|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 May 2006
doi: 10.1242/dev.02392
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ENS, Biologie cellulaire de la synapse, Paris, F-75005 France; Inserm, U789, Paris, F-75005, France.
* Author for correspondence (e-mail: jlbesse{at}biologie.ens.fr)
Accepted 28 March 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Developmental timing, Nicotinic acetylcholine receptor, DAF-12
| INTRODUCTION |
|---|
|
|
|---|
In the nematode Caenorhabditis elegans, analysis of mutants
displaying abnormal postembryonic development has revealed molecular
mechanisms of developmental timing control. C. elegans goes from
hatching to reproductive adulthood through four larval stages (L1 to L4), all
terminated by a molt. Each larval stage is associated with a developmental
program characterized by specific patterns of cell division, differentiation
and migration. Mutants have been isolated that bypass or repeat some of these
stage-specific developmental programs. Genes whose mutation causes such
temporal transformations are called heterochronic genes (reviewed by
Ambros, 2000
;
Pasquinelli and Ruvkun, 2002
;
Rougvie, 2001
;
Thummel, 2001
). They define an
intrinsic developmental timer that specifies the identity of each larval
stage. However, in addition to genetic constraints, C. elegans
development is modulated by the environment. The best characterized example is
the choice between reproductive development and a facultative L3 diapause
(reviewed by Riddle and Albert,
1997
). Under favorable conditions, eggs develop into reproductive
adults within 3 days. If L1 larvae are exposed to adverse conditions,
including limited food, high temperature and high population density, animals
can enter a facultative L3 diapause stage called the dauer larva
(Cassada and Russell, 1975
).
Dauer larvae survive for several months without feeding and are able to resume
development to fertile adults when conditions are favorable again. A complex
genetic network involving a TGFß, an insulin-like and a nuclear hormone
receptor (NHR) pathway controls dauer entry (reviewed by
Riddle and Albert, 1997
).
These three pathways integrate environmental cues perceived by several classes
of sensory neurons, thus defining converging neuroendocrine pathways
(Bargmann and Horvitz, 1991
;
Li et al., 2003
;
Ren et al., 1996
).
In addition to dauer-inducing conditions, C. elegans developmental
rate can also vary according to food quantity and quality
(Houthoofd et al., 2002
) or
population density (Golden and Riddle,
1984a
). The cellular and molecular bases of these controls are
poorly characterized. To investigate a potential role of the nervous system in
the temporal regulation of development, we pharmacologically manipulated
acetylcholine (ACh)-mediated transmission at early stages of C.
elegans development. ACh is the prominent excitatory neurotransmitter in
this species: of the 302 neurons that compose the nervous system of an adult
hermaphrodite, one-third are cholinergic (Rand, 1997). The two classes of
receptors mediating ACh-mediated transmission in the mammalian nervous system
muscarinic G-protein-coupled receptors and nicotinic ligand-gated ion
channels are expressed in C. elegans
(Bargmann, 1998
). Genome
sequence analysis detected up to 42 genes potentially encoding nicotinic
acetylcholine receptor (nAChR) subunits
(Bargmann, 1998
). Some of these
subunits have been involved in defined functions such as feeding
(McKay et al., 2004
), egg
laying (Kim et al., 2001
),
locomotion (Fleming et al.,
1997
; Lewis et al.,
1980a
; Lewis et al.,
1980b
) and copulation (Garcia
et al., 2001
). However, the function of most C. elegans
nAChRs is unknown.
We manipulated nicotinic neurotransmission by exposing animals to the nicotinic agonist 1,1-dimethyl-4-phenylpiperazinium (DMPP). We observed that chronic exposure to DMPP slowed development at the second larval stage without affecting the molt timing, thus causing a lethal heterochronic phenotype at the L2/L3 molt. Genetic analysis of the sensitivity to DMPP identified nAChRs and the nuclear hormone receptor DAF-12 as components of a novel neuroendocrine pathway that controls developmental timing in C. elegans.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mutants scored DMPP sensitive were: acr-5(ok180, ok182, ok205) III, acr-7(tm863) II, acr-8(ok1240) X, acr-9(ok933) X, acr-11(ok1345) I, acr-12(ok367) X, acr-14(ok1155) II, acr-15(ok1214) V, acr-16(ok789) V, acr-18(ok1285) V, acr-19(ad1674) I, acr-21(ok1314) III, acr-22(tm627) X, des-2(u695) deg-3(u662) V, eat-2(ad453) II and lev-1(kr6) IV.
RNAi clones used in DMPP sensitivity tests were: C02C2.3, R13A5.4, F48E3.7 (acr-22), C04C3.2, F17E9.7, F17E9.8, T05B4.1, T01H10.7, T01H10.2, T01H10.1, T01H10.5, F11C7.1, F28F8.1 (acr-18), F53E10.2 (acr-17), K03F8.2 (acr-5), K03B8.9 (deg-3), T26H10.1 (des-2), R06A4.10 (acr-20), C31H5.3 (acr-19), F25G6.4 (acr-15), T09A5.3 (acr-7), Y48B6A.4, F25G6.3 (acr-16), D2092.3 (acr-11), C40C9.2 (acr-9), R01E6.4 (acr-12), C35C5.5 (acr-13), F21F3.5 (unc-38), T08G11.5 (unc-29) and F09E8.7 (lev-1).
