|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 12 April 2006
doi: 10.1242/dev.02350
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 INRA MSNC Group, DEPSN, Institut A. Fessard, CNRS, 1 avenue de la Terrasse,
91198 Gif-sur-Yvette, France.
2 Oncodesign, 20 rue Jean Mazen, 21000 Dijon, France.
* Author for correspondence (e-mail: joly{at}iaf.cnrs-gif.fr)
Accepted 8 March 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Fish, Zebrafish, Oct4, Pou2, Ol-pou5f1, Epiboly, Pluripotency
| INTRODUCTION |
|---|
|
|
|---|
Our experimental model is the Japanese medaka Oryzias latipes, a
currently emerging vertebrate model
(Wittbrodt et al., 2002
) with
features similar to those of the zebrafish Danio rerio (high
fecundity, small size and external development of transparent embryos). The
teleost optic tectum (ot) is a cortical structure of the dorsal midbrain
(Nguyen et al., 1999
), which
grows by the successive addition of open rings of progenitor cells originating
from a population of stem cells located at the periphery of the organ. In this
structure, mitotic cells are located at the margin, differentiating cells at
the center, and in between lies an `arrest zone', where cell cycle-exit genes
are expressed (Nguyen et al.,
2001a
). We took advantage of this topographically oriented growth
mode to undertake a systematic whole-mount in situ hybridization (WMISH)
screen on the medaka CNS (Deyts et al.,
2005
; Nguyen et al.,
2001b
), aimed at identifying novel molecules linked to cell
proliferation in the CNS and, potentially, in other tissues. These studies
demonstrated the predictive value of this approach, at least for the genes
expressed in the arrest zone; there is a very strong correlation between the
expression pattern and gene function (in that case, downregulation of the cell
cycle). Among the candidate genes isolated in the course of our screen, a
previously uncharacterized gene was called simplet (smp).
Although Smp has no characterized biochemical domains, it binds to the 14-3-3
adaptor proteins. In addition, the human homolog FAM53B binds to the SKIIP
protein, known to modulate the activity of transcriptional regulators
implicated in cell proliferation. Based on smp expression patterns
during embryonic development, and on gain- or loss-of-function experiments, we
propose that smp is involved in the regulation of cell proliferation
and, possibly, in the maintenance of pluripotency.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning and sequence analysis
A 1025 bp fragment of simplet 3' cDNA end was isolated from
a library of medaka anterior brain (35-somite, stage 30-31) in the course of
the in situ hybridization screen (Nguyen
et al., 2001b
). To isolate the 5' cDNA sequence, total RNA
was extracted from medaka anterior brain at 18-19 somites (stage 25) and
RT-PCR was further performed, following the SMART RACE cDNA Amplification Kit
instructions (Clontech, CA, USA). Synthesized cDNA was used as template for
PCR amplification of the full-length simplet coding region using the
following primers: forward,
5'-CATGCCATGGCCCAGTTGGAGCAACTTGGAAGGAG-3'; and reverse,
5'-ATAGTTTAGCGGCCGCTTTCATATGAGCTCCTCAAGACATTGG-3'. A fragment
(
1.5 kb) was purified with the QIAEX II Gel Extraction Kit (QIAGEN) and
subcloned into pCRII-TOPO (InVitrogen). The simplet sequence was
compared with the GenBank and SwissProt databases using BLAST (National Center
for Biotechnology Information, USA). Homologous protein sequences of fugu were
downloaded from the JGI website
(http://genome.jgi-psf.org/Takru4/Takru4.home.html).
Alignments were created using MultAlign
(http://prodes.toulouse.inra.fr/multalin/multalin.html)
(Corpet, 1988
). For
phylogenetic analyses, we used the CLUSTAL X Multiple Sequence Alignment
Program (Thompson et al.,
1997
) and MEGA version 2.1
(Kumar et al., 2001
). To
isolate medaka Ol-pou5f1, we blasted the medaka genome sequence using
the NIG DNA sequencing center website
(http://dolphin.lab.nig.ac.jp/medaka)
to identify the closest medaka relative to zebrafish Pou2. Ol-pou5f1
PCR primers were: forward, 5'-CTGTGGGGCCAGAAGCTCAGATGAT-3'; and
reverse, 5'-TGCAGTTGAGGTGGGTCTCAGC-3'. A 162 bp fragment
containing the whole ORF was cloned; the medaka protein is 56% identical to
the zebrafish protein.
Yeast two-hybrid screen
Yeast two-hybrid screen using the entire ORF of the human smp
related gene FAM53B was carried out by Dualsystems Biotech AG
(Zurich, Switzerland). For the screen using the mutated FAM53B ORF,
the underlined serine of each 14-3-3 binding domain was changed into alanine
to generate mutations sites (RSXPSXP). Library plasmids
were isolated from positive clones and assayed in a FAM53B dependency
test with (1) the bait plasmid and (2) a control bait encoding a LexA-laminC
fusion using a mating strategy (Kolonin et
al., 2000
). Bait dependent interactors were further analyzed for
homologies with BLASTp.
