|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 April 2006
doi: 10.1242/dev.02373
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3204, USA.
* Author for correspondence (e-mail: sxlcline{at}berkeley.edu)
Accepted 20 March 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila melanogaster, Transcription, DNA motif, Midblastula transition, Enhancer, Temporal regulation
| INTRODUCTION |
|---|
|
|
|---|
Even for the frog, however, where the concept of a `midblastula transition'
marking the onset of widespread zygotic transcription has perhaps been most
thoroughly developed, a few genes are known to be transcribed earlier
(Kimelman et al., 1987
;
Nakakura et al., 1987
). The
same is true for Drosophila, although even the earliest fly genes are
not transcribed until 1 hour after fertilization (see
Fig. 1). Remarkably little is
known about the features of these unusually early genes that allow them to be
expressed at a time when most of the genome is silent. Previous studies
suggested that the time of onset of transcription for even these exceptional
genes is determined by the disappearance of repressors that are titrated by
DNA, ones presumably different from those proposed to suppress the majority of
zygotic genes (Brown et al.,
1991
; Pritchard and Schubiger,
1996
). Work we report here adds a new perspective on this process
by allowing us to infer that the binding of positively acting factors to
specific sites near the promoters of such exceptionally early genes must also
be an important factor in determining precisely when these genes become
active.
Our attention was drawn to pre-cellular blastoderm (pre-CB) transcription
by the fact that Drosophila sex-determination genes are among the
handful of genes expressed so early. Drosophila sex and X-chromosome
dosage compensation are determined by the number of X chromosomes, which are
counted by the feminizing switch gene Sex-lethal (Sxl) prior
to the cellular blastoderm stage (reviewed by
Cline and Meyer, 1996
).
Sxl counts by measuring the level of zygotic gene products generated
from at least four X-chromosome signal elements (XSEs): sisterlessA
(sisA), scute (sc, a.k.a. sisB),
outstretched (os, a.k.a. upd or sisC)
(Sefton et al., 2000
) and
runt (run). Diplo-X (female) embryos, but not haplo-X (male)
embryos, generate a level of XSE products high enough to activate
transcription at the Sxl `establishment' promoter, Pe, in
somatic cells, thereby producing a pulse of SXL protein. This female-specific
protein pulse subsequently engages a positive feedback loop on Sxl
pre-mRNA splicing that locks Sxl into its feminizing expression mode
throughout the rest of development.
By counting X-chromosomes in nuclear cycle 12, embryos engage their dosage
compensation machinery in time to avoid an imbalance in X-linked gene products
that would otherwise arise between the sexes during cycle 14 when genome-wide
transcription begins (Gergen,
1987
; Tracey et al.,
2000
). But such early chromosome counting demands that expression
of the genes that communicate X-chromosome dose to Sxl must begin
even before cycle 12. As Fig. 1
illustrates, the two strongest XSEs, sisA and sc, are among
the earliest expressed genes (Erickson and
Cline, 1993
).
The question of whether these sex-determination genes might have something
in common that allows them to be expressed so early led us to the
heptanucleotide motif, CAGGTAG. Three of the four XSEs in D.
melanogaster (all but run) possess multiple copies of this
sequence or its reverse complement within 500 bp of their transcription start
sites (Erickson and Cline,
1998
; Sefton et al.,
2000
). The cluster of three CAGGTAG sites upstream of sc
was shown to be functionally significant by the demonstration that their
elimination reduced sc XSE activity, and abolished it when combined
with a deletion of a downstream regulatory element
(Wrischnik et al., 2003
).
We have used genome-wide computational analysis and species comparisons to show that CAGGTAG clustering is not unique to sex-determination signal genes, but is also found upstream of other genes whose transcription begins prior to cycle 14. 1-bp degenerate heptamers are identified that cluster with, and can probably substitute for CAGGTAG. We call these sequences the TAGteam. Functional analysis of TAGteam clusters in transgenic reporter constructs for sc, SxlPe and the patterning gene zerknüllt (zen) revealed that TAGteam site number influences the time of onset of pre-CB transcription.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bioinformatics
We created a simple algorithm to search for CAGGTAG clusters in the D.
melanogaster genome (Adams et al.,
2000
). When the program FLY ENHANCER
(Markstein et al., 2002
)
became available, we determined that it generated the same results. Pre-CB
genes were chosen as genes transcribed prior to nuclear cycle 14, according to
previously published reports in the literature
(Fig. 1), and post-CB genes
(Table S1 in supplementary material) were randomly chosen among those known
not to be transcribed prior to gastrulation according to the BDGP expression
database (Tomancak et al.,
2002
). For pre- and post-CB genes, the total number of occurrences
of CAGGTAG and related heptamer sequences per interval was subjected to a
2 test incorporating Yate's correction. The same analysis was
applied to the orthologous genes in D. pseudoobscura
(Richards et al., 2005
).
Identification of orthologous sequences and alignments
Sequences in D. yakuba, D. ananassae, D. pseudoobscura, D.
mojavensis and D. virilis were downloaded from the
Lawrence-Berkeley National Lab Vista Browser
(Frazer et al., 2004
).