Nicotinic agonist resistance assays and dauer pheromone
1,1-Dimethyl-4-phenylpiperazinium (DMPP) (Sigma) was dissolved in water and
added to 55°C-equilibrated NG agar just before plates were poured. Gravid
adult worms were allowed to lay eggs for several hours on standard plates.
Eggs were then carefully transferred on DMPP-containing plates and counted.
Surviving L4, adult and dauer larvae were scored after 2.5 (25°C), 3
(20°C) or 5 (15°C) days of development. Dauer pheromone was purified
as described (Golden and Riddle,
1984b
) and added to peptone-free DMPP plates when mentioned.
Levamisole (Sigma) was dissolved in water and added to standard NG agar. Levamisole resistance was scored as the fraction of adult worms moving after 2 hours on 1 mM levamisole.
DMPP resistance screen and daf-12 allele identification
N2 worms were mutagenized by germline mobilization of the
Drosophila transposon Mos1
(Williams et al., 2005
).
Young-adult F1 worms were transferred on 0.75 mM DMPP plates and allowed to
lay eggs for 1 day. Three days later, plates were screened for healthy living
adult animals. In EN16 [daf-12(kr16::Mos1)] and in EN32
[daf-12(kr32::Mos1)], Mos1 insertions were localized,
respectively, at positions 10,665,405 and 10,664,945 of chromosome X by
inverse PCR (WormBase website:
http://www.wormbase.org,
release WS140, date 06/2005).
Plasmid constructions
pAF54 Pmyo-3::unc-63
unc-63 full-length cDNA was amplified by PCR from a pMT3-UNC-63
plasmid given by E. Culetto using Phusion Taq (FINNZYME) (primers
GGGCCATGGTACCAGAAAAAATGGGACCAAATGACC and GGGGGGCTCGAGCTAAGCAAGAGCCGGCGTGTT)
and sequenced. It was then digested by KpnI and NaeI, and
cloned into the pPD115.62 plasmid using KpnI and EcoRI
sites.
pAF66 Punc-63::unc-63-SL2-GFP
Two PCR fragments were independently amplified with Phusion polymerase on
wild-type (N2) genomic DNA using primers
ACGTTAGTGCACATTCTGAAAATTTTATTTTTTAAGTTG and GTAGGGTAACTGTAGTTCAGG (fragment
1), and ACGTTAGTGACATATCGATCCCCAACAACAC and AATGTCGATGCAATAATCACAACGGTTCC
(fragment 2). Fragment 1 was digested by XhoI and ApaLI, and
fragment 2 by ApaLI. The digested fragments were then ligated together into
pBS KSII+ digested by XhoI and EcoRV to generate pVR10. The
5' part of the unc-63 genomic region was PCR amplified with
Phusion polymerase (primers GCGGTACCTAGGTTAGAGCCCCAACAGG and
AAAACTCACCGCTTGGAATG) and cloned into pVR10 using KpnI and
XhoI to generate pAF67. We PCR amplified an SL2-GFP fragment from
pEXPR gcy-32-egl-2(gf) (kind gift from M. de Bono) with
GCGGATCCATCGATGCTGTCTCATCCTACTTTCA and ATCGATGTACGGCCGACTAGTAGGAA, both
containing a ClaI site, and cloned it into pVR10 using ClaI
(pAF65). We then generated pAF66 by subcloning a NaeI BlpI
fragment from pAF67 into pAF65.
pAF68 Punc-63::unc-63
The 3' end of unc-63 cDNA together with unc-54
3' UTR was subcloned from pAF54 to pVR10 using ClaI and
SpeI. We then subcloned the unc-63 5' region from
pAF67 into this plasmid using KpnI and XhoI.
Germline transformation
Transformation was performed by microinjection of plasmid DNA into the
gonad (Mello et al., 1991
).
unc-63(kr13) worms were injected with a DNA mixture containing pAF54
(Pmyo-3::unc-63) (10 ng/µl), 1 kb+ DNA ladder (INVITROGEN) (85
ng/µl) and pPD115.62 (Pmyo-3::GFP) (5 ng/µl) as a
co-transformation marker or pAF68 (Punc-63::unc-63) (20 ng/µl),
pHU4 (Prab-3::GFP) (20 ng/µl), pPD115.62 (5 ng/µl) and 1kb+ (55
ng/µl). pAF66 (Punc-63::unc-63-SL2-GFP) was injected in
lin-15(n765ts) at 20 ng/µl with EKL15 [lin-15(+)] (80
ng/µl) as a co-injection marker.
Light microscopy
Animals were anesthetized with M9 buffer containing 20 mM sodium azide,
mounted on 2% agarose in M9 pads and examined by epifluorescence and/or DIC
optics using an Axioskop compound microscope (Zeiss). For confocal microscopy,
3.8 mM tricaine and 0.42 mM tetramisole were added to the anesthetic. Animals
were examined using a Leica (Nussloch, Germany) TCS SP2 AOBS confocal
microscope. Confocal image reconstructions were obtained with ImageJ.
Electron microscopy
Chemical fixation
Just-molted L3 larvae grown on standard or 0.75 mM DMPP plates were fixed
in 2.5% glutaraldehyde, 1% paraformaldehyde, 0.1 M cacodylate (pH 7.2) at
4°C and cut preferentially at the head and tail. Samples were then mounted
into agar blocks, postfixed in 1% OsO4, 0.1 M cacodylate buffer,
dehydrated in a series of alcohols and embedded in Araldite (Ernest F. Fullam;
Latham, NY).
