|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 May 2006
doi: 10.1242/dev.02378
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Cell Biology, Emory University School of Medicine, 615 Michael
Street, Atlanta, GA 30322, USA.
2 Department of Biology, Emory University, 1510 Clifton Road, Atlanta, GA 30322,
USA.
* Author for correspondence (e-mail: barry{at}cellbio.emory.edu)
Accepted 28 March 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Galactosyltransferase, Bmp, Zebrafish, Embryonic axis
| INTRODUCTION |
|---|
|
|
|---|
Most studies of complex carbohydrate function during vertebrate development
have relied upon the characterization of targeted knockouts of specific
glycosyltransferases of interest. This approach has yielded important clues
about the overall requirement of N-linked glycoside chains during
early development, and about the role of specific monosaccharide residues in
various physiological events (Domino et
al., 2001
; Ioffe and Stanley,
1994
; Lu et al.,
1997
; Maly et al.,
1996
). Furthermore, and perhaps more importantly, these studies
have shown that glycosyltransferases are a much more polymorphic class of
enzymes than previously thought. For example, targeted deletion of
ß1,4-galactosyltransferase uncovered the existence of five additional
genes that encode ß1,4-galactosyltransferases. In light of the large
number of individual glycosyltransferases thought to be active in mammalian
tissues (e.g.
150-300), it becomes difficult to achieve a more global
understanding of carbohydrate function through traditional knockout
approaches. To address this limitation, we have taken advantage of the
zebrafish system, which is more amenable to a high throughput analysis, to
investigate the function of glycosyltransferases during development. Herein,
we describe an essential and unexpected role for a
ß1,4-galactosyltransferase in patterning of the early embryo by
participating in proteoglycan glycosylation that is required for Bmp-dependent
specification of the dorsoventral axis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
In silico identification of ß4-galactosyltransferases
Putative zebrafish ß4-galactosyltransferases (ß4GalTs) were
identified through searches of the zebrafish genomic database (Sanger
Institute). Briefly, mammalian ß4GalTs (human ß4GalT5, NM_004776 and
mouse ß4GalT5, NM_019835) were used as query sequences. Putative trace
sequences were merged into contigs using the Lasergene sequence management
software (DNASTAR) to determine the full-length sequences. Identified
sequences were BLASTed against the genome assembly to identify putative splice
sites. Primary amino acid sequence, as well as genetic structure, was used to
define homology. Simple phylogeny was determined based upon parsimony,
aligning the known human ß4GalTs (NM_001497, NM_003780, NM_003779,
NM_212543, NM_004775) with putative zebrafish orthologs using protpars (J.
Felsenstein, unpublished). An unrooted phylogenetic tree was inferred from the
alignment using megalign (DNASTAR) and ClusalW
(Thompson et al., 1994
).
Cloning of full-length zebrafish ß4GalT5
ß4GalT5 was cloned by RT-PCR from total RNA isolated from 72-hour
zebrafish embryos. Primers (Operon) were designed to the central region of
ß4GalT5 and used to amplify a core fragment. Additional primers within
the core fragment were used to perform both 5' and 3' RACE. The
RACE fragments were gel purified and overlapping regions between the 5'
RACE, the core fragment and the 3' RACE were annealed. The full-length
transcript was generated by PCR using primers designed to the 5' and
3' UTR. The full-length transcript was then cloned into pCRII
(Invitrogen). Full-length ß4GalT5 was subjected to site-directed
mutagenesis to introduce silent mutations into the morpholino recognition site
that would eliminate binding (Gene-Tailor, Invitrogen). The MO3 recognition
sequence (TAATGCCGACACATCTGAGA) was modified to TTATGCCCACACACCTAAGC.
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed as described previously
(Thisse and Thisse, 1998
).
Briefly, staged embryos were fixed in 4% paraformaldehyde and dehydrated in
methanol. Following rehydration into phosphate-buffered saline/0.1% Tween-20,
embryos were prehybridized for 1 hour at 65°C. Hybridization with
gene-specific probes was conducted overnight at 65°C. DIG-labeled probes
were detected with
-DIG antibodies (Roche) and visualized with BCIP/NBT
(Vector Labs). Plasmids containing chordin were kindly provided by M.
Halpern (Carnegie Institution). pax2a, mkp3 and ß4galt5
RNA antisense probes were synthesized with T7 from BamH1 linearized
plasmids. Sense controls were generated from Not1 linearized plasmids
and transcribed with Sp6. At least 10 embryos were used in each assay. All in
situ hybridizations were repeated at least three times.