Promoter sequences for bottleneck (bnk) from D.
willistoni, D. hydei and Zaprionus tuberculatus were obtained by
PCR amplification with conserved D. pseudoobscura primers: (1)
GGTGCGCGGAAAACACGTAAAATTCGCGTG; (2) GTGTTGGTCAGCTTGTTGAAGAAGTTGATTTTGTC.
Sequences were aligned using ClustalW
(Thompson et al., 1994
), then
manually adjusted to align motifs identified with MEME
(Bailey and Gribskov,
1998
).
Site-directed mutagenesis and germline transformation
Standard techniques were used for germline transformation
(Spradling, 1986
). All
mutagenesis reactions were carried out with the Quick-Change site-directed
mutagenesis kit (Stratagene). PCR reactions were performed under standard
conditions and all products were sequence verified prior to subcloning into
P-element vectors. Mutagenic primers used are listed below, with
their altered TAGteam sites underlined and the base pairs in bold indicating
changes from the wild-type site (shown in parentheses).
For scute, a 1.65-kb XhoI-BamHI genomic fragment
in pBluescript (Stratagene) was used as a template for mutagenesis. Mutants
were subcloned into the scute genomic DNA fragment described by
Wrischnik et al. (Wrischnik et al.,
2003
). For Sxl, wild-type 1.4-kb
SxlPe-lacZ vector
(Yang et al., 2001
) was
digested with EcoRI-NotI and subcloned into pBluescript for
use as a template to make mutants, which were subsequently cloned back into
the original vector using the same digest. For zen, mutagenesis of
VRE TAGteam sites was performed in a modified pGEM72f(-) vector, pGEM-BGS, in
which the sequence from BspEI to KpnI was replaced with
BglII-600VRE-SpeI (a gift from M. Markstein). Following
mutagenesis reactions, the mut600VRE pGEM-BGS was digested with
BglII-SpeI and cloned into newE2G, a gypsy-insulated pCaSpeR
vector containing an eve minimal promoter fused to a lacZ
reporter (Markstein et al.,
2004
).
|
In situ hybridization and nuclear dots
0- to 2-hour D. melanogaster embryos were collected at 25°C on
standard molasses/agar plates smeared with live yeast paste. Embryo fixation
and hybridization was performed with digoxigenin-labeled antisense
lacZ RNA probes as described previously
(Jiang et al., 1991
;
Tautz and Pfeifle, 1989
),
except for embryos used for nuclear dot analysis, which were stained with 0.5
µg/ml DAPI, washed with PBT, and mounted in 70% glycerol/1x PBS
following alkaline phosphatase staining. Embryonic nuclear cycles were
determined by the density of nuclei and their position relative to the
periphery of the embryo.
We only counted dots in late interphase or prophase nuclei, since these stages appeared to have the greatest propensity for dot expression. For nuclear cycles 9-13, at least 80 nuclei per embryo were scored. For earlier cycles, all visible nuclei were scored. We defined the time of onset of transcription conservatively to be the first cycle with at least a 5-fold increase in the percentage of expressing nuclei over a previous cycle with at least 1% expressing nuclei.
Immunocytochemistry
Embryos grown at 25°C were stained with ß-galactosidase antibody
(5 Prime-3 Prime) and processed as described by Kuo et al.
(Kuo et al., 1996
), except
that alkaline phosphatase-conjugated goat anti-rabbit secondary antibody was
used and color was developed with 5-bromo,4-chloro,3-indolyl phosphate
(BCIP)/nitroblue tetrazolium (NBT).
| RESULTS |
|---|
|
|
|---|
If CAGGTAG functions more generally to regulate pre-CB gene expression,
perhaps in combination with other sequences, one might expect it to be
over-represented in the promoters of genes expressed prior to the cellular
blastoderm stage, even if it did not always appear in clusters. Moreover,
CAGGTAG-related sequences might also be over-represented. To explore these
possibilities, we compared the occurrence of CAGGTAG and all its 1-bp
degenerate sequences in the region flanking the transcription start sites of
genes expressed pre-CB to that for genes expressed post-CB (see Materials and
methods). CAGGTAG is indeed over-represented in the 500-bp region upstream of
pre-CB genes relative to post-CB genes (P=6.3x10-7,
Fig. 2A), even if
SxlPe and the genes from the genomic cluster search are
removed from the pre-CB set to avoid a possible ascertainment bias
(P=2.1x10-4, data not shown). The degenerate
sequence tAGGTAG, that had been suggested as a possible alternative to CAGGTAG
in an earlier comparison of Sxl promoters
(Erickson and Cline, 1998
), is
nearly as over-represented as CAGGTAG (P=1.6x10-6).
The sequence CAGGcAG (P=9.2x10-4) also emerged in
this analysis as the only other 1-bp degenerate with a P-value less
than 0.01. Hereafter, we refer collectively to these over-represented
heptamers as TAGteam sequences.