High-pressure freezing
Young L3 animals were immobilized by high-pressure freezing just after L2
cuticle shedding, then dehydrated by freeze substitution and embedded in
Araldite as previously described (Rostaing
et al., 2004
).
| RESULTS |
|---|
|
|
|---|
|
DMPP is toxic during L2 stage by uncoupling developmental speed from the molt cycle
Although animals are exposed to DMPP from the beginning of the first larval
stage until they die at the L2/L3 molt, no phenotype is observed at the L1/L2
molt. As the L3 cuticle is synthesized during late L2 stage, the effects of
DMPP on development might be restricted to the second larval stage. To
establish DMPP sensitivity period, we performed transfer experiments
(Fig. 2A). When larvae hatched
on DMPP were removed from drug-containing plates before the L1/L2 molt, they
developed to adulthood. Conversely, larvae grown on standard plates placed on
DMPP after the L2/L3 molt were resistant to the drug. From these two
experiments, we concluded that DMPP toxicity is restricted to the L2
stage.
C. elegans cuticle is synthesized by the underlying epidermis and
disrupting epidermis development has been shown to affect the properties of
the cuticle being synthesized (Singh and
Sulston, 1978
). Lateral cells of the epidermis (`seam cells')
undergo stereotyped cell divisions at each larval stage. To analyze epidermis
development in DMPP-treated individuals, we followed seam cell divisions using
differential interference contrast (DIC) microscopy and the green fluorescent
protein (GFP) reporter Pcdh-3::GFP
(Kirouac and Sternberg, 2003
;
Pettitt et al., 1996
). This
reporter is also expressed in the anchor cell (AC), a specialized cell from
the somatic gonad which differentiates during late L2 stage. Based on seam
cell divisions and anchor cell differentiation, we divided the L2 stage into
five successive temporal stages (Fig.
2B). In the wild type, seam cells underwent an equational division
immediately followed by a stem cell division in which the anterior daughter
cell fuses with the epidermal syncytium hyp7. Later during L2 stage, GFP was
detected in the anchor cell (Fig.
2B). On DMPP, the two seam cell divisions were delayed by several
hours and most animals had just completed the second division by the end of
the second larval stage. In addition, the anchor cell precursor was observed
under DIC but none of the animals expressed GFP
(Fig. 2C). These data indicated
that DMPP delayed the development of at least two different tissues during the
L2 larval stage.
The end of the L2 larval stage is defined by the L2/L3 molt. Does DMPP also
delay this molt? The lethargus period, which corresponds to the initiation of
the molting process, is marked by behavioral changes, including cessation of
rhythmic pharyngeal contractions (also called pharyngeal pumping)
(Singh and Sulston, 1978
).
Pumping rate was monitored in a synchronized developing population
(Golden and Riddle, 1984a
). In
the absence of DMPP, L1/L2 and L2/L3 molts occurred at 26 and 36 hours after
egg laying, respectively. Exposure to DMPP did not affect the timing of L1/L2
or L2/L3 molts (Fig. 2D).
Therefore, DMPP uncouples the L2 developmental timer from the molting timer
(Fig. 2E) and causes a lethal
heterochronic phenotype characterized by molt triggering while epidermal cell
are undergoing mid-L2 developmental events.
|
|
Previous reports indicate that unc-63 is expressed in body-wall
muscles and in neurons (Culetto et al.,
2004
). However, recent gene predictions indicate that the
unc-63 promoter fragment used to characterize unc-63
expression pattern included an open reading frame upstream of unc-63.
To refine this analysis, we used a shorter unc-63 promoter fragment.
The unc-63-coding sequence expressed under the control of this
promoter was able to rescue DMPP resistance of unc-63(0) mutants
(Fig. 4A). GFP expression
driven by the Punc-63 promoter was detected in body-wall muscles, in
many head and tail neurons and in motoneurons
(Fig. 4B-D). In muscle, UNC-63
is part of a well-characterized receptor present at neuromuscular junctions
that is pharmacologically identified based on its sensitivity to the nicotinic
agonist levamisole. The levamisole-sensitive receptor consists of four
obligatory subunits (LEV-1, UNC-29, UNC-38 and UNC-63) that assemble with an
unknown stoichiometry to form a heteropentameric receptor. Mutating one of
these subunits is sufficient to inactivate fully the levamisole receptor
(Culetto et al., 2004
;
Richmond and Jorgensen, 1999
).
Two lines of evidence suggest that this muscle receptor is not the molecular
target responsible for DMPP-induced L2 heterochrony. First, null mutations in
unc-29 and unc-38 are as levamisole resistant as
unc-63(0) (see Fig. S1 in the supplementary material) but far less
DMPP resistant (Fig. 4A).