Microinjection of morpholino oligonucleotides and full-length RNA
Antisense morpholino oligonucleotides were designed to compliment either a
sequence in the 5'UTR of ß4GalT5 (MO1,
5'-CACTGCTGGAAATGTAAATACTCAT-3'; base pairs 245 to
221), an internal splice site of ß4GalT5 (MO2,
5'-ACGTGAACCCTGTCGCGTCCTGTCA-3'; base pairs +176 to +186 plus 15
intronic base pairs) or the start codon of ß4GalT5 (MO3,
5'-CGAAATCTCAGATGTGTCGGCATTA-3'; base pairs 2 to +23)
(Gene-Tools). Morpholinos were resuspended in 1xDaneau Buffer prior to
injection (Nasevicius and Ekker,
2000
). Various concentrations, as described in the text, were
injected into the cytoplasmic stream of two- and four-cell embryos.
Morpholinos to other galactosyltransferases or an irrelevant morpholino
oligonucleotide (5'-CCTCTTACCTCAGTTACAATTTATA-3') were injected as
controls. Full-length transcripts of ß4GalT5 and mutated ß4GalT5
were subcloned into the pCRII plasmid (Invitrogen). Mature capped and
poly-adenylated mRNA was transcribed from BamH1 linearized plasmids
using the T7 or Sp6 mMessage mMachine kit (Ambion). mRNA was diluted in water
and various concentrations were injected into the cytoplasmic stream of two-
and four-cell embryos. Antisense mRNA at the same concentrations was injected
as a control.
Western blot analysis
Embryos were lyzed in ice-cold lysis buffer (0.5% Triton X-100, 150 mM
NaCl, 20 nM Tris-HCl, 10 mM EDTA) and electrophoresed on 7.5% SDS-PAGE for
-Smad blots. Fifteen percent SDS-PAGE gels were used for
-Bmp
blotting. Blots were transferred to PVDF (Millipore) membranes and blocked in
5% nonfat dry milk in 20 mM Tris-HCl, 150 mM NaCl (TBS) plus 0.1% Tween-20
(TBST) for 1 hour at room temperature. Following block, membranes were
incubated in primary antibody (
-Smad5, 1:1000, Cell Signaling;
-phospho-Smad1/5/8, 1:1000, Cell Signaling;
-Bmp2, 2 µg/ml,
Sigma; or
-Bmp7, 2 µg/ml, Alpha Diagnostic International) in 5% BSA
in TBST for 12 hours at 4°C. Following three washes in TBST, membranes
were incubated in secondary antibody [goat
-rabbit-HRP (Santa Cruz) or
-mouse-HRP (Santa Cruz), both at 1:25,000 dilutions] in 5% BSA in TBST
for 1 hour at room temperature. Following three washes in TBST and two washes
in TBS, antibody reactivity was detected using ECL detection (Amersham).
Proteoglycan isolation and Bmp-binding assay
Proteoglycans were extracted as described previously from deyolked 85%
epiboly embryos (Hascall and Kimura,
1982
). Briefly, embryos were placed in ice-cold 4 M guanidine-HCl,
0.2% w/v zwittergent 3-12, 50 mM sodium acetate, 10 mM EDTA with protease
inhibitors (Roche), and incubated at 4°C for 1 hour. The lysates were
cleared by spinning at 15,000x g for 10 minutes at
4°C. The supernatant was removed and dialyzed against 20 mM Tris-HCl, pH
7.4, for 18 hours at 4°C. The proteoglycans were precipitated using 5%
cetylpyridinium chloride at 37°C for 1 hour. The precipitate was washed in
0.5 M sodium acetate/95% ethanol followed by 0.5 M sodium acetate/10% ethanol.
The final pellet was resuspended in 20 mM HEPES, pH 7.4. For SDS-PAGE of
isolated proteoglycans, samples were run on a 5% polyacrylamide gel. The gel
was fixed in 50% methanol/5% acetic acid for 1 hour and washed in 3% acetic
acid for 20 minutes with one change of the wash solution. Carbohydrates were
oxidized for 30 minutes with 10 mg/ml periodic acid in 3% acetic acid. The gel
was again washed for 20 minutes with 3% acetic acid and stained with Pro-Q
emerald (Molecular Probes) for 2 hours and visualized at 300 nm. The gel was
then stained for total protein by incubating with SYPRO stain (Molecular
Probes) and visualized at 300 nm.