To determine whether the over-representation of TAGteam heptamers upstream of pre-CB genes is unique to D. melanogaster, we performed a similar analysis on D. pseudoobscura orthologs. Again, CAGGTAG (P=1.5x10-6) and tAGGTAG (P=2.0x10-5) were over-represented in the interval immediately upstream of pre-CB genes relative to post-CB genes, but CAGGcAG was not (Fig. 2B). CAGGTAG and/or tAGGTAG were also over-represented in regions beyond 500 bp in the two species (Fig. 2A,B), though less so than in regions closer to the promoter, suggesting that TAGteam members may be able to exert influence over distances greater than 500 bp.
This relative over-representation of TAGteam sequences in the interval directly upstream of the transcription start site was a consequence of pre-CB genes containing more sites than expected by chance, although the values for CAGGTAG in pseudoobscura and for tAGGTAG in both species were also increased by a depression in the number of sites upstream of post-CB genes (Fig. 2C,D). In contrast, although CAGGcAG in D. pseudoobscura was six times more prevalent than expected upstream of pre-CB genes, a strong positive bias among post-CB genes as well dropped this heptamer below the over-representation cutoff. An extension of the analysis of pre-CB genes shown in Fig. 2C to four more Drosophila species, two of which are more distant than pseudoobscura, showed that CAGGTAG was reliably the most over-represented of the three TAGteam members, and that the other two were consistently among the top three runners up among all 1-bp degenerates (Table S2 in supplementary material).
While this manuscript was under review, a genome-wide microarray-based
developmental profile of relative poly(A)+ mRNA levels in D.
melanogaster prior to gastrulation was published
(Pilot et al.,
2006
) which gave us an opportunity to expand the data set
for pre-CB genes in the analysis of TAGteam sequence occurrence. Our analysis
of this much larger and differently biased new data set (Fig. S1 in
supplementary material) showed remarkable agreement with our conclusions from
Fig. 2A. Again the three
TAGteam heptamers described above stood out, with CAGGTAG leading the pack,
but they were now joined by two additional 1-bp degenerate sequences, CAGGTAa
and CAGGTAt that rose far above the P=0.01 significance threshold.
CAGGTAa had been just below that threshold in our original analysis, and was
consistently among the top five most over-represented 1-bp degenerates in the
six-species comparison of pre-CB genes (Table S2 in supplementary
material).
Conservation of individual TAGteam sites is variable among early gene promoters
To explore the pattern of conservation of TAGteam sites in a pre-CB gene
unrelated to sex determination, we performed an alignment of bnk
sequence from nine species within the family Drosophilidae for the
region in melanogaster that contains the triple CAGGTAG cluster and,
just upstream of that, a tAGGTAG sequence
(Fig. 3A,B). Support for the
functionality of the latter sequence was strengthened by the observation that
each of the melanogaster CAGGTAG sites was replaced by tAGGTAG in at
least one species. Moreover, the upstream tAGGTAG sequence was conserved among
the three closest relatives of melanogaster.
|
To determine if the findings for bnk were representative, we used the genome sequence available for six Drosophila species to align the 500-bp regions upstream of the promoters of five additional pre-CB genes (Fig. 3C). Three of these genes are related to sex determination (sisA, sc, SxlPe), but the other two [snail (sna) and zen] are not. For sna and zen, known enhancer elements further upstream of these genes were also examined, since they contained TAGteam clusters in melanogaster. As with bnk, these regions exhibited a variable degree of conservation. There was no obvious difference in conservation between genes involved in sex determination and those that are not. The fact that TAGteam sites in the upstream enhancer elements of zen and sna seemed as conserved as those closer to the promoter argues for the functional significance of TAGteam site over-representation (Fig. 2A,B) regardless of its distance from the promoter.
There were several instances in the five-gene/six-species comparison in
which de novo TAGteam sites appeared to replace lost sites, suggesting that
stabilizing selection may influence TAGteam evolution (see
Ludwig et al., 2000
;
Ludwig et al., 1998
). In view
of our recent analysis of the Pilot et al.
(Pilot et al., 2006
) data
pointing to CAGGTAa as a member of the TAGteam, it seems significant that in
the species comparisons shown in Fig.
3, this sequence replaced one of the conserved original three
TAGteam heptamers even more frequently than any one of them replaced the two
others (data not shown).
The least over-represented TAGteam member does contribute to pre-CB gene function
The functional significance of CAGGTAG clusters had previously been
established using an assay for the XSE function of scute
(sc) (Wrischnik et al.,
2003
). Since sc has a CAGGcAG site 53 bp upstream of its
transcription start site (Fig.
4A), we could utilize the same assay to determine whether this
least-over-represented member of the original TAGteam also contributes to
pre-CB gene functioning.
|
Mutating the single CAGGcAG site by itself had no effect on the ability of this transgene to rescue mutant females (101% viability, relative to that of the heterozygotes); however, rescue was reduced to only 3% in combination with the triple CAGGTAG knockout, a value far below the 35% average rescue for the triple knockout alone (Fig. 4B). We could be confident of the biological significance of this synergism, even in the face of considerable variation in rescue among insertion lines, since values for individual transgene lines were reproducible, and since the range of rescue values for the various quadruple knockout lines (1-5%) did not overlap that for the triple knockouts (7-76%).
|
As expected, the wild-type transgene gave a 1:1 ratio of stained to
unstained embryos, indicating females and males, respectively, with nearly all
females staining darkly (Fig.