Plasmids
For immunoprecipitation, the smp cDNA insert was excised from the
pCRII-TOPO plasmid and inserted into a pTracer plasmid (InVitrogen). A FLAG
epitope was fused to the N-terminal protein extremity by insertion between the
KpnI and PpuMI restriction sites of the PCR amplified
product obtained with a 5' primer containing the FLAG sequence,
CGGGTACCGGCGCGCCGCCACCATGGACTACAAAGACGATGACGACAAGTCCAACGTCGAGTTATCGAGCAGC and
a 3' primer, TGTGGAGAGGAAAGGTCCTGCG, using pTracer/Ol-smp as
template. To amplify human FLAG/FAM53B, we used a cDNA library from
MCF-7 cells. PCR product was obtained with the FLAG-containing 5' primer
GGGTACCGGCGCGCCGCCACCATGGACTACAAAGACGATGACGACAAGGTGATGGTCCTAGTGAAAGCC and a
3' primer, GAATTCCTCAGTTCTTCTCTATCTGCTCAATGTCC, cut by KpnI and
EcoRI restriction enzymes and inserted into the pTracer plasmid in
the same restriction sites.
Immunoprecipitation
HCT-116 cells were transfected with empty pTracer,
pTracer/FLAG/Ol-smp and pTracer/FLAG/FAM53B with
lipofectamine 2000 (Invitrogen). After 72 hours, cells were lyzed by RIPA
buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5% Deoxycholate, 1% Triton,
0.2% SDS] with a proteinase inhibitor cocktail tablet (Roche), and
immunoprecipitated with M2 EzView beads (Sigma). After protein denaturation,
immunoprecipitated complexes were separated by 15% SDS-PAGE and transferred
onto a nitrocellulose membrane. FLAG/Ol-Smp and FLAG/FAM53B proteins
were revealed with anti-FLAG M5 antibody (Sigma), and 14-3-3 proteins with
polyclonal antibody (Upstate), followed by HRP-coupled secondary antibodies,
before ECL treatment (Amersham). EGF-stimulated A431 cell lysate was loaded as
a positive control for 14-3-3 proteins. Detection of SKIIP proteins was
performed using an anti-human SKIIP antibody (a gift of Dr L. Banks)
(Prathapam et al., 2002
).
Whole-mount in situ hybridization (WMISH)
WMISH were performed with an Intavis automat. Embryos from the one-cell
stage to the late gastrula stage (stage 17) were fixed overnight in 4%
paraformaldehyde (PFA) and 0.05% glutaraldehyde in 0.12 M phosphate buffer
(PBS, pH 7.4); from the late gastrula stage onwards, embryos were fixed
overnight in 4% PFA. Sense and antisense digoxigenin-UTP RNA probes were
prepared according to Joly et al. (Joly et
al., 1997
). From the 256/512-cell stage (stage 9), embryos were
subjected to Proteinase K treatment (25 µg/ml) for the following times: 1
minute for embryos at the 512-cell stage, 3 minutes for later stages until mid
gastrula (stage 15), 5 minutes for 2-somite embryos (stage 19), 10 minutes for
16-somite embryos (stage 24) and 30 minutes for 35-somite embryos (stage 30).
Control sense probe did not lead to any detectable signal. Embryos were
cleared in glycerol and mounted in 1% methylcellulose (Sigma). Alternatively,
specimens were dehydrated in methanol and mounted in a 2:1 mixture of
benzylbenzoate:benzylalcohol. For sectioning, stained embryos were dehydrated,
embedded in paraffin wax and microtome sectioned (8 µm thickness).
Morpholino (MO) and RNA microinjections
For knockdown and clonal analyses, individual blastomeres of two- or
32-cell stage medaka embryos were microinjected with specific MOs. Dead
embryos (5%) were discarded 2 hours after injection and not considered in
subsequent counting. MOs were designed and synthesized by Gene-Tools, LLC
(Corvallis). The sequence of the smp-morpholino I (smpMOI)
was:
5'-CATGGCAACACACATCCTCCTTCCA-3'.
The sequence of the smp-morpholino II (smpMOII) was:
5'-GTTGCTCCAACTGGGACAATCTACA-3'.
Underlined bases were changed to generate mis-paired control morpholinos
(smpMOIC and -IIC). To use them as in vivo dyes, 3'-end
modifications of morpholinos with carboxyfluorescein or lissamine were
performed. Morpholinos were resuspended to 20 mg/ml (about 2 mM) in sterile
RNase-free water. Knockdown experiments were performed with 2 to 10 mg/ml of
smpMO, and clonal and rescue experiments with 8 mg/ml of
smpMO. Embryos injected with RNase-free water or a balanced salt
solution gave the same results.
For overexpression, capped mRNAs encoding Smp or EGFP were in vitro synthesized (Ambion mMessage mMachine kit). EGFP RNA was injected either alone or together with smpRNA. For rescue experiments, five independent experiments were performed with more than 50 embryos in each batch.
TUNEL assay
The development of smpMOI- or smpMOIC-injected embryos (6
mg/ml) was arrested with 4% PFA, 0.05% glutaraldehyde (for 48 hours at
4°C). Fixed-embryos were mechanically dechorionated, permeabilised (0.1%
sodium citrate) and labelled for DNA strand breaks using the In Situ Cell
Death Detection Kit (TUNEL, Roche). Staining substrate was Fast-Red
(Roche).
DAPI staining
Following MO injection into two- or 32-cell-stage embryos (8 mg/ml),
development was arrested in 4% PFA, 0.05% glutaraldehyde (2 hours). Embryos
were dechorionated and incubated for 30 minutes with DAPI fluorochrome (300 nM
in PBS/Tween 1%). Blastoderms were detached from the yolk and mounted on
PPD-glycerol (1,2-Phenylendiamin, Merck) for microscopy observation. For
clonal analyses, nuclear morphology was analyzed under a laser scanning
confocal microscope.