Second, muscle-specific expression of UNC-63 in an unc-63(0)
background rescued levamisole but not DMPP sensitivity
(Fig. 4A and see Fig. S1 in the
supplementary material). Therefore, illegitimate activation of an
UNC-63-containing AChR expressed in neurons is likely the cause of
heterochronic L2 development. Unfortunately, we could not rescue
unc-63(0) DMPP resistance by using the pan-neuronal promoter
Prab-3 (Nonet et al.,
1997
) to express UNC-63 in neurons (data not shown), but this
negative result might reflect a tight regulation of UNC-63 expression in
DMPP-responsive neurons that is not achievable with Prab-3.
|
The DAF-12 nuclear hormone receptor is necessary for efficient DMPP-induced L2 developmental delay
To identify the molecules required to implement DMPP effect, we performed a
forward genetic screen for mutants that can develop on DMPP. To speed up the
cloning of such DMPP-resistance genes, we used an insertional mutagenesis
technique based on the mobilization of the Drosophila transposon
Mos1 in the C. elegans germline
(Bessereau et al., 2001
;
Williams et al., 2005
). Among
seven resistant mutants, we identified two strains carrying a Mos1
insertion in the daf-12 gene. DAF-12 encodes a nuclear hormone
receptor (NHR) involved in many processes in C. elegans, including
temporal patterning, dauer formation and aging
(Antebi et al., 1998
;
Antebi et al., 2000
). One of
the Mos1 insertions isolated introduced a late stop in the DAF-12
open reading frame, and the second one was in the stop codon
(Fig. 5A). As these two
Mos1 alleles are not predicted to be null, we tested the DMPP
sensitivity of the null allele daf-12(rh61rh411) and demonstrated
that mutant animals were resistant to high DMPP concentrations
(Fig. 5B). As discussed for
unc-63, resistance to DMPP might have reflected alterations of the
molt cycle timing. We observed that the L2/L3 molt was not delayed in
daf-12(0) mutants (Fig.
5C). However, analysis of seam cell divisions showed that DMPP was
no longer inducing L2 developmental delay in daf-12(0) mutants
(Fig. 5D). Therefore the DAF-12
protein is required to implement DMPP-induced developmental delay.
Inactivating non-dauer daf-12 activity confers DMPP resistance
Genetic analysis has separated two daf-12 activities
(Antebi et al., 1998
;
Antebi et al., 2000
). One
activity, probably corresponding to the non-liganded form of this nuclear
receptor, is promoting L3 dauer diapause via the activation of genes required
for dauer formation. Null alleles of daf-12 are unable to form dauer
larvae in any environmental conditions (dauer formation-deficient Daf-d
phenotype). A second activity, probably generated by the DAF-12 receptor bound
to a steroid hormone, acts in non-dauer development. Mutations that are
predicted to impair hormone binding or interactions with co-activators or
co-repressors cause heterochronic phenotypes, including reiteration of the L2
seam cell division program at the L3 stage and reiteration of the L3 gonadal
migration program at the L4 stage. Based on heterochronic and dauer-formation
phenotypes, daf-12 alleles were grouped into six classes
(Antebi et al., 1998
)
(Fig. 5E). To test whether the
function of DAF-12 in the response to DMPP corresponds to a previously defined
activity, we evaluated the DMPP sensitivity of the strongest available
daf-12 allele of each class. We showed that class 1 to 4 mutants are
strongly resistant to DMPP, whereas class 5 are sensitive and class 6 are only
weakly resistant (Fig. 5E).
Therefore, resistance to DMPP is unrelated to dauer formation activity but is
qualitatively correlated with extra-gonadal heterochronic phenotypes. These
phenotypes are thought to reveal the loss of DAF-12 non-dauer activity, which
induces the progression from L2 to L3 developmental programs.
|
Environmental cues modulate DMPP sensitivity
Three major environmental parameters can affect DAF-12 activity and trigger
dauer formation in the wild type: food availability, temperature and
population density. Do these cues also modulate DMPP sensitivity? First, we
restricted food availability throughout development using pep-2 and
eat-6 mutants. pep-2 encodes an intestinal peptide
transporter (Meissner et al.,
2004
) that is essential for the uptake of intact peptides from the
gut lumen. eat-6 encodes a Na+/K+ ATPase
expressed specifically in the worm pharynx that is necessary for efficient
pharynx muscle contractions (Davis et al.,
1995
). pep-2(0) animals and strong eat-6
loss-of-function mutants are starved and develop slowly. We observed that a
significant fraction of pep-2(0) and eat-6(lf) mutants can
develop on DMPP (Fig. 6A), thus
suggesting that restricting food availability leads to partial DMPP
resistance. Second, we tested the effect of temperature on DMPP sensitivity.
In wild-type N2 strain, raising the temperature increased the survival of
animals on DMPP (Fig. 6B).
Third, DAF-12 activity is modulated by population density that is monitored
via the concentration of a constitutively secreted pheromone
(Golden and Riddle, 1982
;
Golden and Riddle, 1984b
;
Jeong et al., 2005
). High
concentration of this pheromone induces dauer formation. We monitored the
effect of DMPP in the presence of increasing concentrations of pheromone. The
experiments were performed at 20°C so that none of the animals entered
dauer diapause. Exposing worms to dauer pheromone increased survival on DMPP
in a concentration-dependent manner (Fig.
6C). Modulation of the sensitivity to DMPP by these three
environmental parameters cannot be explained by an increase of the L2 stage
duration: in our conditions, reduced food availability increased generation
time; high temperature speeded up development; and pheromone had no effect on
overall developmental speed (data not shown). Therefore, analysis of DMPP
sensitivity unmasks developmental effects of dauer-inducing stimuli in
non-dauer development, possibly by modulating the ratio between distinct
DAF-12 activities.
| DISCUSSION |
|---|
|
|
|---|
|
DAF-12 is required to implement nAChR stimulation in the control of development
In a forward genetic screen for animals that can reach adulthood on DMPP,
we isolated two novel mutant alleles of daf-12. DAF-12 is a nuclear
hormone receptor that belongs to the vitamin D and pregnane X receptor family
(Antebi et al., 2000
). It binds
DNA and regulates gene transcription by interacting with transcriptional
co-activators and co-repressors (Ludewig
et al., 2004
). daf-12 null mutants are unable to form
dauer larvae and suppress most mutants that constitutively develop into dauer.