5B,F). By contrast, almost no embryos carrying the triple TAGteam
mutant showed dark or intermediate staining, and only an estimated 8% of
females reached even the lightest staining category
(Fig. 5C,G). Two additional
transgenes established that the contribution of TAGteam sites to
SxlPe regulation is cumulative. Loss of just the two
promoter-proximal sites, CAGGTAG and tAGGTAG (mutYAGGTAG), impaired expression
(Fig. 5D,H), but not as
severely as loss of all three. Again only a few embryos had dark or
intermediate staining, but an estimated 50% of females were lightly stained.
Even mutation of the CAGGcAG doublet by itself reduced staining
(Fig. 5E,I), though not by as
much as the loss of the two other TAGteam sites together. Inferences regarding
the contribution of the CAGGcAG site are complicated by the fact that this
double site partially overlaps an E-box sequence previously implicated in
SxlPe regulation (Yang
et al., 2001
). Although the E-box hexamer itself was purposely
left intact in the CAGGcAG mutants, the possibility remains that transcription
factor binding to this E-box site could be marginally affected by sequences
outside the canonical hexamer motif.
We used in situ hybridization to RNA from the SxlPe-lacZ transgene in 0- to 2-hour embryos both to establish that the effects of TAGteam mutations on ß-galactosidase levels reflected effects on transcript levels by the cellular blastoderm stage, and to determine whether TAGteam mutations delayed the onset of Sxl transcription. Fig. 6 shows that, as expected, the level of cytoplasmic mRNA from the TAGteam mutant Sxl reporter was far below that from the wild-type transgene at cycle 14 (compare Fig. 6A and C).
|
Dots from endogenous Sxl transcripts were reported to first appear
at cycle 12, with the proportion of dot-containing nuclei quickly reaching
100% by the end of that cycle (Barbash and
Cline, 1995
; Erickson and
Cline, 1993
). We were surprised to find that the unmutated 1.4-kb
SxlPe-lacZ reporter transgene was not as faithful a mimic
of the endogenous gene as we had expected; nevertheless, it did reveal an
unambiguous effect of the triple TAGteam knockout on both the timing and
extent of transcription driven by SxlPe. The unmutated
reporter initiated transcription during nuclear cycle 9, rather than cycle 12,
with the proportion of active nuclei only gradually increasing during
subsequent cycles to a maximum of just over 80%
(Fig. 6B,E). Pritchard and
Schubiger (Pritchard and Schubiger,
1996
) had observed a similar gradual increase in nuclear dots for
many pre-CB genes, a behavior that had set these genes apart from endogenous
Sxl. Moreover, we observed a small but reproducible amount of
transcription in the nuclei of males, as deduced from the fact that after
cycle 9, all embryos had at least a few nuclei with dots (data not shown).
Nuclear dots of hybridization from the endogenous SxlPe
had been observed previously in pre-CB male embryos, albeit not in all males
examined (D. A. Barbash, PhD Thesis, University of California, 1995). In our
study, the average percent of dot-containing nuclei in males always remained
low, consistent with the fact that expression of the reporter appeared
female-specific when assayed by ß-galactosidase levels
(Fig. 5F) or even by
cytoplasmic mRNA accumulation (data not shown). In order to determine the
onset of transcription of the 1.4-kb SxlPe-lacZ reporter
specifically in females, we included only the top 50% of expressing embryos
per cycle in our analysis.
|
TAGteam sites in the zen ventral repression element influence the time of onset of pre-CB transcription
The search for large TAGteam clusters led to zen, a gene expressed
as early as the earliest XSEs (Pritchard
and Schubiger, 1996
), but one not involved in sex determination.
The gene has six upstream TAGteam sites, four of which form an exceptionally
compact cluster (91 bp) relatively far (1.4 kb) from the promoter
(Fig. 7A) in a 600-bp region
called the zen ventral repression element (VRE). The zen VRE
had been shown to harbor pre-CB transcription activation sequences of unknown
identity based on its ability to activate the even-skipped
(eve) basal promoter in lacZ reporter constructs
(Jiang et al., 1993
;
Kirov et al., 1993
), a basal
promoter that responds faithfully to pre-CB regulatory information
(Markstein et al., 2002
;
Small et al., 1992
). We
assessed the potential role of the TAGteam in VRE functioning using the same
reporter-gene strategy.
The intact 600-bp VRE begins to drive cytoplasmic mRNA accumulation in the
soma prior to cellularization, with the level peaking early in cycle 14
(Fig. 7B). Accumulation is
limited to the dorsal half of the embryo as a result of the action of Dorsal
protein that represses zen in the ventral half of the embryo by
binding to the VRE (reviewed by
Stathopoulos and Levine,
2002
). A 250-bp fragment of the VRE containing the four TAGteam
sites had been shown to contain sequences necessary for transcriptional
activation (Jiang et al.,
1993
). We found that this 250-bp fragment is not only necessary
for activation, it is sufficient: it drove expression as effectively as the
full-length 600-bp fragment (Fig.
7D). Expression was nearly uniform, since the 250-bp fragment
lacked all but one Dorsal binding site.