Flow cytometry
smpMOI-injected (10 mg/ml) and uninjected embryos were frozen in
liquid nitrogen at early gastrula stage (13 hours post fertilization, hpf) and
dechorionated in Galbraith buffer
(Galbraith et al., 1983
).
Nuclei were separated from debris by filtration through a 50-µm nylon mesh.
Filtrates were treated with RNase A (100 µg/ml) and stained with 300 µl
propidium iodide (50 µg/ml). Nuclei (10,000) were analyzed with an EPICS
Elite ESP flow cytometer. Nuclei from adult medaka liver cells (G1 arrested)
were used for calibration. Histograms were obtained using MultiCycle AV
software.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
Two conserved domains [named homology regions I and II (HRI and II)] were
found in Smp proteins (Fig.
1A). The HRII domain was shown to contain a putative nuclear
localization signal (NLS). We used HRI and HRII to construct a phylogenetic
tree with the identified set of smp-related genes
(Fig. 1B). These genes appeared
to be organized into two main groups. A first group (A) contains two human
predicted proteins (Hs XP094066 and Hs AAF63766) and the
previously identified chicken DNTNP [Dorsal Neural Tube Nuclear
Protein, Gg AAL76115 (Jun et al.,
2002
)]. Globally, two genes are found in mammals, whereas a single
member was identified in amphibians and chicken, suggesting that an additional
duplication event may have occurred in the mammalian lineage. In the other
group (B), which contains smp, we identified only one gene in each
tetrapod species. The human gene (Hs Q14153) was successively named
KIAA0140, by the Kazusa DNA Research Institute, and FAM53B
by HUGO Gene Nomenclature Committee after its identification by systematic
genome data mining. By contrast, medaka, fugu, and tetraodon have two genes in
this group. This probably results from the well-known increase in gene number
in fish following a major duplication event that occurred in the teleostean
lineage. Zebrafish presents only one gene, either as a result of a later loss
of one of the paralogs, or because the sequence of a second gene is not
present in the current release of the zebrafish genome.
smp is expressed predominantly in proliferating cells throughout embryonic development Maternal expression
The smp expression pattern was examined by WMISH. Maternal
transcripts were detected at the one-cell stage and were found to be evenly
distributed among all undifferentiated blastomeres during the first five
cleavages (Fig. 2A,B). In
teleost embryos, three individual cell layers are progressively determined
before the mid-blastula transition (MBT), which corresponds to the onset of
zygotic transcription and which begins around the 1000-cell stage (stage 10)
(Aizawa et al., 2003
;
Iwamatsu, 2004
). The central
blastomeres, which produce the embryo proper, are not specified [except for
the germinal precursors (Yoon et al.,
1997
)] and proliferate actively until MBT. By contrast, the
marginal blastomeres, which constitute the future extra-embryonic tissues [the
enveloping layer (EVL) and the yolk syncytial layer (YSL)
(Kimmel and Law, 1985
)], are
specified early, although they are not irreversibly committed to their fate
(Ho, 1992
;
Kane et al., 1992
;
Kimmel et al., 1990
).
Strikingly, by the seventh cell cleavage (64/128-cell stage, stage 8),
smp transcripts were no longer detected in peripheral blastomeres,
but only in central ones (Fig.
2C-E). The maternal smp expression suggests that it is
associated with a cellular undifferentiated state and/or with an active cell
proliferation.
|
Zygotic expression
Although WMISH was not sensitive enough to detect smp expression
after MBT in the thin cells layers of the gastrula, real-time PCR experiments
allowed us to clearly detect zygotic smp transcripts at MBT and later
(data not shown). WMISH on 2-somite (stage 19) and 16-somite (stage 24)
embryos revealed that zygotic smp transcripts are restricted to the
anterior midline of the telencephalon and to the prospective
midbrain-hindbrain boundary (mhb, Fig.
2G,H). In 35-somite embryos (stage 30), transcripts were detected
in retinal progenitor cells and other parts of the CNS, particularly in
proliferative zones of the forebrain, the optic tectum, the mhb and the
hindbrain rhombic lips (Fig.
2I). At these stages, WMISH also revealed an expression in the
developing somites, but we focused subsequent analysis on the neural
expression. In the CNS, we carefully compared the areas of smp
expression with proliferative zones, as revealed by WMISH with a PCNA
probe (Proliferating Cell Nuclear Antigen,
Fig. 3). Transversal sections
in the CNS after WMISH at the 34/35-somite stage (stage 29-30) showed that
smp and PCNA expression domains are similar in the forebrain
(Fig. 3B-E) and in the midbrain
(Fig. 3F,G). In the hindbrain,
such comparisons were difficult: the smp expression pattern is highly
dynamic and differentiation events take place very early. Overall, our results
suggest that smp is expressed in CNS mitotic cells.
|
FAM53B interacts with 14-3-3 and SKIIP proteins
To identify molecular partners of Smp proteins, a yeast two-hybrid screen
was performed. We used the human smp gene (FAM53B) as bait
to screen a human adult brain cDNA library. Among the clones analyzed, the
majority (14 out of 17) corresponded to 14-3-3 chaperone proteins, which
represent a large and highly conserved family [from yeast to mammals
(Fu et al., 2000
;
Kultz et al., 2001
;
Wang and Shakes, 1996
)] of
sequence-specific phosphoserine-binding proteins. These proteins are
ubiquitously expressed and are especially abundant in the CNS
(Takahashi, 2003
). To confirm
that both medaka and human Smp interact with 14-3-3 proteins, we performed an
immunoprecipitation experiment using FLAG-tagged medaka and human Smp proteins
(Fig. 1C). Analysis of the
complex clearly showed that 14-3-3 proteins were co-immunoprecipitated only
when Ol-Smp or FAM53B are produced in cells. We also observed a degradation
profile of medaka Smp, probably indicating a protein instability in human
cells. However, the functional property to interact with 14-3-3 was conserved
between fish and human. A closer analysis of the Smp sequence identified a
conserved consensus 14-3-3 recognition motif (RSXPSXP)
(Muslin et al., 1996
) in both
HRI and HRII conserved domains (Fig.