For affinity chromatography, 100 µl of purified proteoglycans were coupled to an Affi-Gel 10 (BioRad) column. Briefly, 100 µl Affi-Gel 10 was washed with distilled water. Purified proteoglycans were added to the matrix, and incubated at room temperature for 1 hour. Following ligand binding, unbound sites were blocked with 0.1 M ethanolamine-HCl, pH 8, for 1 hour at room temperature. The bound and blocked matrix was added to a 1 ml syringe filled with approximately 100 µl volume of glass wool. The column was washed with 3 ml HEPES, pH 7.4 and stored at 4°C. All liquids were applied to the column and allowed to flow by gravity. Prior to use, the columns were washed with 1 ml 20 mM Tris-HCl, pH 7.4. Recombinant human BMP2 (Sigma) or recombinant human BMP7 (Sigma) (2 µg) was applied to the columns and allowed to bind. Following binding, the columns were washed with 1 ml 20 mM Tris-HCl, pH 7.4, and the BMP was eluted with increasing concentrations of NaCl in 20 mM Tris-HCl, pH 7.4. Fractionated eluent was separated by SDS-PAGE and probed for BMP2 or BMP7 by western blotting, as described above.
| RESULTS |
|---|
|
|
|---|
ß4galt5 is expressed throughout the embryo following initiation of zygotic transcription
To define the temporal expression of ß4galt5,
semi-quantitative RT-PCR was preformed with staged RNA libraries
(Fig. 2A). In the oocyte, high
levels of control mRNA [brul, a maternally and zygotically expressed
RNA-binding protein (Suzuki et al.,
2000
)] were detected (data not shown); however, there was no
detectable expression of ß4galt5. Low levels of ß4galt5
were first evident at 50% epiboly and reached peak expression by the 12-somite
stage. Levels of ß4GalT5 remained consistently high in Prim-16 stage
embryos. Thus, ß4GalT5 is not maternally loaded into the oocyte and peak
expression is reached by mid-somitogenesis.
|
|
20 embryos were injected in each experiment with equal
amounts of an irrelevant morpholino. The degree of embryonic death was similar
(<10% death) in all injections, irrelevant of the morpholino injected.
However, developmental defects were only seen in embryos injected with
ß4GalT5-specific morpholinos; all surviving embryos injected with control
morpholinos appeared normal (Fig.
3B).
|
The ß4GalT5 morphant phenotypes were classified according to the
criteria defined by Mullins et al.
(Mullins et al., 1996
) for
dorsoventral defects. The three classes of ß4GalT5 morphants roughly
correspond to the three most severe classes of dorsoventral phenotypes
described by Mullins et al. (Mullins et
al., 1996
). Class 3 embryos are similar to the pgy mutant
(Fig. 3C), in that they have a
slightly coiled tail indicative of mild dorsalization, and display moderate
ear defects, including small otic fields and an absence of otoliths (asterisk,
Fig. 3E). Interestingly, both
wild-type and ß4GalT5MO embryos express pax2a, a marker of the
otic vesicle (Pfeffer et al.,
1998
); however, the pax2a field in ß4GalT5MO embryos
is smaller and rounder than in wild-type embryos
(Fig. 3E).
Class 4 embryos are similar to the snh mutant and display a more significant coiling of the tail, as well as dorsalization within the anterior regions of the embryo, and are considered moderately dorsalized (Fig. 3C). Due to the severity of the phenotype, no otic structures were detected in this class of morphants, although both Class 4 and Class 5 embryos, in our hands, have pax2a staining in a region that is consistent with the otic field (data not shown). Class 5 embryos, similar to swr mutants (Fig. 3C), are the most severely affected and display a completely dorsalized phenotype.
The penetrance of the morpholino phenotype was directly dependent upon the amount of ß4GalT5 morpholino injected. As demonstrated for ß4GalT5MO1 (Table 1), injection of 5 ng morpholino resulted in a greater proportion of Class 3 embryos and few Class 5 embryos; whereas 20 ng resulted in high proportions of Class 5 embryos and few Class 3 embryos. Thus, the severity of the ß4GalT5 morpholino phenotype was dose dependent.
Whereas the use of multiple independent morpholino oligonucleotides is
taken as evidence that the phenotype results from downregulating the target
(i.e. ß4GalT5) transcript (Nechiporuk
et al., 2005
; Yan et al.,
2005
), we tested the specificity of the ß4GalT5 morpholinos
by injection of mRNA encoding full-length ß4GalT5 in combination with
ß4GalT5MO3 (Table 1).
