conserved among mouse, rat and human sequences, was critical to drive lacZ expression in the dorsal spinal cord, suggesting that Mbh1 expression is regulated by a bHLH protein. Furthermore, chromatin immunoprecipitation (ChIP) experiments revealed that Math1 bound the Mbh1 enhancer containing the E-box in the spinal cord. Transfection assays in the mouse spinal cord indicated that expression of a reporter gene carrying the E-box was activated specifically by Math1. These results, taken together with Mbh1 expression in the gain- and loss-of-function experiments of Math1, indicate that Mbh1 is a downstream target gene of Math1. The function of Mbh1 was analyzed using chimeric proteins containing the homeodomain of Mbh1 and functional domains that can modulate transcription. A chimeric protein containing the Engrailed repressor domain generated commissural neurons, as Mbh1 and Math1 did. By contrast, a chimeric protein containing the VP16 activator domain inhibited generation of commissural neurons. These findings suggest that transcriptional repressor activity of Mbh1 is necessary and sufficient for the specification of commissural neurons. Thus, these studies revealed a cascade of events for specifying commissural neuron identity in the spinal cord.
| Materials and methods |
|---|
|
|
|---|
Generation and analysis of transgenic mice
The lacZ-coding region with SV40 polyadenylation site derived from
BGZA (Yee and Rigby, 1993
;
Helms and Johnson, 1998
) was
inserted downstream of the translation start site of Mbh1, which matched the
translation start site of ß-gal. In Tg5 and Tg6, the basal
ß-globin promoter was used in place of the 1.0 kb 5'
sequence. Tg18 was constructed by linking three tandem copies of the 123 bp
fragment containing the E-box. The mutation was introduced into the E-box
using an In Vitro Mutagenesis Kit (Takara).
Transgenic mice were generated and analyzed as described previously
(Saba et al., 2003
). Briefly,
injected eggs were implanted into ICR female mice, and founders were collected
and stained for ß-gal activity. Stable transgenic lines were also
generated for Tg2 and Tg4. Transgenes were detected by PCR for the
lacZ gene using placenta DNA for embryos and tail DNA for pups.
In situ hybridization and immunohistochemistry
Section and whole-mount in situ hybridization were performed as described
in Saito et al. (Saito et al.,
1996
) and Wilkinson
(Wilkinson, 1992
),
respectively. Antisense RNA probes were synthesized from plasmids carrying
mouse cDNA clones: pMH4-1 and pNH10 for Mbh1; Lhx9 (gift of
T. M. Jessell, Columbia University); Math1 (gift of R. Kageyama,
Kyoto University). Immunofluorescent studies were performed as described
(Saba et al., 2003
). The
following primary and secondary antibodies were used for visualizing the
signals: rabbit anti-Math1 (Helms and
Johnson, 1998
); goat anti-ß-gal (Biogenesis); mouse
monoclonal anti-bromodeoxyuridine (BrdU) (Sigma); donkey anti-mouse and
anti-rabbit IgGs conjugated with Cy3 (Jackson ImmunoResearch); donkey
anti-goat IgG conjugated with Alexa Fluor 488 (Molecular Probes).
In vivo electroporation
In vivo electroporation was performed as described before
(Saba et al., 2003
). Solution
(1 µl) containing 140 nmol/l each plasmid in PBS was injected into the
central canal of the spinal cord of E11.5 mouse embryos. Half-ring type
electrodes were used to transfect DNA through the spinal cord. pEYFP, which
carried EYFP downstream of a CAG promoter
(Saito and Nakatsuji, 2001
),
was used as a control. pEYFP-Math1 and pEYFP-Mash1 were constructed by
inserting the coding region of Math1 and Mash1 downstream of
the second CAG promoter of pCAG-EYFP-CAG
(Saito and Nakatsuji, 2001
),
respectively. The Math1-HA gene was constructed by inserting
oligonucleotides encoding the HA tag immediately upstream of the translation
termination codon of Math1. The En-Mbh1 and VP16-Mbh1
chimeric genes were constructed by fusing the sequences encoding the
Drosophila Engrailed repressor domain
(Jaynes and O'Farrell, 1991
)
and the VP16 activator domain (Clontech) to the sequence encoding the
C-terminal portion of the Mbh1 protein, respectively. These three genes were
inserted downstream of the second CAG promoter of pCAG-EYFP-CAG to construct
pEYFP-Math1-HA, pEYFP-En-Mbh1 and pEYFP-VP16-Mbh1. Each result of
electroporation was confirmed by using at least two independently isolated
clones with the same structure.