1A), further strengthening the hypothesis that 14-3-3 interaction
is important for Smp function. This motif has been demonstrated to mediate
interactions between 14-3-3
and the yeast Raf-1 kinase
(Clark et al., 1997
). Recently,
in vivo analysis in Drosophila showed that 14-3-3 proteins are
involved in the correct timing and progression of normal cell cycle through
the regulation of sub-cellular protein localization
(Su et al., 2001
). In
addition, studies in Xenopus showed that 14-3-3 proteins are
important in vertebrate embryonic development
(Wu and Muslin, 2002
).
Therefore, Smp represents a new partner of 14-3-3 proteins, which are involved
in the control of cell signaling, cell division and apoptosis
(Fu et al., 2000
;
Hermeking, 2003
).
To identify other Smp partners, a second yeast two-hybrid screen was
performed using the human FAM53B bait with an inactivating mutation
in each 14-3-3 binding domain (see Materials and methods). Of the 34 clones
showing a specific interaction with the bait, 29 corresponded to known human
proteins (see Table S1 in the supplementary material). Among them, 20 still
corresponded to the previously characterized 14-3-3 ß,
and
interactors. The presence of these prey, despite the fact that their canonical
binding domains were mutated, indicated that their interaction with FAM53B is
not only mediated by the canonical phosphoserine-containing motif. Recent work
has demonstrated that 14-3-3 can indeed bind to other motifs, including
unphosphorylated sites (Aitken,
2002
; Fuglsang et al.,
2003
). Two clones were identified as unknown genes (KIAA
hypothetical proteins), while three others presented no significant similarity
with sequences in public protein databases. These latter three clones
corresponded to human cDNA 3' regions. We focused our attention on one
clone corresponding to the Ski-interacting protein (SKIIP).
Co-immunoprecipitation experiments confirmed that the human SKIIP and FAM53B
proteins (but not the medaka Smp) interact with each other
(Fig. 1C, see also Materials
and methods). Interactions between these two families of proteins are
potentially important, as SKIIP is involved in signaling pathways controlling
cell proliferation along with vitamin D, retinoic acid, oestrogens,
glucocorticoids, Notch1-IC and TGFß
(Prathapam et al., 2002
). For
example, Ski binds to the DNA-binding protein Smad and recruits a repression
complex including HDAC. The Ski/SKIIP complex was also shown to overcome
pRb-mediated cell cycle arrest in G1
(Prathapam et al., 2002
).
SKIIP proteins are part of the spliceosome and can have either an activator or
a repressor role in transcription, as an adaptor that connects DNA-binding
proteins to other transcriptional regulators
(Prathapam et al., 2002
).
FAM53B might therefore be a new component in this complex that was undetected
in screens for proliferation regulators performed in protostome models because
of its vertebrate-specific occurrence. It will be interesting to test whether
Smp, and/or the protein encoded by the other medaka ortholog to FAM53B
(Ol 11143), interact with medaka Ski/SKIIP. This is necessary to
establish whether Smp function can be mediated by an interaction with SKIIP.
Because Ski is a muscular proto-oncogene and smp is
expressed in somites, it would be interesting to analyze their functional
relationships in mesodermal tissue.
|
|
|
Phenotype specificity was assessed by injecting a second non-overlapping morpholino (smpMOII) and the corresponding control containing base-pair mismatches (smpMOIC and smpMOIIC; Table 1). Phenotypes similar to those observed with smpMOI were obtained with smpMOII (with reduced efficiency). No defects were observed following injection of control MOs, indicating a high specificity of both smpMO.
Rescue experiments were performed by co-injecting smpMOI (8 mg/ml) and mRNA (50 and 100 µg/ml) encoding Smp but devoid of the 5'UTR. The resulting numbers of wild-type embryos at 25 hpf (late gastrulation) were significantly larger (55%) than when injecting MO alone (37%, P<0.003 by Student's paired t-test). These data indicated a partial rescue of epiboly delay, and confirmed that the defects are a specific consequence of smp knockdown. At greater smpRNA concentrations (150 to 500 µg/ml) no rescue was observed. At such concentrations, smpRNA injections led to specific defects, including epiboly delays (see below), which may mask the rescue effect.
smp does not interfere with embryonic patterning and does not induce apoptosis
To determine whether smpMO injections produce abnormal patterning
events during neurogenesis, we examined the expression patterns of several
brain markers (fgf8, wnt1, pax2 and otx2) along the
anteroposterior and dorsoventral axis of mhb-affected embryos at the 18-somite
stage (stage 25, data not shown). For these markers, no major patterning
defects were detected and we thus focused our subsequent analysis on cell
proliferation, apoptosis and cell pluripotency.