Injection of 40 pg full-length mRNA in combination with 10 ng morpholino
resulted in a rescue of the ß4GalT5 knockdown phenotype, i.e. a wild-type
appearance (Fig. 3D). Injection
of full-length ß4GalT5 mRNA in the absence of morpholino did not produce
any noticeable phenotype. These results demonstrate that the phenotype
observed following injection of ß4GalT5 morpholino oligonucleotides
results from a specific reduction of ß4GalT5.
Because the ß4GalT5MO phenotype grossly phenocopies the swr,
snh and sbn mutations, which are characterized by dorsalized
embryos resulting from mutations in bmp2b, bmp7 or smad5,
respectively (Dick et al.,
2000
; Hild et al.,
1999
; Kishimoto et al.,
1997
), it was important to determine whether downregulating
ß4GalT5 had a synergistic effect with these mutations. Knockdown of
ß4GalT5 in swr (bmp2b) mutants failed to reveal any
additional phenotype, which may simply reflect the pre-existing severely
dorsalized phenotype in swr mutants. However, knockdown of
ß4GalT5 accentuated the moderate phenotype of snh
(bmp7) mutants into a more severe dorsalized appearance, similar to
that seen in the swr mutant (22 out of 24 morpholino-injected embryos
showed a swr phenotype versus 0 out of 24 control-injected embryos).
The failure of ß4GalT5 knockdown to influence the swr phenotype
and to increase the dorsalization of the more moderate snh mutant is
consistent with a ß4GalT5 function in Bmp signaling.
chordin expression is unrestricted in ß4GalT5 morphant embryos
Bmp2b and Bmp7 generate a negative-feedback loop with chordin that is
required for the proper establishment of the dorsoventral margin. In mutants
with defective Bmp signaling, such as swr and snh, chordin
expression invades the ventral hemisphere, a result of relieving the Bmp
inhibition (Miller-Bertoglio et al.,
1997
). Therefore, we examined chordin expression in 85%
epiboly embryos by in situ hybridization to determine whether Bmp signaling is
altered following ß4GalT5 knockdown. As reported, chordin
expression was high in the dorsal axis of control-injected embryos
(Fig. 4A; asterisk indicates
dorsal axis in all panels) and restricted from the ventral hemisphere (arrows,
Fig. 4A). ß4GalT5MO
embryos had no obvious dorsal axis when viewed dorsally
(Fig. 4B); however, the axis
was evident in the animal view (Fig.
4B). Moreover, chordin expression was expanded both
ventrally and anteriorly (Fig.
4B). The expanded chordin expression in the presumptive
ventral domain was also apparent when viewed from the vegetal pole
(Fig. 4B), where
chordin expression had completely enveloped the ventral
hemisphere.
|
Smad activation is decreased in ß4GalT5 morphants
Bmps affect gene expression through the activation of the Smad family of
transcription factors. Bmp receptor activation leads to phosphorylation of the
R-Smad proteins (receptor-regulated Smads1/5/8), which are subsequently
released from the receptor and form a heteromeric complex with the common
Smad, Smad4. The phosphorylated R-Smad/Smad4 complex is translocated into the
nucleus, where it regulates gene transcription
(Mehra and Wrana, 2002
).
|
|
Reduced glycosylation of high molecular weight proteoglycans in ß4GalT5 morphant embryos
It has become clear during the past few years that the ability of soluble
cytokines to maintain stable expression domains is dependent upon their
binding to the glycosaminoglycan (GAG) chains of large molecular weight
proteoglycans. However, virtually all of our knowledge comes from the study of
specific cytokines, such as Egf and Fgf, which bind to defined pentasaccharide
structures within the heparan sulfate chains of proteoglycans
(Hardingham and Fosang, 1992
;
Norton et al., 2005
). Although
other cytokines, including members of the Tgfß superfamily to which the
Bmps belong, have also been shown to bind proteoglycan GAG chains, the overall
binding specificity of proteoglycans for these other cytokines has yet to be
demonstrated. As we have no evidence to suggest that the expression of either
bmp2b or bmp7 is altered, we examined whether the defective
Bmp signaling characteristic of ß4GalT5MO embryos can be attributed to
abnormal proteoglycan biosynthesis.
|
300 kDa,
both of which contained similar protein levels in control and ß4GalT5MO
preparations (Fig. 6A). Both
polypeptide species were highly glycosylated in the control sample
(Fig. 6A); however, the same
polypeptide bands showed dramatically less carbohydrate content in the
ß4GalT5MO sample (Fig.