Conversely, some daf-12 mutants are dauer-constitutive and are
epistatic to most dauer-defective mutants. Therefore, DAF-12 is considered to
be the main transcriptional output of a complex genetic network that controls
the dauer decision. DAF-12 remains an orphan receptor, but genetic and
biochemical evidence indicates that a steroid hormone regulates DAF-12
activity (Gerisch et al.,
2001
; Jia et al.,
2002
; Matyash et al.,
2004
). Schematically, DAF-12 could act as a developmental switch
that alternates between a hormone-free form necessary for dauer formation and
a hormone-bound form that promotes non-dauer development. Disrupting this
non-dauer activity results in heterochronic phenotypes. Analysis of DMPP
resistance unmasked a novel function of DAF-12 at the second larval stage,
which is independent of DAF-12 function in dauer formation. However, DMPP
resistance of daf-12 alleles qualitatively correlates with
extra-gonadal heterochronic phenotypes. This suggested that the non-dauer
activity of DAF-12, mediated by its hormone-bound form
(Antebi et al., 2000
), is
required to implement DMPP developmental phenotypes. This hypothesis was
further supported by the DMPP-resistance of daf-9 mutants, which
presumably abrogate DAF-12 ligand synthesis
(Gerisch et al., 2001
;
Jia et al., 2002
). Therefore,
we concluded that the ability of nAChRs to affect L2 development depends on
DAF-12 non-dauer activity mediated by the hormone-bound form of DAF-12.
DAF-12 is able to regulate the transcription of a wide range of targets
(Ao et al., 2004
;
Shostak et al., 2004
).
Liganded-DAF-12 might directly or indirectly control the L2-stage expression
of one gene or a subset of genes participating in the predicted signaling
cascade triggered by exposure to DMPP. Obvious candidates would be nAChRs.
However, we do not favor this hypothesis because unc-63 expression
remains unchanged in daf-12 null mutants (data not shown).
Alternatively, UNC-63-containing nAChRs might regulate DAF-12 activity that,
in turn, would control L2 development speed. However, analysis of unc-63;
daf-12 double-null mutants indicates that UNC-63 and DAF-12 do not
function in a simple linear pathway (data not shown). In addition, UNC-63 is
not expressed in the epidermal syncytium hyp7 or in the XXX cells (see Fig. S2
in the supplementary material), the two DAF-9 expressing tissues involved in
DAF-12 ligand synthesis. As L2 development speed is unchanged in
daf-12 null mutants, a likely hypothesis would be that the non-dauer
DAF-12 activity regulates components of the DMPP-triggered signaling cascade
that control L2 development speed (Fig.
7).
We showed that DMPP sensitivity can be modulated by environmental
conditions (food availability, temperature, population density) that otherwise
influence the dauer decision. Among them, the effect of dauer pheromone at
concentrations unable to induce dauer formation is highly reminiscent of the
transcriptional repression of the chemosensory receptor genes str-2,
str-3 and srd-1 by low levels of dauer pheromone
(Peckol et al., 1999
). The
mechanism of this repression was not analyzed further but could involve
daf-12. daf-12 is mostly envisioned as a transcriptional switch that
mediates an all-or-none response for the dauer decision
(Antebi et al., 2000
). However,
graded response to dauer-triggering stimuli through transcription of a
specific subset of genes is possible, either by combinatory assembly of
co-repressor and/or co-activator complexes, or by differential sensitivity of
target promoters. According to this model, inhibiting DAF-12 non-dauer
activity below a crucial threshold would cause the animals to develop to dauer
(Fig. 7).
|
Independent timers control development and molting
In C. elegans, the combination of invariant cell lineage and
discontinuous postembryonic development provided a means to identify
heterochronic genes that temporally specify cell identity. Because mutating
these genes causes entire stage-specific programs to occur earlier or later,
or be skipped (reviewed by Ambros,
2000
; Pasquinelli and Ruvkun,
2002
; Rougvie,
2001
; Thummel,
2001
), the temporal regulation of C. elegans
postembryonic development is viewed as the successive selection of
stage-specific developmental modules. However, whether a single timer is
launched at each larval stage and how events are coordinated within each
program remains largely unknown. The present results show that stimulation of
nicotinic receptors can uncouple the timing of cell division and
differentiation from the molt timing at the second larval stage. This suggests
that at least two timers exist at the L2 stage: one to control molting and one
to regulate cell divisions and differentiation
(Fig. 7). The mechanisms that
control C. elegans molt timing are still poorly understood
(Frand et al., 2005
) in
contrast to those in insects where each molt is triggered by a pulse of
ecdysteroid. The regulation of developmental speed and especially the
mechanisms that control the timing of cell divisions within each larval stage
are also poorly characterized. Specifically, heterochronic mutants were not
reported to display a change in developmental speed within a given larval
stage [for a discussion, see Kipreos
(Kipreos, 2005
)].
Our data suggest that nicotinic signaling in the nervous system represents
one of the upstream regulators of developmental speed and might provide a way
to connect environmental signals to animal development. We showed that DAF-12
plays a central role in this regulation and interacts in a non-linear pathway
with nicotinic signaling. As DAF-12 functions in complex genetic and molecular
networks to control temporal patterning, dauer formation and aging,
DMPP-sensitive nAChRs could modulate one branch of these networks. The
insulin-like pathway is an interesting candidate as it has been shown to
control developmental timing in Drosophila
(Bateman and McNeill, 2004
) and
to interact with the ecdysone NHR to regulate animal growth
(Colombani et al., 2005
).