We first analyzed the effect of smpMO injection on apoptosis, when
the smp knockdown effect becomes detectable, e.g. at the late
blastula stage (stage 11-12, 9 hpf, post-MBT), when apoptotic pathways become
active (Carter and Sible, 2003
;
Hensey and Gautier, 1997
)
(Fig. 5). Two-cell-injected
embryos were allowed to develop until late blastula stage and were stained
with DAPI to detect apoptotic bodies
(Huynh and Teel, 2000
;
Zong et al., 2003
). Nuclear
morphology analysis revealed no sign of apoptosis, not at this stage
(Fig. 5A,B) nor during early
gastrulation (data not shown). We then analyzed the effect of the
smpMO on apoptosis during neurulation
(Fig. 5C-G). MO-injected
embryos were allowed to develop until late gastrula and 18-somite stage [stage
17 (24 hpf) and stage 25 (49 hpf), respectively], and were analyzed for
apoptosis by the TUNEL method. No apoptosis above basal levels was detected
either at late gastrula stage (in class II embryos,
Fig. 5D) or at 18-somite stage
(in mhb-defective embryos), although the level of apoptosis was slightly
increased in extra-embryonic tissues (Fig.
5G). A slight increase in apoptotic cell number was observed in a
few class II embryos (Fig. 5E).
However, this was probably not a direct effect of the smpMO on
apoptosis, but rather a secondary phenomenon due to earlier developmental
defects initiated during gastrulation.
|
smp-morphant cells have a reduced cell proliferation but a normal cell cycle pattern
DAPI staining of two-cell stage smpMO-injected embryos suggested
that smp knockdown does not affect cell division before MBT
(Fig. 5A,B; data not shown). To
analyze the cycling properties of smp-morphant cells after MBT,
smp-morphant and control embryos were subjected to flow cytometry at
early gastrula stage (stage 13, Fig.
6). Whole-embryo DNA content was almost identical in both injected
and uninjected embryos, indicating no phase-specific cell block. In addition,
no endo-duplication phenomenon was observed (i.e. no cells with a DNA content
higher than 4N; data not shown).
To determine whether smp knockdown affects the cell proliferation rate, we performed a clonal analysis: we microinjected a single central blastomere of 32-cell stage embryos with a fluorescent smpMO or its corresponding control. In all cases, fluorescence remained confined to the injected blastomere and to its progeny, thus allowing us to follow proliferation activity in a wild-type context. Progeny of the injected blastomere was followed under a dissecting microscope until the end of gastrulation (Fig. 7). From the time of injection to MBT, both smpMO-injected and control-injected blastomeres would be expected to divide about five times and thus would display about 32 fluorescent descendent cells. A quantitative analysis was performed after MBT, at early gastrula stage (stage 14). Control embryos exhibited from 50 to 150 distinct fluorescent cells, indicating that about two or three additional rounds of division occurred after MBT (Fig. 7A,B,G). Within a single batch of embryos injected with smpMOI or smpMOII, embryos typically displayed a correct timing of epiboly but less fluorescent cells, indicating fewer divisions (Fig. 7D,E,G). This was confirmed in six independent experiments, in which 50% of the smpMO-injected embryos showed less than 50 isolated labelled cells (Fig. 7H). Among these embryos, the most affected showed about 10 isolated labelled cells and a single cluster of about 20 cells, bringing the total number of fluorescent cells to about 30. Because the total number of cells in these embryos is not far from that expected around MBT (32), and as we observed no delay in cell proliferation before MBT, we conclude that smp knockdown results in a dramatic reduction of cell proliferation, starting at MBT, in a cell-autonomous manner.
|
|
|
In clonal experiments, we noticed the presence of clusters of cells in
smpMO-injected embryos (Fig.
7D,E). Eventually, at the end of gastrulation, their descendants
were excluded from the embryonic axis (Fig.
7F), whereas smpMOC cells were found all along the
embryonic axis (Fig. 7C). Thus,
smpMO-containing cells also exhibit altered cell movements, which
might be linked to modified adhesion properties, and/or to the large size of
blastomeres. This could be one of the main factors causing delayed epiboly.
Indeed, in the course of a Tübingen screen for new zebrafish mutants
(Haffter and Nusslein-Volhard,
1996
), several mutants identified as affecting the cell cycle also
displayed an early epiboly arrest phenotype (Early Arrest Group Class I
mutants) (Kane et al., 1996
).
Furthermore, overexpression of the XCS1 (Xenopus cleavage
signal protein) gene in Xenopus embryos disturbs mitosis and leads to
abnormal gastrulation due to cell enlargement
(Nakamura et al., 2000
), and
the mouse Rnf2 (Ring1b) (Ring finger protein) null mutant
causes cell cycle inhibition together with gastrulation arrest
(Voncken et al., 2003
). Our
results thus provide an additional illustration of the tight link between cell
proliferation and the morphogenetic movements of epiboly: in absence of Smp,
the cycling activity of cells slows down and cells fail to move normally over
the yolk sphere, precluding further morphogenetic movements at
gastrulation.
smp regulates expression of Ol-pou5f1, homologous to pou2/oct4
Because early smp expression has features reminiscent of
Ol-pou5f1 (Fig. 2E,F),
we tested whether smp regulates Ol-pou5f1 expression. We
first examined its expression in smpMO-injected embryos. Decreased
expression of Ol-pou5f1 was observed after MBT in deep cells of early
gastrula stage embryos (stage 13; 10 out of 14 embryos), but not in the
enveloping cells (not expressing smp,
Fig. 8A,B). Later during
gastrulation, no difference could be detected (data not shown). These data
suggest that smp might be part of a network triggering the activation
of Ol-pou5f1 zygotic expression soon after MBT, whereas, at later
stages, the expression of Ol-pou5f1 might be under the control of
other factors, including redundant proteins.