6A). Thus, the proteoglycan core proteins appear to be synthesized
normally in ß4GalT5MO embryos, but are grossly underglycosylated relative
to those in control-injected embryos. Surprisingly, the underglycosylated
proteoglycans from ß4GalT5 morphants resolved at a similar molecular mass
to control proteoglycans, suggesting either that the ß4GalT5 deficiency
does not lead to a global loss of GAG side-chains or that any reduction in
molecular weight, given the relative amount of carbohydrate in the native
proteoglycan, is too small to be resolved by the 6% SDS-polyacrylamide gel. In
any event, the proteoglycans from ß4GalT5 morphants show reduced
glycosylation, and we therefore determined whether this influenced its ability
to bind Bmp2 and/or Bmp7.
ß4GalT5 morphant proteoglycans fail to bind recombinant BMP2
Proteoglycans were extracted from 80% epiboly stage embryos and coupled to
an affinity support to which recombinant human BMP2 or BMP7 was applied, and
any unbound protein was removed by washing. Bound BMP2 or BMP7 was eluted by
increasing the salt concentration. BMP2 was eluted from control proteoglycans
(Fig. 6B) at 0.8-1.6 M NaCl,
similar to what others have shown for the binding of recombinant Noggin and
Bmp4 to synthetic heparin sulfate
(Paine-Saunders et al., 2002
).
When BMP2 was applied to proteoglycans isolated from ß4GalT5MO embryos
(Fig. 6B), BMP2 eluted from the
column at 0.2 M NaCl and was completely eluted by 0.8 M NaCl. Similar results
were obtained using proteoglycans isolated from ß4GalT5MO embryos
injected with either splice blocking (MO2) or translational blocking (MO3)
oligonucleotides. This demonstrates that proteoglycans isolated from
ß4GalT5MO embryos show a reduced binding affinity for BMP2, relative to
control proteoglycans.
We determined whether the decrease in BMP2 affinity to ß4GalT5MO
proteoglycans was specific to BMP2 or characteristic for other cytokines as
well. As Bmp7 is the other major ventralizing agent in the late epiboly stage
embryo, the affinity of BMP7 for control and ß4GalT5MO proteoglycans was
analyzed (Dick et al., 2000
).
BMP7 showed a distinctly different elution profile from that seen with BMP2,
with a broad elution profile between 0.4-1.4 M NaCl
(Fig. 6B). Unlike that seen
with BMP2, BMP7 showed a similar elution pattern from proteoglycans isolated
from both control-injected and ß4GalT5MO embryos. This indicates that
ß4GalT5 generates a proteoglycan epitope that has apparent specificity
for Bmp2, but not for Bmp7.
| DISCUSSION |
|---|
|
|
|---|
Previous analysis of glycosyltransferase function during development has
relied upon generating knockouts of individual transferases or through random
mutagenesis. Although these approaches have yielded insights into the function
of a few specific glycosyltransferases, there is still a plethora of
glycosyltransferases that remain uncharacterized
(Bulik and Robbins, 2002
;
Furukawa et al., 2001
;
Lu et al., 1997
;
Maly et al., 1996
;
Wandall et al., 2005
).
Furthermore, because of the large number of glycosyltransferases now known to
exist in mammalian tissues, and because of a poor understanding of the
substrate specificity for each enzyme, it is difficult to accurately identify
individual glycosyltransferases that are likely to be essential during
development. For example, there are currently six confirmed ß4GalTs in
the mammalian genome, and this reflects just one arm of the larger
glycosyltransferase `superfamily' (Lowe,
1991
). An initial search of the human genome suggests upwards of
300 glycosyltransferases are encoded. Generating targeted knockouts in all of
these genes to identify those that have functions during development would be
a monumental task.
Invertebrate systems have yielded new insight into developmentally
essential glycosyltransferases. For example, in C. elegans, sqv-3,
sqv-7 and sqv-8 predominantly affect the glycosylation of
chondroitin sulfate and heparan sulfate proteoglycans
(Bulik and Robbins, 2002
). As a
result of defective glycosylation, the vulval epithelium that normally
invaginates to form a tube, is either collapsed or completely absent.