ChIP assay
Chromatin was prepared as described in Forsberg et al.
(Forsberg et al., 2000
) with
minor modifications. To examine binding of endogenous Math1, the spinal cord
from
28 mouse embryos at E10.5 was used for one assay. To analyze binding
of misexpressed Math1, EYFP+ sides of the spinal cord were
dissected out 24 hours after electroporation at E11.5, and
10
electroporated embryos were used for one assay. The dissected spinal cord was
fixed with 1% formaldehyde in PBS for 3 hours on ice. After cell lysis and
sonication, ChIP was performed following the manufacture's protocol in the
ChIP Assay Kit (Upstate). The following antibodies and IgG (3 µg) were
used: rabbit anti-Math1; rabbit anti-neurofilament 200 (Sigma); rat anti-HA
(3F10, Roche); rat IgG (Immunotech). Immunocomplexes were pulled down using
protein A and protein G-agarose beads for rabbit and rat IgGs, respectively. A
502 bp fragment spanning nucleotides +5507 to +6009 containing the E-box of
the Mbh1 enhancer was amplified by semi-quantitative PCR using the
following primers: sense, TTCCAGGTGCCCGCCTCTTCTGA; antisense,
TTCGCGGATCCAAGCACAACTCATT. As a negative control, a 546 bp DNA fragment
spanning nucleotides 6 to +540 of the Mbh1 gene was amplified
using the following primers: sense, GTAGAAATGACAGCAATGGAAGG; antisense,
CCTGAAGCTCTCGTGTGC. The intensity of PCR bands was analyzed using a Typhoon
9410 fluorescence imager (Amersham Bioscience). For all experiments,
immunoprecipitated DNA templates were well under the saturation level.
Reporter assay
Forty-eight hours after electroporation, EYFP+ regions in one
side of the spinal cord were dissected out in cold PBS under a fluorescent
stereomicroscope and suspended with lysis buffer from the High Sensitivity
ß-galactosidase Assay Kit (Stratagene). Approximately 150 µg of
protein was obtained from the EYFP+ region of one embryonic spinal
cord. ß-gal activity was measured using the Assay Kit according to the
manufacturer's protocol. The efficiency of transfection was normalized with
the intensity of EYFP fluorescence, which was measured using the Typhoon 9410
fluorescence imager.
| Results |
|---|
|
|
|---|
|
|
Embryos harboring Tg5 and Tg6, in which the 1.0 kb 5' fragment of Tg4 was replaced with the ß-globin basal promoter, expressed lacZ in the dorsal spinal cord (Fig. 2E), suggesting that the 2.5 kb 3' fragment is sufficient to drive lacZ expression in an Mbh1-specific manner. The 3' fragment functioned irrespective of its orientation as well as shorter fragments (see below).
An E-box is required for lacZ expression in the dorsal spinal cord
To identify a cis-regulatory element directing Mbh1
expression in the dorsal spinal cord, we made a series of deletions of the 2.5
kb 3' fragment (Fig. 3A).
As demonstrated by Tg12, a 517 bp fragment, which was 5.7 kb downstream of the
translation start site, was sufficient to drive lacZ expression in
the dorsal spinal cord of some transgenic embryos. Further deletions suggested
that the 5' portion of the 517 bp fragment contained a critical site for
Mbh1 expression (see also Fig. S2C-F in the supplementary material). It should be noted that ß-gal activity became weaker, as the genome
sequences were progressively deleted. This finding suggests that several sites
of the 3' fragment are involved in upregulating Mbh1
expression.
|
To examine if the E-box was essential for Mbh1 expression, we
introduced a mutation into the E-box (ATTCTG) of the 517 bp and 308 bp
fragments, thereby constructing Tg16 and Tg17. This mutation is known to
disrupt the binding activity of Math1 to DNA
(Helms et al., 2000
). None of
the transgenic embryos harboring these two mutant Tgs expressed lacZ
in the dorsal spinal cord (Fig.