We truncated the VRE even further to just a 111-bp fragment containing only the four TAGteam sites and 10 bp on each side. An alignment of this region from the species examined in Fig. 3C showed that the four TAGteam sites account for two-thirds of the nucleotides conserved in all six species. In contrast, the remaining 83 nucleotides of this fragment contained only eleven invariant base pairs, of which the longest contiguous run was only three base pairs that were adjacent to a TAGteam site. Even this minimal fragment drove ubiquitous expression in the early embryo, albeit at a reduced level, particularly at the posterior pole (Fig. 7E). Duplicating this minimal TAGteam cluster fragment increased transcript accumulation to levels comparable to those of the 250-bp VRE fragment (Fig. 7G). In contrast, mutating the four VRE TAGteam sites, whether in the original 600-bp fragment or in the minimal 111-bp fragment, reduced the accumulation of transcript at cycle 14 to low levels (Fig. 7C,F). The effects of the TAGteam mutations appear to be specific to pre-CB expression, since we saw no differences between the TAGteam mutant and wild-type 600-bp VRE fragment through stage (not cycle) 14 with respect to the highly patterned and dynamic post-CB embryonic expression pattern (data not shown).
|
Whereas decreasing the number of TAGteam sites retarded initiation of
pre-CB transcription, increasing their number appeared to advance it. The
onset of transcription from the (2X)111VRE construct was in nuclear cycle 7
(Fig. 7H,I), two cycles earlier
than that of the 111VRE construct and one cycle ahead of the earliest point
that transcription of endogenous genes has been shown to begin
(Erickson and Cline, 1993
;
Pritchard and Schubiger,
1996
). This advance is unlikely to be an artifact of increased
staining levels, since cytoplasmic mRNA staining for the 250-bp fragment was
comparable to that for the (2X)111VRE construct in early cycle 14 (compare
Fig. 7D with G), yet the 250-bp
construct initiated expression one cycle later. The lack of concordance
between onset of transcription and cycle 14 staining level was even greater
between the (2X)111VRE construct and the wild-type 1.4-kb
SxlPe construct, which stained much more darkly by cycle
14, despite having begun transcription two cycles later (compare
Fig. 6A with
Fig. 7G).
hermaphrodite does not encode the TAGteam binding factor
The hermaphrodite (her) gene seemed an attractive
candidate as a source of the TAGteam binding factor, since its maternally
encoded product is a zinc-finger transcription factor that had been reported
to positively regulate not only SxlPe but also
non-sex-specific targets of unknown identity in the young embryo
(Li and Baker, 1998
;
Pultz and Baker, 1995
;
Pultz et al., 1994
).
Consequently we determined whether the maternal effect of mutations in
her would interfere with expression of the (2X)111VRE zen
transgene. It did not, as the level of lacZ mRNA immunostaining from
this transgene was the same for the progeny of her l(2)mat
homozygous mutant mothers as for the progeny of their heterozygous sisters
(data not shown).
Interpretation of this negative result is complicated by the fact that we did not observe the female-biased lethal maternal effect reported for her l(2)mat that had made the gene such an attractive candidate. For both her l(2)mat and the her l(2)mat/her1 heteroallelic combination, we did observe maternal-effect embryonic lethality, but both sexes of progeny were affected equally. Moreover, even when we tried to sensitize daughters to the maternal effect of her l(2)mat/her1 by reducing the dose of Sxl+ to one copy, we saw no sex bias in lethality. Since we verified that the her alleles carried the appropriate molecular lesions, we can only surmise that the effect of her on Sxl is far weaker than originally indicated, and that some undefined and unsuspected aspect of genetic background or culture conditions sensitized Sxl to her in the previous studies. Hence the identity of the protein that recognizes TAGteam sites to drive pre-CB gene expression remains to be determined.
| DISCUSSION |
|---|
|
|
|---|
In contrast, we show here that eliminating TAGteam sites has the opposite
effect on the onset of pre-CB gene expression, retarding transcription driven
either by a 111-bp minimal regulatory fragment of the pattern-formation gene
zerknüllt (zen) or by the promoter of
Sex-lethal (Sxl), the gene that counts fly X chromosomes to
determine sex. Hence TAGteam sites must recruit activators, rather than
repressors. Our observation that duplication of the minimal TAGteam VRE
fragment advances the onset of transcription suggests that precisely when
pre-CB genes are first expressed is determined by a balance between specific
activator and repressor proteins. Reciprocal changes in the number of binding
sites for an activator protein involved in C. elegans pharynx
development had been shown to have reciprocal effects on the onset of
expression of the mutated target gene
(Gaudet and Mango, 2002
);
however, the gene studied in that case was expressed only after widespread
zygotic transcription had already begun.
Analysis of the mechanism by which the TAGteam sites act to influence
pre-CB transcription may provide unique insights into transcriptional
regulation, since the nuclear environment during this early period appears to
differ significantly from that later when general transcription begins. For
example, during this early period in Drosophila, the high mobility
group protein D (HMG-D) stands in for histone H1
(Ner et al., 2001
;
Ner and Travers, 1994
).