Similarly, the Drosophila mutants fringe, brainiac and
egghead all encode glycosyltransferases with important developmental
roles. Fringe is a N-acetylgalactosaminyltransferase that is required
for regulating Notch signaling by modulating its ligand-binding specificity
(Moloney et al., 2000
).
brainiac and egghead are embryonic lethal mutations that
encode glycosyltransferases required for the synthesis of the core
carbohydrate in glycosphingolipids
(Wandall et al., 2005
).
Classically, glycosyltransferases are required for the posttranslational modification of virtually all membrane bound and secreted glycoproteins and glycolipids, so it is not surprising that ß4GalT5 showed widespread expression throughout the embryo. Although the widespread expression of glycosyltransferases has made it difficult to determine which ones are likely to play crucial roles during embryogenesis, the power of zebrafish has allowed us to screen the knockdown phenotype of individual transferases to identify those that are essential during development. Through this approach, we have identified a ß4GalT transcript that is required for dorsoventral patterning of the early embryo, but which had no precedent for having a role in vertebrate or invertebrate embryogenesis.
Specification of the dorsoventral axis is dependent upon Bmp signaling, as
shown by mutations in swirl/bmp2b, snailhouse/bmp7
and somitabun/smad5 (Dick
et al., 2000
; Hild et al.,
1999
; Nguyen et al.,
1998
). At the onset of gastrulation, Bmps are present throughout
the embryo, and not until the initial stages of dorsoventral patterning do
Fgf8, Bozozok, and possibly members of the Wnt family repress Bmp signaling in
the presumptive dorsal region of the embryo
(Furthauer et al., 2004
;
Kishimoto et al., 1997
;
Solnica-Krezel and Driever,
2001
). Once the dorsal organizer has been established, Chordin,
Follistatin and Noggin repress Bmp signaling by physically inhibiting the
binding of Bmp to its receptor (Iemura et
al., 1998
; Piccolo et al.,
1996
; Zimmerman et al.,
1996
). A feedback loop is established whereby Bmp2b/Bmp7 inhibit
Chordin through the activation of a chordin-specific protease, Tolloid
(Blader et al., 1997
). Upon Bmp
receptor activation, the R-Smad proteins (e.g. Smad5) are phosphorylated and
released from the receptor complex to form heteromeric complexes with Smad4;
these heteromeric complexes then translocate to the nucleus where they
activate the transcription of genes that direct ventralization
(Kimelman and Pyati, 2005
;
Mehra and Wrana, 2002
;
O'Connor et al., 2006
;
Padgett et al., 1998
).
Defective Bmp signaling leads to the inappropriate expansion of chordin expression into the presumptive ventral domain. In this study, we observed a similar expansion of chordin expression, suggesting a reduction of Bmp signaling in ß4GalT5MO embryos. Furthermore, we determined that the activated Smad signaling complex was inefficiently activated in ß4GalT5MO embryos, thus confirming a reduction in Bmp signaling. In order to determine how defective galactosylation in ß4GalT5MO embryos could affect Bmp-dependent signaling pathways, we compared proteoglycans from control and ß4GalTMO embryos, as proteoglycans are known to regulate cytokine binding and trafficking across the epithelial sheet.
Proteoglycans are a diverse class of extracellular proteins that consist of
a protein core anchored to the plasma membrane by either a transmembrane
domain (syndecans) or by a glycosylphosphatidylinositol (GPI) anchor
(glypicans); some proteoglycans can be secreted as well (perlecans)
(Kreis and Vale, 1999
).
Attached to the core protein are multiple, large molecular weight GAG chains
that account for as much as 90% of the proteoglycan mass, and which contain a
linker region followed by a repeating disaccharide unit unique to each GAG
type (Sugahara and Kitagawa,
2000
). GAG chains can be further modified by the addition of
sulfate groups to specific monosaccharide residues
(Chapman et al., 2004
), and
there is some evidence to suggest that the position of sulfate groups along
the GAG chain directs cytokine binding. Knockdown of a specific
sulfotransferase in zebrafish, zHS6ST, results in a phenotype similar to
knypek, which encodes a glypican involved in non-canonical Wnt
signaling, thus suggesting a role for GAG chains in the modulation of Wnt
signaling (Bink et al., 2003
;
Topczewski et al., 2001
).
However, the Drosophila homolog of zHS6ST, dHS6ST, is not involved in
Wnt signaling, although dHS6ST participates in Fgf signaling
(Kamimura et al., 2001
).
Although these studies suggest that sulfation can be crucial to ligand
binding, it is still unclear how alterations in sulfation directly regulate
ligand specificity. Our work suggests that carbohydrate moieties outside of
the traditional GAG chain and independent of sulfation can impact
ligand-binding specificity as well.