Another cue for the link between smp and Ol-pou5f1 was provided by smp gain-of-function experiments. When smpRNA (500 µg/ml) was injected at the two-cell stage, most embryos displayed a perturbed and sometimes delayed gastrulation, as well as abnormal body axes during early somitogenesis; they eventually recovered, but showed midbrain and hindbrain defects (data not shown). When smpRNA (500 µg/ml) was injected at the 32-cell stage, gastrulation movements were not affected (Fig. 8C,D). In injected embryos (54 out of 109), the cell progeny was excluded from the embryo axis at the 2-somite stage (Fig. 8E,F), but it revealed no apparent modification of the cell number (Fig. 8C,D). Ol-pou5f1 expression was further analyzed into smp-overexpressing embryos at the 2-somite stage (stage 19) after two-cell stage injections (Fig. 8G-O). In control embryos, Ol-pou5f1 is predominantly expressed in the pluripotent cells of the tailbud and in the telencephalon (Fig. 8G). A massive ectopic expression of Ol-pou5f1 could be observed in the forebrain, in the mhb and in the hindbrain in about 60% of injected embryos (n=28, Fig. 8H). WMISH followed by transversal sections revealed an expansion of the expression domain in the telencephalon, and ectopic expression in the ventral mhb and rhombencephalic domains in smpRNA injected embryos (Fig. 8M-O), when compared with controls (Fig. 8J-L). In all embryos exhibiting strongly affected body axes, a more widespread expression was observed (n=14, Fig. 8I). smp and Ol-pou5f1 are not expressed in equivalent cells of normal embryos at this stage, with the putative exception of the telencephalon. Therefore, they may have similar functions in this latter domain, as well as in deep cells of late blastula and early gastrula. It would be interesting to examine whether smp directly activates Ol-pou5f1 transcription, and whether they cooperate to maintain cell pluripotency by activating known targets of Oct4 family proteins.
The discovery of a new vertebrate gene important for cell proliferation, and possibly for cell pluripotency, provides further support of an increase in the complexity of proliferation control in vertebrates. It will be of interest to investigate the possible role of smp genes (FAM53B) in tumorigenesis, and to examine their potential value as new targets for anti-cancer drugs.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/10/1881/DC1
| REFERENCES |
|---|
|
|
|---|
Aitken, A. (2002). Functional specificity in 14-3-3 isoform interactions through dimer formation and phosphorylation. Chromosome location of mammalian isoforms and variants. Plant Mol. Biol. 50,993 -1010.[CrossRef][Medline]
Aizawa, K., Shimada, A., Naruse, K., Mitani, H. and Shima, A. (2003). The medaka midblastula transition as revealed by the expression of the paternal genome. Gene Expr. Patterns 3,43 -47.[CrossRef][Medline]
Bai, C., Richman, R. and Elledge, S. J. (1994). Human cyclin F. EMBO J. 13,6087 -6098.[Medline]
Belting, H. G., Hauptmann, G., Meyer, D., Abdelilah-Seyfried,
S., Chitnis, A., Eschbach, C., Soll, I., Thisse, C., Thisse, B., Artinger, K.
B. et al. (2001). spiel ohne grenzen/pou2 is required during
establishment of the zebrafish midbrain-hindbrain boundary organizer.
Development 128,4165
-4176.
Burgess, S., Reim, G., Chen, W., Hopkins, N. and Brand, M. (2002). The zebrafish spiel-ohne-grenzen (spg) gene encodes the POU domain protein Pou2 related to mammalian Oct4 and is essential for formation of the midbrain and hindbrain, and for pre-gastrula morphogenesis. Development 129,905 -916.[Medline]
Carter, A. D. and Sible, J. C. (2003). Loss of XChk1 function triggers apoptosis after the midblastula transition in Xenopus laevis embryos. Mech. Dev. 120,315 -323.[CrossRef][Medline]
Clark, G. J., Drugan, J. K., Rossman, K. L., Carpenter, J. W.,
Rogers-Graham, K., Fu, H., Der, C. J. and Campbell, S. L.
(1997). 14-3-3 zeta negatively regulates raf-1 activity by
interactions with the Raf-1 cysteine-rich domain. J. Biol.
Chem. 272,20990
-20993.
Corpet, F. (1988). Multiple sequence alignment
with hierarchical clustering. Nucleic Acids Res.
16,10881
-10890.
Deyts, C., Candal, E., Joly, J. and Bourrat, F. (2005). An automated in situ hybridization screen in the medaka to identify unknown neural genes. Dev. Dyn. 234,698 -708.[CrossRef][Medline]
Fu, H., Subramanian, R. R. and Masters, S. C. (2000). 14-3-3 proteins: structure, function, and regulation. Annu. Rev. Pharmacol. Toxicol. 40,617 -647.[CrossRef][Medline]
Fuglsang, A. T., Borch, J., Bych, K., Jahn, T. P., Roepstorff,
P. and Palmgren, M. G. (2003). The binding site for
regulatory 14-3-3 protein in plant plasma membrane H+-ATPase: involvement of a
region promoting phosphorylation-independent interaction in addition to the
phosphorylation-dependent C-terminal end. J. Biol.