Moreover, it has been shown that Xenopus embryos have a uniquely
large excess of core histones prior to the midblastula transition (MBT) that
may play an important part in pre-MBT transcriptional quiescence
(Prioleau et al., 1994
). It is
not known whether Drosophila embryos have a comparable shift in the
level of core histones relative to DNA that correlates with the onset of
widespread transcription, but measurements of histone mRNA levels are
consistent with the possibility of a large shift
(Anderson and Lengyel, 1980
).
The availability of TATA-binding factor also seems to be a factor limiting
transcription in Xenopus only prior to the MBT
(Veenstra et al., 1999
), but
it is not known whether a similar change occurs in Drosophila.
Although the TAGteam is highly over-represented upstream of the genes that
serve as the sex-determination signal in D. melanogaster, our
discovery that TAGteam sites can also be unusually abundant upstream of early
expressed genes like zen and bnk that have nothing to do
with sex determination shows that their function is not restricted to
sex-determination genes. On the other hand, the TAGteam cannot be the only
sequences that mark genes for pre-CB expression, since the mutant 111-bp
zen VRE transgene with no TAGteam sequences was still able to
initiate pre-CB transcription from the even-skipped promoter, albeit
with a delay relative to the nonmutant transgene, and with a reduction in the
fraction of nuclei that ultimately express. Moreover, pre-CB genes exist (e.g.
nullo) that have no TAGteam heptamer within 2 kb of their
transcription start site. As more information becomes available on various
Drosophila species with respect not only to DNA sequence, but also to
start times of transcription for specific genes, a clearer picture should
emerge on the interchangeability of motifs that direct pre-CB gene expression.
Already, our analysis of very new data that increased the list of recognized
melanogaster pre-CB genes (Pilot
et al., 2006
) led us to two 1-bp degenerates of CAGGTAG that may
earn the certified TAGteam label once their functional contribution to pre-CB
gene expression is tested by mutation.
Thus the TAGteam seems to provide an opportunity to analyze how enhancer
sequences change over evolutionary time under circumstances where the organism
may have a variety of alternatives available to achieve the same functional
goal. But if those alternatives are truly equivalent, it is puzzling why the
X-chromosome signal elements (XSEs) in D. melanogaster seem to rely
so heavily on the TAGteam. Even run, the only exception to the rule
that XSEs in D. melanogaster have three CAGGTAG sites within 500 bp
of their transcription start sites, has six TAGteam sites within 3.1 kb
upstream. Previously published analysis of the regions we now know contain
TAGteam sites showed that they direct the very early, broad expression of
run that affects SxlPe
(Klingler et al., 1996
).
Because the duplicated 111-bp TAGteam fragment from zen drove expression earlier than any endogenous gene is known to be transcribed, it seems likely that any TAGteam binding protein that activates pre-CB transcription will be derived from maternal rather than zygotic gene expression. With our elimination of the genetically characterized hermaphrodite (her) gene as a potential source of this activity (and indeed perhaps even as a regulator of SxlPe), a straightforward biochemical approach may be the most practical route for identifying the relevant protein. Information on the identity of this protein should further understanding of the molecular mechanisms that govern pre-CB transcription and reveal whether those mechanisms differ qualitatively from those governing the subsequent widespread activation of zygotic gene expression.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/10/1967/DC1
| REFERENCES |
|---|
|
|
|---|
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A.,
Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A.,
Galle, R. F. et al. (2000). The genome sequence of Drosophila
melanogaster. Science
287,2185
-2195.
Andeol, Y. (1994). Early transcription in different animal species: implication for transition from maternal to zygotic control in development. Rouxs Arch. Dev. Biol. 204, 3-10.[CrossRef]
Anderson, K. V. and Lengyel, J. A. (1979). Rates of synthesis of major classes of RNA in Drosophila embryos. Dev. Biol. 70,217 -231.[CrossRef][Medline]
Anderson, K. V. and Lengyel, J. A. (1980). Changing rates of histone mRNA synthesis and turnover in Drosophila embryos. Cell 21,717 -727.[CrossRef][Medline]
Bailey, T. L. and Gribskov, M. (1998). Methods and statistics for combining motif match scores. J. Comput. Biol. 5,211 -221.[Medline]
Barbash, D. A. and Cline, T. W. (1995). Genetic and molecular analysis of the autosomal component of the primary sex determination signal of Drosophila melanogaster. Genetics 141,1451 -1471.[Abstract]
Bronner, G., Chu-LaGraff, Q., Doe, C. Q., Cohen, B., Weigel, D., Taubert, H. and Jackle, H. (1994). Sp1/egr-like zinc-finger protein required for endoderm specification and germ-layer formation in Drosophila. Nature 369,664 -668.[CrossRef][Medline]
Brown, J. L., Sonoda, S., Ueda, H., Scott, M. P. and Wu, C. (1991). Repression of the Drosophila fushi tarazu (ftz) segmentation gene. EMBO J. 10,665 -674.[Medline]
Cline, T. W. and Meyer, B. J. (1996). Vive la difference: males vs females in flies vs worms. Annu. Rev. Genet. 30,637 -702.[CrossRef][Medline]
Coulter, D. E., Swaykus, E. A., Beran-Koehn, M. A., Goldberg, D., Wieschaus, E. and Schedl, P. (1990). Molecular analysis of odd-skipped, a zinc finger encoding segmentation gene with a novel pair-rule expression pattern. EMBO J. 9,3795 -3804.[Medline]
Davidson, E. H. (1986). Gene Activity in Early Development. Orlando: Academic Press.