Of all of the proteoglycans, the most intensely studied are those that
contain heparan sulfate GAG chains. dally is a Drosophila
heparan sulfate proteoglycan that has been shown to interact with dpp
(a member of the Tgfß family of cytokines that includes the Bmps) in the
Drosophila imaginal disk (Jackson
et al., 1997
). Dally is also required for
wingless (wg) signaling in the wing disc by interacting with
the Wg receptor, Frizzled 2 (Cadigan et
al., 1998
). However, there is no evidence that dally
interacts with dpp during embryogenesis, where dpp is
essential for dorsoventral axis patterning.
We interpret the results presented here to suggest that ß4GalT5
participates in the synthesis of oligosaccharide chains of zebrafish
proteoglycans that are essential for Bmp2 binding and subsequent presentation
to its receptor, thus triggering Smad activation. ß4GalT5 has no apparent
role in the synthesis or expression of Bmp2, only in its ability to bind
and/or activate its receptor. Consequently, injection of recombinant Bmp2, or
its mRNA, would not be expected to rescue the morphant phenotype unless one
could bypass the requirement for proteoglycans and insure that Bmp2 was
presented to its receptor with equal efficacy as wild type. In a similar
study, defective synthesis of heparan sulfate proteoglycans that leads to
reduced Fgf10 signaling could not be rescued by the injection of Fgf10 protein
(Norton et al., 2005
).
It is interesting that whereas proteoglycans isolated from ß4GalT5MO embryos show reduced affinity for Bmp2, relative to control proteoglycans, binding of the closely related cytokine Bmp7 was relatively unaffected. The structure of the ß4GalT5 epitope involved in Bmp2 binding is of obvious interest, but because the substrate specificity of the ß4GalT5 identified here remains unknown, identification must await structural analysis of the relevant proteoglycan chains. In any event, this is the first report in which the ligand binding affinity of an endogenous proteoglycan can be modulated by a specific ß1,4-galactosylation. Furthermore, these results raise the possibility that the ligand-binding specificity of proteoglycans may be defined by a carbohydrate `code' involving glycoside residues both internal and external to the traditional GAG chains.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bink, R. J., Habuchi, H., Lele, Z., Dolk, E., Joore, J., Rauch,
G. J., Geisler, R., Wilson, S. W., den Hertog, J., Kimata, K. et
al. (2003). Heparan sulfate 6-o-sulfotransferase is essential
for muscle development in zebrafish. J. Biol. Chem.
278,31118
-31127.
Blader, P., Rastegar, S., Fischer, N. and Strahle, U.
(1997). Cleavage of the BMP-4 antagonist chordin by zebrafish
tolloid. Science 278,1937
-1940.
Bulik, D. A. and Robbins, P. W. (2002). The
Caenorhabditis elegans sqv genes and functions of proteoglycans in
development. Biochim. Biophys. Acta
1573,247
-257.[Medline]
Cadigan, K. M., Fish, M. P., Rulifson, E. J. and Nusse, R.
(1998). Wingless repression of Drosophila frizzled 2 expression
shapes the Wingless morphogen gradient in the wing.
Cell 93,767
-777.[CrossRef][Medline]
Chapman, E., Best, M. D., Hanson, S. R. and Wong, C. H.
(2004). Sulfotransferases: structure, mechanism, biological
activity, inhibition, and synthetic utility. Angew. Chem. Int. Ed.
Engl. 43,3526
-3548.[Medline]
Dick, A., Hild, M., Bauer, H., Imai, Y., Maifeld, H., Schier, A.
F., Talbot, W. S., Bouwmeester, T. and Hammerschmidt, M.
(2000). Essential role of Bmp7 (snailhouse) and its prodomain in
dorsoventral patterning of the zebrafish embryo.
Development 127,343
-354.[Abstract]
Domino, S. E., Zhang, L., Gillespie, P. J., Saunders, T. L. and
Lowe, J. B. (2001). Deficiency of reproductive tract
alpha(1,2)fucosylated glycans and normal fertility in mice with targeted
deletions of the FUT1 or FUT2 alpha(1,2)fucosyltransferase locus.
Mol. Cell. Biol. 21,8336
-8345.
Furthauer, M., Van Celst, J., Thisse, C. and Thisse, B.
(2004). Fgf signalling controls the dorsoventral patterning of
the zebrafish embryo. Development
131,2853
-2864.