3A and see Fig. S2I,J in the supplementary material), suggesting
that this E-box is required for Mbh1 expression in the dorsal spinal
cord.
The involvement of the E-box in Mbh1 expression was further supported by Tg18. Transgenic embryos harboring Tg18, which carried a trimer of the 123 bp fragment, expressed lacZ in the dorsal spinal cord (Fig. 3D and see Fig. S2G,H in the supplementary material). However, lacZ expression from Tg18 was also detected at ectopic sites, the midbrain and somites, in most of the ß-gal+ embryos, suggesting that the sequence outside these 123 bp is involved in restricting Mbh1 expression in the dorsal spinal cord.
Math1 is necessary and sufficient for Mbh1 expression
The E-box necessary for Mbh1 expression completely matched the
site to which the Math1 protein could bind efficiently in vitro
(Akazawa et al., 1995
;
Helms et al., 2000
).
Mbh1 is expressed by a lineage of cells that have expressed Math1
(Saba et al., 2003
). Moreover,
Mbh1 expression started in cells expressing Math1
(Fig. 2H). To clarify a genetic
relationship between Mbh1 and Math1, Mbh1 expression was
examined in Math1 knockout embryos
(Fig. 4 and see Figs S3, S4 in
the supplementary material). Mbh1 expression was lost in the spinal
cord of Math1/ embryos, indicating that
Math1 was necessary for Mbh1 expression. Expression of Lhx9,
which resembled that of Mbh1, was also lost in the
Math1/ spinal cord
(Fig. 4G). By contrast, in the
developing dorsal diencephalon, where Math1 was not expressed,
Mbh1 expression was not perturbed by the Math1 null mutation
(Fig. 4H).
|
|
|
|
|
5-fold by Math1 but not
by Mash1. This result was consistent with the data of transgenic embryos,
where lacZ was not expressed from Tg12 in Mash1+ domains,
such as the dorsal half of the spinal cord and autonomic nervous system. These
results indicate that the expression of the transgene is specifically
activated by Math1.
Repressor activity of Mbh1 is required for the differentiation of commissural neurons downstream of Math1
We analyzed the function of Mbh1 using chimeric proteins, which were
expected to exert opposite functions. As the C-terminal portion, which
included the homeodomain, was well conserved among Bar-class homeodomain
proteins, the N-terminal portion of the Mbh1 protein was replaced with a
functional domain: the repressor domain of Drosophila Engrailed
(Jaynes and O'Farrell, 1991
)
for En-Mbh1, or the activation domain of herpes simplex virus VP16
(Triezenberg et al., 1988
) for
VP16-Mbh1. Their genes were transfected into the E11.5 spinal cord by in vivo
electroporation and co-expressed with EYFP in the same cells using
the double promoter vector. More commissural neurons were generated by
transfection of Mbh1 as well as Math1
(Fig. 8B,C), as described
previously (Saba et al.,
2003
). Similarly, EYFP+ commissural neurons were
generated by misexpression of En-Mbh1
(Fig. 8D) but not
VP16-Mbh1 (Fig. 8E), suggesting that Mbh1 functions as a transcriptional repressor.
To clarify the role of Mbh1 in the differentiation of commissural neurons, these chimeric genes were cotransfected with Math1. Whereas co-transfection of En-Mbh1 with either Math1 or Mbh1 generated commissural neurons in a manner similar to the transfection of each gene (data not shown), the generation of commissural neurons by Math1 and Mbh1 was inhibited by VP16-Mbh1 (Fig. 8F; data not shown). These results suggest that VP16-Mbh1 functions as a dominant negative form of Mbh1, and that transcriptional repressor activity of Mbh1 is required for the differentiation of commissural neurons downstream of Math1.
| Discussion |
|---|
|
|
|---|
|
Enhancer analyses using transgenic mice showed the critical role of the
E-box 3' of the Mbh1 gene for its expression. Math1 is
suggested to autoregulate its expression through an E-box 3' of the
Math1 gene (Helms et al.,
2000
). The nucleotide sequences of the two E-boxes were identical.