Eldon, E. D. and Pirrotta, V. (1991). Interactions of the Drosophila gap gene giant with maternal and zygotic pattern-forming genes. Development 111,367 -378.[Abstract]
Erickson, J. W. and Cline, T. W. (1993). A bZIP
protein, sisterless-a, collaborates with bHLH transcription factors early in
Drosophila development to determine sex. Genes Dev.
7,1688
-1702.
Erickson, J. W. and Cline, T. W. (1998). Key aspects of the primary sex determination mechanism are conserved across the genus Drosophila. Development 125,3259 -3268.[Abstract]
Estes, P. A., Keyes, L. N. and Schedl, P. (1995). Multiple response elements in the Sex-lethal early promoter ensure its female-specific expression pattern. Mol. Cell. Biol. 15,904 -917.[Abstract]
Foe, V. E. and Alberts, B. M. (1983). Studies of nuclear and cytoplasmic behaviour during the five mitotic cycles that precede gastrulation in Drosophila embryogenesis. J. Cell Sci. 61,31 -70.[Abstract]
Frazer, K. A., Pachter, L., Poliakov, A., Rubin, E. M. and
Dubchak, I. (2004). VISTA: computational tools for
comparative genomics. Nucleic Acids Res.
32,W273
-W279.
Gaudet, J. and Mango, S. E. (2002). Regulation
of organogenesis by the Caenorhabditis elegans FoxA protein PHA-4.
Science 295,821
-825.
Gergen, J. P. (1987). Dosage compensation in
Drosophila: evidence that daughterless and Sex-lethal control X-chromosome
activity at the blastoderm stage of embryogenesis.
Genetics 117,477
-485.
Harrison, D. A., McCoon, P. E., Binari, R., Gilman, M. and
Perrimon, N. (1998). Drosophila unpaired encodes a secreted
protein that activates the JAK signaling pathway. Genes
Dev. 12,3252
-3263.
Ibnsouda, S., Schweisguth, F., de Billy, G. and Vincent, A. (1993). Relationship between expression of serendipity alpha and cellularisation of the Drosophila embryo as revealed by interspecific transformation. Development 119,471 -483.[Abstract]
Ingham, P. W., Howar, K. R. and Ish-Horowicz, D. (1985). Transcription pattern of the Drosophila segmentation gene hairy. Nature 318,439 -445.[CrossRef]
Jazwinska, A., Rushlow, C. and Roth, S. (1999). The role of brinker in mediating the graded response to Dpp in early Drosophila embryos. Development 126,3323 -3334.[Abstract]
Jiang, J., Kosman, D., Ip, Y. T. and Levine, M.
(1991). The dorsal morphogen gradient regulates the mesoderm
determinant twist in early Drosophila embryos. Genes
Dev. 5,1881
-1891.
Jiang, J., Cai, H., Zhou, Q. and Levine, M. (1993). Conversion of a dorsal-dependent silencer into an enhancer: evidence for dorsal corepressors. EMBO J. 12,3201 -3209.[Medline]
Kimelman, D., Kirschner, M. and Scherson, T. (1987). The events of the midblastula transition in Xenopus are regulated by changes in the cell cycle. Cell 48,399 -407.[CrossRef][Medline]
Kirov, N., Zhelnin, L., Shah, J. and Rushlow, C. (1993). Conversion of a silencer into an enhancer: evidence for a co-repressor in dorsal-mediated repression in Drosophila. EMBO J. 12,3193 -3199.[Medline]
Klingler, M. and Gergen, J. P. (1993). Regulation of runt transcription by Drosophila segmentation genes. Mech. Dev. 43,3 -19.[CrossRef][Medline]
Klingler, M., Soong, J., Butler, B. and Gergen, J. P. (1996). Disperse versus compact elements for the regulation of runt stripes in Drosophila. Dev. Biol. 177, 73-84.[CrossRef][Medline]
Kraut, R. and Levine, M. (1991). Spatial regulation of the gap gene giant during Drosophila development. Development 111,601 -609.[Abstract]
Kuo, Y. M., Jones, N., Zhou, B., Panzer, S., Larson, V. and Beckendorf, S. K. (1996). Salivary duct determination in Drosophila: roles of the EGF receptor signalling pathway and the transcription factors fork head and trachealess. Development 122,1909 -1917.[Abstract]
Kwiatowski, J., Skarecky, D., Bailey, K. and Ayala, F. J. (1994). Phylogeny of Drosophila and related genera inferred from the nucleotide sequence of the Cu,Zn Sod gene. J. Mol. Evol. 38,443 -454.[CrossRef][Medline]
Lamb, M. M. and Laird, C. D. (1976). Increase in nuclear poly(A)-containing RNA at syncytial blastoderm in Drosophila melanogaster embryos. Dev. Biol. 52, 31-42.[CrossRef][Medline]
Lecuit, T. and Wieschaus, E. (2000). Polarized
insertion of new membrane from a cytoplasmic reservoir during cleavage of the
Drosophila embryo. J. Cell Biol.