Further analysis of the developmental effects of nAChR stimulation during
C. elegans post-embryonic development might represent an interesting
paradigm to analyze how the nervous system can modulate a genetically encoded
timer in response to extrinsic factors, and how multiple timers are
coordinated during the post-embryonic development of a multicellular
organism.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/11/2211/DC1
| REFERENCES |
|---|
|
|
|---|
Ambros, V. (2000). Control of developmental timing in Caenorhabditis elegans. Curr. Opin. Genet. Dev. 10,428 -433.[CrossRef][Medline]
Antebi, A., Culotti, J. G. and Hedgecock, E. M. (1998). daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development 125,1191 -1205.[Abstract]
Antebi, A., Yeh, W. H., Tait, D., Hedgecock, E. M. and Riddle,
D. L. (2000). daf-12 encodes a nuclear receptor that
regulates the dauer diapause and developmental age in C. elegans.
Genes Dev. 14,1512
-1527.
Ao, W., Gaudet, J., Kent, W. J., Muttumu, S. and Mango, S.
E. (2004). Environmentally induced foregut remodeling by
PHA-4/FoxA and DAF-12/NHR. Science
305,1743
-1746.
Bargmann, C. I. (1998). Neurobiology of the
Caenorhabditis elegans genome. Science
282,2028
-2033.
Bargmann, C. I. and Horvitz, H. R. (1991).
Control of larval development by chemosensory neurons in Caenorhabditis
elegans. Science 251,1243
-1246.
Bateman, J. M. and McNeill, H. (2004). Temporal control of differentiation by the insulin receptor/tor pathway in Drosophila. Cell 119,87 -96.[CrossRef][Medline]
Bessereau, J. L., Wright, A., Williams, D. C., Schuske, K., Davis, M. W. and Jorgensen, E. M. (2001). Mobilization of a Drosophila transposon in the Caenorhabditis elegans germ line. Nature 413,70 -74.[CrossRef][Medline]
Boorse, G. C. (2004). Endocrine mechanisms underlying plasticity in metamorphic timing in spadefoot toads. Integr. Comp. Biol. 43,646 -657.
Cassada, R. C. and Russell, R. L. (1975). The dauerlarva, a post-embryonic developmental variant of the nematode Caenorhabditis elegans. Dev. Biol. 46,326 -342.[CrossRef][Medline]
Colombani, J., Bianchini, L., Layalle, S., Pondeville, E.,
Dauphin-Villemant, C., Antoniewski, C., Carre, C., Noselli, S. and
Leopold, P. (2005). Antagonistic actions of ecdysone and
insulins determine final size in Drosophila. Science
310,667
-670.
Corringer, P. J., Le Novere, N. and Changeux, J. P. (2000). Nicotinic receptors at the amino acid level. Annu. Rev. Pharmacol. Toxicol. 40,431 -458.[CrossRef][Medline]
Culetto, E., Baylis, H. A., Richmond, J. E., Jones, A. K.,
Fleming, J. T., Squire, M. D., Lewis, J. A. and Sattelle, D. B.
(2004). The Caenorhabditis elegans unc-63 gene encodes a
levamisole-sensitive nicotinic acetylcholine receptor alpha subunit.
J. Biol. Chem. 279,42476
-42483.
Davis, M. W., Somerville, D., Lee, R. Y., Lockery, S., Avery, L. and Fambrough, D. M. (1995). Mutations in the Caenorhabditis elegans Na,K-ATPase alpha-subunit gene, eat-6, disrupt excitable cell function. J. Neurosci. 15,8408 -8418.[Abstract]
Ebling, F. J. (2005). The neuroendocrine timing
of puberty. Reproduction
129,675
-683.
Fleming, J. T., Squire, M. D., Barnes, T. M., Tornoe, C.,
Matsuda, K., Ahnn, J., Fire, A., Sulston, J. E., Barnard, E. A.,
Sattelle, D. B. et al. (1997). Caenorhabditis elegans
levamisole resistance genes lev-1, unc-29, and unc-38 encode functional
nicotinic acetylcholine receptor subunits. J.
Neurosci. 17,5843
-5857.
Frand, A. R., Russel, S. and Ruvkun, G. (2005). Functional genomic analysis of C. elegans molting. PLoS Biol. 3,e312 .[CrossRef][Medline]
Galligan, J. J. (1999). Nerve terminal
nicotinic cholinergic receptors on excitatory motoneurons in the myenteric
plexus of guinea pig intestine. J. Pharmacol. Exp.
Ther. 291,92
-98.
Garcia, L. R., Mehta, P. and Sternberg, P. W. (2001). Regulation of distinct muscle behaviors controls the C. elegans male's copulatory spicules during mating. Cell 107,777 -788.[CrossRef][Medline]
Gerisch, B., Weitzel, C., Kober-Eisermann, C., Rottiers, V. and Antebi, A. (2001). A hormonal signaling pathway influencing C. elegans metabolism, reproductive development, and life span. Dev. Cell 1,841 -851.[CrossRef][Medline]
Golden, J. W. and Riddle, D. L. (1982). A
pheromone influences larval development in the nematode Caenorhabditis
elegans. Science 218,578
-580.