There is another Bar-class homeobox gene, Mbh2 (Barhl1
MGI), of which expression is lost in
Math1/ mice
(Bermingham et al., 2001
). We
could not find a sequence similar to the 123 bp fragment containing the E-box
3' of the Mbh1 gene in the Mbh2-flanking genome
sequences. Expression patterns of Mbh1 and Mbh2 are similar
but not identical (T.S., T. Hama and R.S., unpublished), as is the case for
their Xenopus orthologs, Xbh1 and Xbh2
(Patterson et al., 2000
).
Regulatory mechanisms of Mbh1 and Mbh2 may be different.
The sequence outside the 123 bp was required for efficient and restricted
expression of lacZ in transgenic embryos, suggesting that Math1
regulates Mbh1 by collaborating with another factor that may bind a
site other than the E-box. Mash1 could not activate lacZ expression
from Tg12 in reporter assays using the spinal cord. However, this finding may
not simply imply that Mash1 cannot bind the E-box, because misexpression of
Mash1 efficiently activated lacZ expression from Tg18, which
carried three copies of the E-box, in 10T1/2 cells (data not shown). These
findings also suggest that there is a factor that specifically interacts with
Math1 to activate gene expression in the spinal cord. Misexpression of
Math1 induced ectopic expression of Mbh1 in more ventral
regions, suggesting that the factor may not be restricted to the dorsalmost
area of the spinal cord, where endogenous Mbh1 expression starts. A
bHLH protein, NeuroM, has been shown to interact with LIM-type homeodomain
proteins and regulate Hb9 (Lee
and Pfaff, 2003
). In the dorsal spinal cord, Lhx9 is
expressed downstream of Math1 (Figs
4,
5), but misexpression of
Lhx9 did not activate either endogenous Mbh1 expression
(Saba et al., 2003
) or
lacZ expression from Tg12 in reporter assays (data not shown).
Spatiotemporal expression of Mbh1
Consistent with the cascade from Math1 to Mbh1, Mbh1 was
expressed in many domains that expressed Math1, including the dorsal
spinal cord and hindbrain. But Mbh1 was not expressed in all places
that expressed Math1, such as the inner ear. This finding suggests
that Math1 is not sufficient and requires an additional factor for
Mbh1 expression. ß-gal activity in the transgenic mice bearing
Tg4 started to be detected at the same time as endogenous Mbh1
expression. The ß-gal activity faded after E13.5, whereas endogenous
Mbh1 expression persisted to at least E18.5. This finding indicates
that the 2.5 kb 3' fragment containing the E-box was sufficient for
initiation, but not for maintenance, of Mbh1 expression. In agreement
with this, Math1 is abundant at the onset of Mbh1 expression.
Mbh1 was also expressed in domains that did not express
Math1, such as the dorsal diencephalon
(Saito et al., 1998
).
lacZ expression was not detected in those areas even in transgenic
mice carrying DNA fragments encompassing from 4.5 kb to +11 kb of the
Mbh1 genome, suggesting that Mbh1 expression and its
maintenance in various domains is controlled by many cis-regulatory
elements dispersed throughout the Mbh1 locus.
Function of Mbh1
Analysis using chimeric proteins, En-Mbh1 and VP16-Mbh1, indicated that
Mbh1 is a potential transcriptional repressor. Bar-class homeodomain proteins
contain a short sequence motif (FxIxxIL), called FIL, in their N-terminal
regions (Saito et al., 1998
).
This motif closely resembles some examples of the eh1 motif
(Smith and Jaynes, 1996
),
which mediates transcriptional repression by interacting with Groucho-family
co-repressors. Many of the transcription factors that are expressed in
progenitor domains of the ventral spinal cord function as transcriptional
repressors (Muhr et al., 2001
;
Novitch et al., 2001
;
William et al., 2003
).
Transcriptional repression may be a general feature in regulating the neuronal
fate. Interestingly, a number of genes expressed by postmitotic neurons are
silenced by Nrsf/Rest in non-neuronal cells (reviewed by
Schoenherr and Anderson,
1995
).