150,849
-860.
Li, H. and Baker, B. S. (1998). Her, a gene required for sexual differentiation in Drosophila, encodes a zinc finger protein with characteristics of ZFY-like proteins and is expressed independently of the sex determination hierarchy. Development 125,225 -235.[Abstract]
Ludwig, M. Z., Patel, N. H. and Kreitman, M. (1998). Functional analysis of eve stripe 2 enhancer evolution in Drosophila: rules governing conservation and change. Development 125,949 -958.[Abstract]
Ludwig, M. Z., Bergman, C., Patel, N. H. and Kreitman, M. (2000). Evidence for stabilizing selection in a eukaryotic enhancer element. Nature 403,564 -567.[CrossRef][Medline]
Markstein, M., Markstein, P., Markstein, V. and Levine, M.
S. (2002). Genome-wide analysis of clustered Dorsal binding
sites identifies putative target genes in the Drosophila embryo.
Proc. Natl. Acad. Sci. USA
99,763
-768.
Markstein, M., Zinzen, R., Markstein, P., Yee, K. P., Erives,
A., Stathopoulos, A. and Levine, M. (2004). A regulatory code
for neurogenic gene expression in the Drosophila embryo.
Development 131,2387
-2394.
McKnight, S. L. and Miller, O. L., Jr (1976). Ultrastructural patterns of RNA synthesis during early embryogenesis of Drosophila melanogaster. Cell 8, 305-319.[CrossRef][Medline]
Nakakura, N., Miura, T., Yamana, K., Ito, A. and Shiokawa, K. (1987). Synthesis of heterogeneous mRNA-like RNA and low-molecular-weight RNA before the midblastula transition in embryos of Xenopus laevis. Dev. Biol. 123,421 -429.[CrossRef][Medline]
Ner, S. S. and Travers, A. A. (1994). HMG-D, the Drosophila melanogaster homologue of HMG 1 protein, is associated with early embryonic chromatin in the absence of histone H1. EMBO J. 13,1817 -1822.[Medline]
Ner, S. S., Blank, T., Perez-Paralle, M. L., Grigliatti, T. A.,
Becker, P. B. and Travers, A. A. (2001). HMG-D and histone H1
interplay during chromatin assembly and early embryogenesis. J.
Biol. Chem. 276,37569
-37576.
Newport, J. and Kirschner, M. (1982a). A major developmental transition in early Xenopus embryos: I. characterization and timing of cellular changes at the midblastula stage. Cell 30,675 -686.[CrossRef][Medline]
Newport, J. and Kirschner, M. (1982b). A major developmental transition in early Xenopus embryos: II. Control of the onset of transcription. Cell 30,687 -696.[CrossRef][Medline]
O'Farrell, P. H., Edgar, B. A., Lakich, D. and Lehner, C. F.
(1989). Directing cell division during development.
Science 246,635
-640.
Pilot, F., Philippe, J. M., Lemmers, C., Chauvin, J. P. and
Lecuit, T. (2006). Developmental control of nuclear
morphogenesis and anchoring by charleston, identified in a functional genomic
screen of Drosophila cellularisation.
Development 133,711
-723.
Powell, J. R. and DeSalle, R. (1995). Drosophila molecular phylogenies and their uses. In Evolutionary Biology. Vol. 28 (ed. M. K. Hecht, R. J. MacIntyre and M. T. Clegg), pp. 87-138. New York: Plenum Press.
Prioleau, M. N., Huet, J., Sentenac, A. and Mechali, M. (1994). Competition between chromatin and transcription complex assembly regulates gene expression during early development. Cell 77,439 -449.[CrossRef][Medline]
Pritchard, D. K. and Schubiger, G. (1996).
Activation of transcription in Drosophila embryos is a gradual process
mediated by the nucleocytoplasmic ratio. Genes Dev.
10,1131
-1142.
Pultz, M. A. and Baker, B. S. (1995). The dual role of hermaphrodite in the Drosophila sex determination regulatory hierarchy. Development 121,99 -111.[Abstract]
Pultz, M. A., Carson, G. S. and Baker, B. S. (1994). A genetic analysis of hermaphrodite, a pleiotropic sex determination gene in Drosophila melanogaster. Genetics 136,195 -207.[Abstract]
Richards, S., Liu, Y., Bettencourt, B. R., Hradecky, P.,
Letovsky, S., Nielsen, R., Thornton, K., Hubisz, M. J., Chen, R., Meisel, R.
P. et al. (2005). Comparative genome sequencing of Drosophila
pseudoobscura: chromosomal, gene, and cis-element evolution. Genome
Res. 15,1
-18.
Russo, C. A., Takezaki, N. and Nei, M. (1995). Molecular phylogeny and divergence times of drosophilid species. Mol. Biol. Evol. 12,391 -404.[Abstract]
Schejter, E. D. and Wieschaus, E. (1993). bottleneck acts as a re