Chem. 278,42266
-42272.
Furutani-Seiki, M. and Wittbrodt, J. (2004). Medaka and zebrafish, an evolutionary twin study. Mech. Dev. 121,629 -637.[CrossRef][Medline]
Galbraith, D. W., Harkins, K. R., Maddox, J. M., Ayres, N. M.,
Sharma, D. P. and Firoozabady, E. (1983). Rapid flow
cytometric analysis of the cell cycle in intact plant tissues.
Science 220,1049
-1051.
Haffter, P. and Nusslein-Volhard, C. (1996). Large scale genetics in a small vertebrate, the zebrafish. Int. J. Dev. Biol. 40,221 -227.[Medline]
Hauptmann, G. and Gerster, T. (1995). Pou-2-a zebrafish gene active during cleavage stages and in the early hindbrain. Mech. Dev. 51,127 -138.[CrossRef][Medline]
Hensey, C. and Gautier, J. (1997). A developmental timer that regulates apoptosis at the onset of gastrulation. Mech. Dev. 69,183 -195.[CrossRef][Medline]
Hermeking, H. (2003). The 14-3-3 cancer connection. Nat. Rev. Cancer 3, 931-943.[CrossRef][Medline]
Ho, R. K. (1992). Cell movements and cell fate during zebrafish gastrulation. Dev. Suppl.65 -73.
Hong, Y., Winkler, C., Liu, T., Chai, G. and Schartl, M. (2004). Activation of the mouse Oct4 promoter in medaka embryonic stem cells and its use for ablation of spontaneous differentiation. Mech. Dev. 121,933 -943.[CrossRef][Medline]
Huynh, H. T. and Teel, R. W. (2000). Selective induction of apoptosis in human mammary cancer cells (MCF-7) by pycnogenol. Anticancer Res. 20,2417 -2420.[Medline]
Iwamatsu, T. (1994). Stages of normal development in the medaka Oryzias latipes. Zool. Sci. 11,825 -839.
Iwamatsu, T. (2004). Stages of normal development in the medaka Oryzias latipes. Mech. Dev. 121,605 -618.[CrossRef][Medline]
Joly, J. S., Bourrat, F., Nguyen, V. and Chourrout, D.
(1997). Ol-Prx 3, a member of an additional class of
homeobox genes, is unimodally expressed in several domains of the developing
and adult central nervous system of the medaka (Oryzias latipes).
Proc. Natl. Acad. Sci. USA
94,12987
-12992.
Jun, L., Balboni, A. L., Laitman, J. T. and Bergemann, A. D. (2002). Isolation of DNTNP, which encodes a potential nuclear protein that is expressed in the developing, dorsal neural tube. Dev. Dyn. 224,116 -123.[CrossRef][Medline]
Kane, D. A., Warga, R. M. and Kimmel, C. B. (1992). Mitotic domains in the early embryo of the zebrafish. Nature 360,735 -737.[CrossRef][Medline]
Kane, D. A., Maischein, H. M., Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J. et al. (1996). The zebrafish early arrest mutants. Development 123, 57-66.[Abstract]
Kango-Singh, M., Nolo, R., Tao, C., Verstreken, P., Hiesinger, P. R., Bellen, H. J. and Halder, G. (2002). Shar-pei mediates cell proliferation arrest during imaginal disc growth in Drosophila. Development 129,5719 -5730.[CrossRef][Medline]
Karsten, S. L., Kudo, L. C., Jackson, R., Sabatti, C., Kornblum, H. I. and Geschwind, D. H. (2003). Global analysis of gene expression in neural progenitors reveals specific cell-cycle, signaling, and metabolic networks. Dev. Biol. 261,165 -182.[CrossRef][Medline]
Kimmel, C. B. and Law, R. D. (1985). Cell lineage of zebrafish blastomeres. II. Formation of the yolk syncytial layer. Dev. Biol. 108,86 -93.[CrossRef][Medline]
Kimmel, C. B., Warga, R. M. and Schilling, T. F.
(1990). Origin and organization of the zebrafish fate map.
Development 108,581
-594.
Kolonin, M. G., Zhong, J. and Finley, R. L. (2000). Interaction mating methods in two-hybrid systems. Methods Enzymol. 328,26 -46.[Medline]
Kong, M., Barnes, E. A., Ollendorff, V. and Donoghue, D. J. (2000). Cyclin F regulates the nuclear localization of cyclin B1 through a cyclin-cyclin interaction. EMBO J. 19,1378 -1388.[CrossRef][Medline]
Kultz, D., Chakravarty, D. and Adilakshmi, T.
(2001). A novel 14-3-3 gene is osmoregulated in gill epithelium
of the euryhaline teleost Fundulus heteroclitus. J. Exp.
Biol. 204,2975
-2985.
Kumar, S., Tamura, K., Jakobsen, I. B. and Nei, M.
(2001). MEGA2: molecular evolutionary genetics analysis software.
Bioinformatics 17,1244
-1245.