One of the genes, Scg10 (Stmn2 Mouse Genome Informatics), which is a pan-neuronal marker, is de-repressed downstream of bHLH proteins. As Mbh1 is expressed by postmitotic neurons in the spinal cord, Mbh1 might also be implicated in pan-neuronal differentiation through the repression of Nrsf (Rest Mouse Genome Informatics). However, misexpression of Mbh1 in NIH3T3 cells could not activate Scg10 expression (data not shown), suggesting that Mbh1 is involved only in the specification of commissural neuron identity. These findings indicate that Mbh1 functions in a cascade controlling specific differentiation to commissural neurons. In parallel with this cascade, another cascade controlling pan-neuronal differentiation may be activated by Math1.
In vivo analysis of transcriptional activation
Quantitative analysis of enhancers and promoters has been mostly performed
using cell lines. Cell lines that are suitable for the analysis of a
particular gene, however, are not always available. We have established a
quick and efficient method to introduce DNA into the developing nervous system
using in vivo electroporation, even if the size of DNA is larger than 12 kb
(Saito and Nakatsuji, 2001
;
Saba et al., 2003
). Our
present work indicates that embryonic tissues can be a good source for
transcriptional analysis using in vivo electroporation, because
EYFP+ portions of the embryonic spinal cord provided enough protein
for the analysis. This approach will be very powerful for examination of gene
function, where suitable cell lines are not available.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/132/9/2147/DC1
* Present address: Graduate School of Medicine, Chiba University, Chiba
260-8670, Japan ![]()
| REFERENCES |
|---|
|
|
|---|
Akazawa, C., Ishibashi, M., Shimizu, C., Nakanishi, S. and
Kageyama, R. (1995). A mammalian helix-loop-helix factor
structurally related to the product of Drosophila proneural gene atonal is a
positive transcriptional regulator expressed in the developing nervous system.
J. Biol. Chem. 270,8730
-8738.
Ben-Arie, N., Bellen, H. J., Armstrong, D. L., McCall, A. E., Gordadze, P. R., Guo, Q., Matzuk, M. M. and Zoghbi, H. Y. (1997). Math1 is essential for genesis of cerebellar granule neurons. Nature 390,169 -172.[CrossRef][Medline]
Bermingham, N. A., Hassan, B. A., Price, S. D., Vollrath, M. A.,
Ben-Arie, N., Eatock, R. A., Bellen, H. J., Lysakowski, A. and Zoghbi, H.
Y. (1999). Math1: an essential gene for the generation of
inner ear hair cells. Science
284,1837
-1841.
Bermingham, N. A., Hassan, B. A., Wang, V. Y., Fernandez, M., Banfi, S., Bellen, H. J., Fritzsch, B. and Zoghbi, H. Y. (2001). Proprioceptor pathway development is dependent on Math1. Neuron 30,411 -422.[CrossRef][Medline]
Bertrand, N., Castro, D. S. and Guillemot, F. (2002). Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci. 3, 517-530.[CrossRef][Medline]
Caspary, T. and Anderson, K. V. (2003). Patterning cell types in the dorsal spinal cord: what the mouse mutants say. Nat. Rev. Neurosci. 4,289 -297.[CrossRef][Medline]
Forsberg, E. C., Downs, K. M., Christensen, H. M., Im, H.,
Nuzzi, P. A. and Bresnick, E. H. (2000). Developmentally
dynamic histone acetylation pattern of a tissue-specific chromatin domain.
Proc. Natl. Acad. Sci. USA
97,14494
-14499.