Golden, J. W. and Riddle, D. L. (1984a). The Caenorhabditis elegans dauer larva: developmental effects of pheromone, food, and temperature. Dev. Biol. 102,368 -378.[CrossRef][Medline]
Golden, J. W. and Riddle, D. L. (1984b). A
pheromone-induced developmental switch in Caenorhabditis elegans:
temperature-sensitive mutants reveal a wild-type temperature-dependent
process. Proc. Natl. Acad. Sci. USA
81,819
-823.
Houthoofd, K., Braeckman, B. P., Lenaerts, I., Brys, K., De Vreese, A., Van Eygen, S. and Vanfleteren, J. R. (2002). Axenic growth up-regulates mass-specific metabolic rate, stress resistance, and extends life span in Caenorhabditis elegans. Exp. Gerontol. 37,1371 -1378.[CrossRef][Medline]
Jeong, P. Y., Jung, M., Yim, Y. H., Kim, H., Park, M., Hong, E., Lee, W., Kim, Y. H., Kim, K. and Paik, Y. K. (2005). Chemical structure and biological activity of the Caenorhabditis elegans dauer-inducing pheromone. Nature 433,541 -545.[CrossRef][Medline]
Jia, K., Albert, P. S. and Riddle, D. L.
(2002). DAF-9, a cytochrome P450 regulating C. elegans larval
development and adult longevity. Development
129,221
-231.
Johnstone, I. L. (2000). Cuticle collagen genes. Expression in Caenorhabditis elegans. Trends Genet. 16,21 -27.[Medline]
Jones, A. K. and Sattelle, D. B. (2004). Functional genomics of the nicotinic acetylcholine receptor gene family of the nematode, Caenorhabditis elegans. BioEssays 26, 39-49.[CrossRef][Medline]
Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G. and Ahringer, J. (2001). Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biol. 2, research0002.1-10.
Kim, J., Poole, D. S., Waggoner, L. E., Kempf, A., Ramirez, D.
S., Treschow, P. A. and Schafer, W. R. (2001). Genes
affecting the activity of nicotinic receptors involved in Caenorhabditis
elegans egg-laying behavior. Genetics
157,1599
-1610.
Kipreos, E. T. (2005). C. elegans cell cycles: invariance and stem cell divisions. Nat. Rev. Mol. Cell Biol. 6,766 -776.[CrossRef][Medline]
Kirouac, M. and Sternberg, P. W. (2003). cis-Regulatory control of three cell fate-specific genes in vulval organogenesis of Caenorhabditis elegans and C. briggsae. Dev. Biol. 257,85 -103.[CrossRef][Medline]
Lewis, J. A., Wu, C. H., Berg, H. and Levine, J. H.
(1980a). The genetics of levamisole resistance in the nematode
Caenorhabditis elegans. Genetics
95,905
-928.
Lewis, J. A., Wu, C. H., Levine, J. H. and Berg, H. (1980b). Levamisole-resistant mutants of the nematode Caenorhabditis elegans appear to lack pharmacological acetylcholine receptors. Neuroscience 5,967 -989.[CrossRef][Medline]
Li, W., Kennedy, S. G. and Ruvkun, G. (2003).
daf-28 encodes a C. elegans insulin superfamily member that is regulated by
environmental cues and acts in the DAF-2 signaling pathway. Genes
Dev. 17,844
-858.
Ludewig, A. H., Kober-Eisermann, C., Weitzel, C., Bethke, A.,
Neubert, K., Gerisch, B., Hutter, H. and Antebi, A.
(2004). A novel nuclear receptor/coregulator complex controls C.
elegans lipid metabolism, larval development, and aging. Genes
Dev. 18,2120
-2133.
Manetti, D., Bartolini, A., Borea, P. A., Bellucci, C., Dei, S., Ghelardini, C., Gualtieri, F., Romanelli, M. N., Scapecchi, S., Teodori, E. et al. (1999). Hybridized and isosteric analogues of N1-acetyl-N4-dimethyl-piperazinium iodide (ADMP) and N1-phenyl-N4-dimethyl-piperazinium iodide (DMPP) with central nicotinic action. Bioorg. Med. Chem. 7, 457-465.[CrossRef][Medline]
Matyash, V., Entchev, E. V., Mende, F., Wilsch-Brauninger, M., Thiele, C., Schmidt, A. W., Knolker, H. J., Ward, S. and Kurzchalia, T. V. (2004). Sterol-derived hormone(s) controls entry into diapause in Caenorhabditis elegans by consecutive activation of DAF-12 and DAF-16. PLoS Biol. 2,e280 .[CrossRef][Medline]
McGehee, D. S. and Role, L. W. (1995). Physiological diversity of nicotinic acetylcholine receptors expressed by vertebrate neurons. Annu. Rev. Physiol. 57,521 -546.[CrossRef][Medline]
McKay, J. P., Raizen, D. M., Gottschalk, A., Schafer, W. R. and
Avery, L. (2004). eat-2 and eat-18 are required for nicotinic
neurotransmission in the Caenorhabditis elegans pharynx.
Genetics 166,161
-169.
Meissner, B., Boll, M., Daniel, H. and Baumeister, R.
(2004). Deletion of the intestinal peptide transporter affects
insulin and TOR signaling in Caenorhabditis elegans. J. Biol.
Chem. 279,36739
-36745.