Muslin, A. J., Tanner, J. W., Allen, P. M. and Shaw, A. S. (1996). Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell 84,889 -897.[CrossRef][Medline]
Nakamura, H., Wu, C., Kuang, J., Larabell, C. and Etkin, L. D. (2000). XCS-1, a maternally expressed gene product involved in regulating mitosis in Xenopus. J. Cell Sci. 113,2497 -2505.[Abstract]
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene `knockdown' in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]
Nguyen, V., Deschet, K., Henrich, T., Godet, E., Joly, J. S., Wittbrodt, J., Chourrout, D. and Bourrat, F. (1999). Morphogenesis of the optic tectum in the medaka (Oryzias latipes): a morphological and molecular study, with special emphasis on cell proliferation. J. Comp. Neurol. 413,385 -404.[CrossRef][Medline]
Nguyen, V., Candal Suarez, E. M., Sharif, A., Joly, J. S. and Bourrat, F. (2001a). Expression of Ol-KIP, a cyclin-dependent kinase inhibitor, in embryonic and adult medaka (Oryzias latipes) central nervous system. Dev. Dyn. 222,439 -449.[CrossRef][Medline]
Nguyen, V., Joly, J. and Bourrat, F. (2001b). An in situ screen for genes controlling cell proliferation in the optic tectum of the medaka (Oryzias latipes). Mech. Dev. 107, 55-67.[CrossRef][Medline]
Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M. and Hamada, H. (1990). A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell 60,461 -472.[CrossRef][Medline]
Prathapam, T., Kuhne, C. and Banks, L. (2002).
Skip interacts with the retinoblastoma tumor suppressor and inhibits its
transcriptional activity. Nucleic Acids Res.
30,5261
-5268.
Roberts, J. M. (1999). Evolving ideas about cyclins. Cell 98,129 -132.[CrossRef][Medline]
Rosner, M. H., Vigano, M. A., Ozato, K., Timmons, P. M., Poirier, F., Rigby, P. W. and Staudt, L. M. (1990). A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345,686 -692.[CrossRef][Medline]
Scholer, H. R., Balling, R., Hatzopoulos, A. K., Suzuki, N. and Gruss, P. (1989). Octamer binding proteins confer transcriptional activity in early mouse embryogenesis. EMBO J. 8,2551 -2557.[Medline]
Scholer, H. R., Ruppert, S., Suzuki, N., Chowdhury, K. and Gruss, P. (1990). New type of POU domain in germ line-specific protein Oct-4. Nature 344,435 -439.[CrossRef][Medline]
Su, T. T., Parry, D. H., Donahoe, B., Chien, C. T., O'Farrell,
P. H. and Purdy, A. (2001). Cell cycle roles for two 14-3-3
proteins during Drosophila development. J. Cell Sci.
114,3445
-3454.
Takahashi, Y. (2003). The 14-3-3 proteins: gene, gene expression, and function. Neurochem. Res. 28,1265 -1273.[CrossRef][Medline]
Takeda, H., Matsuzaki, T., Oki, T., Miyagawa, T. and Amanuma,
H. (1994). A novel POU domain gene, zebrafish pou2:
expression and roles of two alternatively spliced twin products in early
development. Genes Dev.
8, 45-59.
Tapon, N., Harvey, K. F., Bell, D. W., Wahrer, D. C., Schiripo, T. A., Haber, D. A. and Hariharan, I. K. (2002). salvador Promotes both cell cycle exit and apoptosis in Drosophila and is mutated in human cancer cell lines. Cell 110,467 -478.[CrossRef][Medline]
Tetzlaff, M. T., Bai, C., Finegold, M., Wilson, J., Harper, J.
W., Mahon, K. A. and Elledge, S. J. (2004). Cyclin F
disruption compromises placental development and affects normal cell cycle
execution. Mol. Cell. Biol.
24,2487
-2498.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and
Higgins, D. G. (1997). The CLUSTAL_X windows interface:
flexible strategies for multiple sequence alignment aided by quality analysis
tools. Nucleic Acids Res.
25,4876
-4882.
Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R.
J., Sutton, G. G., Smith, H. O., Yandell, M., Evans, C. A., Holt, R. A. et
al. (2001). The sequence of the human genome.
Science 291,1304
-1351.
Voncken, J. W., Roelen, B. A., Roefs, M., de Vries, S.,
Verhoeven, E., Marino, S., Deschamps, J. and van Lohuizen, M.
(2003). Rnf2 (Ring1b) deficiency causes gastrulation arrest and
cell cycle inhibition. Proc. Natl. Acad. Sci. USA
100,2468
-2473.
Wang, W. and Shakes, D. C. (1996). Molecular evolution of the 14-3-3 protein family. J. Mol. Evol. 43,384 -398.[Medline]
Wittbrodt, J., Shima, A. and Schartl, M. (2002). Medaka - a model organism from the far East. Nat. Rev. Genet. 3,53 -64.[CrossRef][Medline]
Wu, C. and Muslin, A. J. (2002). Role of 14-3-3 proteins in early Xenopus development. Mech. Dev. 119, 45-54.[CrossRef][Medline]
Wullimann, M. F. and Knipp, S. (2000). Proliferation pattern changes in the zebrafish brain from embryonic through early postembryonic stages. Anat. Embryol. 202,385 -400.[CrossRef][Medline]
Yamamoto, T. (1975). Medaka (killifish) Biology and Strains. Tokyo: Keigaku.
Yoon, C., Kawakami, K. and Hopkins, N. (1997). Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development 124,3157 -3165.[Abstract]
Zong, W. X., Li, C., Hatzivassiliou, G., Lindsten, T., Yu, Q.
C., Yuan, J. and Thompson, C. B. (2003). Bax and Bak can
localize to the endoplasmic reticulum to initiate apoptosis. J.
Cell Biol. 162,59
-69.
| |||||