Goridis, C. and Rohrer, H. (2002). Specification of catecholaminergic and serotonergic neurons. Nat. Rev. Neurosci. 3,531 -541.[CrossRef][Medline]
Gowan, K., Helms, A. W., Hunsaker, T. L., Collisson, T., Ebert, P. J., Odom, R. and Johnson, J. E. (2001). Cross inhibitory activities of Ngn1 and Math1 allow specification of distinct dorsal interneurons. Neuron 31,219 -232.[CrossRef][Medline]
Helms, A. W. and Johnson, J. E. (1998). Progenitors of dorsal commissural interneurons are defined by MATH1 expression. Development 125,919 -928.[Abstract]
Helms, A. W., Abney, A. L., Ben-Arie, N., Zoghbi, H. Y. and Johnson, J. E. (2000). Autoregulation and multiple enhancers control Math1 expression in the developing nervous system. Development 127,1185 -1196.[Abstract]
Helms, A. W. and Johnson, J. E. (2003). Specification of dorsal spinal cord interneurons. Curr. Opin. Neurobiol. 13,42 -49.[CrossRef][Medline]
Jaynes, J. B. and O'Farrell, P. H. (1991). Active repression of transcription by the Engrailed homeodomain protein. EMBO J. 10,1427 -1433.[Medline]
Lee, K. J. and Jessell, T. M. (1999). The specification of dorsal cell fates in the vertebrate central nervous system. Annu. Rev. Neurosci. 22,261 -294.[CrossRef][Medline]
Lee, S.-K. and Pfaff, S. L. (2003). Synchronization of neurogenesis and motor neuron specification by direct coupling of bHLH and homeodomain transcription factors. Neuron 38,731 -745.[CrossRef][Medline]
Muhr, J., Andersson, E., Persson, M., Jessell, T. M. and Ericson, J. (2001). Groucho-mediated transcriptional repression establishes progenitor cell pattern and neuronal fate in the ventral neural tube. Cell 104,861 -873.[CrossRef][Medline]
Novitch, B. G., Chen, A. I. and Jessell, T. M. (2001). Coordinate regulation of motor neuron subtype identity and pan-neuronal properties by the bHLH repressor Olig2. Neuron 31,773 -789.[CrossRef][Medline]
Patterson, K. D., Cleaver, O., Gerber, W. V., White, F. G. and Krieg, P. A. (2000). Distinct expression patterns for two Xenopus Bar homeobox genes. Dev. Genes Evol. 210,140 -144.[CrossRef][Medline]
Saba, R., Nakatsuji, N. and Saito, T. (2003).
Mammalian BarH1 confers commissural neuron identity on dorsal cells in the
spinal cord. J. Neurosci.
23,1987
-1991.
Saito, T., Lo, L., Anderson, D. J. and Mikoshiba, K. (1996). Identification of novel paired homeodomain protein related to C. elegans unc-4 as a potential downstream target of MASH1. Dev. Biol. 180,143 -155.[CrossRef][Medline]
Saito, T., Sawamoto, K., Okano, H., Anderson, D. J. and Mikoshiba, K. (1998). Mammalian BarH homologue is a potential regulator of neural bHLH genes. Dev. Biol. 199,216 -225.[CrossRef][Medline]
Saito, T. and Nakatsuji, N. (2001). Efficient gene transfer into the embryonic mouse brain using in vivo electroporation. Dev. Biol. 240,237 -246.[CrossRef][Medline]
Schoenherr, C. J. and Anderson, D. J. (1995). Silencing is golden: negative regulation in the control of neuronal gene transcription. Curr. Opin. Neurobiol. 5, 566-571.[CrossRef][Medline]
Smith, S. T. and Jaynes, J. B. (1996). A conserved region of engrailed, shared among all en-, gsc-, Nk1-, Nk2- and msh-class homeoproteins, mediates active transcriptional repression in vivo. Development 122,3141 -3150.[Abstract]
Triezenberg, S. J., Kingsbury, R. C. and McKnight, S. L.
(1988). Functional dissection of VP16, the trans-activator of
herpes simplex virus immediate early gene expression. Genes
Dev. 2,718
-729.
Yee, S. P. and Rigby, P. W. (1993). The
regulation of myogenin gene expression during the embryonic development of the
mouse. Genes Dev. 7,1277
-1289.
Wilkinson, D. G. (1992). In Situ Hybridization: a Practical Approach. Oxford: IRL Press.
William, C. M., Tanabe, Y. and Jessell, T. M.
(2003). Regulation of motor neuron subtype identity by repressor
activity of Mnx class homeodomain proteins.
Development 130,1523
-1536.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||