Mello, C. C., Kramer, J. M., Stinchcomb, D. and Ambros, V. (1991). Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10,3959 -3970.[Medline]
Nonet, M. L., Staunton, J. E., Kilgard, M. P., Fergestad, T.,
Hartwieg, E., Horvitz, H. R., Jorgensen, E. M. and Meyer, B. J.
(1997). Caenorhabditis elegans rab-3 mutant synapses exhibit
impaired function and are partially depleted of vesicles. J.
Neurosci. 17,8061
-8073.
Pasquinelli, A. E. and Ruvkun, G. (2002). Control of developmental timing by micrornas and their targets. Annu. Rev. Cell Dev. Biol. 18,495 -513.[CrossRef][Medline]
Peckol, E. L., Zallen, J. A., Yarrow, J. C. and Bargmann, C. I. (1999). Sensory activity affects sensory axon development in C. elegans. Development 126,1891 -1902.[Abstract]
Pettitt, J., Wood, W. B. and Plasterk, R. H. (1996). cdh-3, a gene encoding a member of the cadherin superfamily, functions in epithelial cell morphogenesis in Caenorhabditis elegans. Development 122,4149 -4157.[Abstract]
Rand, J. B. and Nonet, M. L. (1997). Synaptic transmission. In C. Elegans II (ed. D. L. Riddle, T. Blumenthal, B. J. Meyer and J. R. Priess), pp.611 -644. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Ren, P., Lim, C. S., Johnsen, R., Albert, P. S., Pilgrim, D. and
Riddle, D. L. (1996). Control of C. elegans larval
development by neuronal expression of a TGF-beta homolog.
Science 274,1389
-1391.
Richmond, J. E. and Jorgensen, E. M. (1999). One GABA and two acetylcholine receptors function at the C. elegans neuromuscular junction. Nat. Neurosci. 2, 791-797.[CrossRef][Medline]
Riddle, D. L. and Albert, P. S. (1997). Genetic and environmental regulation of dauer larva development. In C. Elegans II (ed. D. L. Riddle, T. Blumenthal, B. J. Meyer and J. R. Priess), pp. 739-768. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Rostaing, P., Weimer, R. M., Jorgensen, E. M., Triller, A. and
Bessereau, J. L. (2004). Preservation of immunoreactivity and
fine structure of adult C. elegans tissues using high-pressure freezing.
J. Histochem. Cytochem.
52, 1-12.
Rougvie, A. E. (2001). Control of developmental timing in animals. Nat. Rev. Genet. 2, 690-701.[CrossRef][Medline]
Rougvie, A. E. (2005). Intrinsic and extrinsic
regulators of developmental timing: from miRNAs to nutritional cues.
Development 132,3787
-3798.
Shostak, Y., Van Gilst, M. R., Antebi, A. and Yamamoto, K.
R. (2004). Identification of C. elegans DAF-12-binding sites,
response elements, and target genes. Genes Dev.
18,2529
-2544.
Simmer, F., Tijsterman, M., Parrish, S., Koushika, S. P., Nonet, M. L., Fire, A., Ahringer, J. and Plasterk, R. H. (2002). Loss of the putative RNA-directed RNA polymerase RRF-3 makes C. elegans hypersensitive to RNAi. Curr. Biol. 12,1317 -1319.[CrossRef][Medline]
Singh, R. N. and Sulston, J. E. (1978). Some observations on moulting in Caenorhabditis elegans.Nematologica 24,63 -71.
Sulston, J. and Hodgkin, J. (1988). Methods. In The Nematode Caenorhabditis Elegans (ed. W. B. Wood), pp. 587-606. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Thummel, C. S. (2001). Molecular mechanisms of developmental timing in C. elegans and Drosophila. Dev. Cell 1,453 -465.[CrossRef][Medline]
Towers, P. R., Edwards, B., Richmond, J. E. and Sattelle, D. B. (2005). The Caenorhabditis elegans lev-8 gene encodes a novel type of nicotinic acetylcholine receptor alpha subunit. J. Neurochem. 93,1 -9.[CrossRef][Medline]
Vizi, E. S. and Lendvai, B. (1999). Modulatory role of presynaptic nicotinic receptors in synaptic and non-synaptic chemical communication in the central nervous system. Brain Res. Brain Res. Rev. 30,219 -235.[CrossRef][Medline]
Williams, D. C., Boulin, T., Ruaud, A. F., Jorgensen, E. M. and
Bessereau, J. L. (2005). Characterization of Mos1 mediated
mutagenesis in C. elegans: a method for the rapid identification of mutated
genes. Genetics 169,1779
-1785.
Related articles in Development:
This article has been cited by other articles:
![]() |
N. Fielenbach and A. Antebi C. elegans dauer formation and the molecular basis of plasticity Genes & Dev., August 15, 2008; 22(16): 2149 - 2165. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jarriault, Y. Schwab, and I. Greenwald A Caenorhabditis elegans model for epithelial-neuronal transdifferentiation PNAS, March 11, 2008; 105(10): 3790 - 3795. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-F. Ruaud and J.-L. Bessereau The P-type ATPase CATP-1 is a novel regulator of C. elegans developmental timing that acts independently of its predicted pump function Development, March 1, 2007; 134(5): 867 - 879. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Hayes, A. R. Frand, and G. Ruvkun The mir-84 and let-7 paralogous microRNA genes of Caenorhabditis elegans direct the cessation of molting via the conserved nuclear hormone receptors NHR-23 and NHR-25 Development, December 1, 2006; 133(23): 4631 - 4641. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||