Furukawa, K., Takamiya, K., Okada, M., Inoue, M., Fukumoto, S.
and Furukawa, K. (2001). Novel functions of complex
carbohydrates elucidated by the mutant mice of glycosyltransferase genes.
Biochim. Biophys. Acta
1525, 1-12.[Medline]
Hagen, F. K., Hazes, B., Raffo, R., deSa, D. and Tabak, L.
A. (1999). Structure-function analysis of the
UDP-N-acetyl-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase.
Essential residues lie in a predicted active site cleft resembling a lactose
repressor fold. J. Biol. Chem.
274,6797
-6803.
Hardingham, T. E. and Fosang, A. J. (1992).
Proteoglycans: many forms and many functions. FASEB J.
6, 861-870.[Abstract]
Hascall, V. C. and Kimura, J. H. (1982).
Proteoglycans: isolation and characterization. Methods
Enzymol. 82,769
-800.
Hild, M., Dick, A., Rauch, G. J., Meier, A., Bouwmeester, T.,
Haffter, P. and Hammerschmidt, M. (1999). The smad5 mutation
somitabun blocks Bmp2b signaling during early dorsoventral patterning of the
zebrafish embryo. Development
126,2149
-2159.[Abstract]
Iemura, S., Yamamoto, T. S., Takagi, C., Uchiyama, H., Natsume,
T., Shimasaki, S., Sugino, H. and Ueno, N. (1998).
Direct binding of follistatin to a complex of bone-morphogenetic protein and
its receptor inhibits ventral and epidermal cell fates in early Xenopus
embryo. Proc. Natl. Acad. Sci. USA
95,9337
-9342.
Ioffe, E. and Stanley, P. (1994). Mice lacking
N-acetylglucosaminyltransferase I activity die at mid-gestation, revealing an
essential role for complex or hybrid N-linked carbohydrates. Proc.
Natl. Acad. Sci. USA 91,728
-732.
Jackson, S. M., Nakato, H., Sugiura, M., Jannuzi, A., Oakes, R.,
Kaluza, V., Golden, C. and Selleck, S. B. (1997).
dally, a Drosophila glypican, controls cellular responses to the
TGF-beta-related morphogen, Dpp. Development
124,4113
-4120.[Abstract]
Kamimura, K., Fujise, M., Villa, F., Izumi, S., Habuchi, H.,
Kimata, K. and Nakato, H. (2001). Drosophila heparan
sulfate 6-O-sulfotransferase (dHS6ST) gene. Structure, expression, and
function in the formation of the tracheal system. J. Biol.
Chem. 276,17014
-17021.
Kimelman, D. and Pyati, U. J. (2005). Bmp
signaling: turning a half into a whole. Cell
123,982
-984.[CrossRef][Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and
Schilling, T. F. (1995). Stages of embryonic development of
the zebrafish. Dev. Dyn.
203,253
-310.[Medline]
Kishimoto, Y., Lee, K. H., Zon, L., Hammerschmidt, M. and
Schulte-Merker, S. (1997). The molecular nature of
zebrafish swirl: BMP2 function is essential during early dorsoventral
patterning. Development
124,4457
-4466.[Abstract]
Kreis, T. and Vale, R. (1999).
Guidebook to the Extracellular Matrix, Anchor, and Adhesion
Proteins. Oxford, New York: Oxford University Press.
Lo, N. W., Shaper, J. H., Pevsner, J. and Shaper, N. L.
(1998). The expanding beta 4-galactosyltransferase gene family:
messages from the databanks. Glycobiology
8, 517-526.
Lowe, J. B. (1991). Molecular cloning,
expression, and uses of mammalian glycosyltransferases. Semin. Cell
Biol. 2,289
-307.[Medline]
Lu, Q., Hasty, P. and Shur, B. D. (1997).
Targeted mutation in beta1,4-galactosyltransferase leads to pituitary
insufficiency and neonatal lethality. Dev. Biol.
181,257
-267.[CrossRef][Medline]
Maly, P., Thall, A., Petryniak, B., Rogers, C. E., Smith, P. L.,
Marks, R. M., Kelly, R. J., Gersten, K. M., Cheng, G., Saunders, T. L.
et al. (1996). The alpha(1,3)fucosyltransferase Fuc-TVII
controls leukocyte trafficking through an essential role in L-, E-, and
P-selectin ligand biosynthesis. Cell
86,643
-653.[CrossRef][Medline]
Mehra, A. and Wrana, J. L. (2002). TGF-beta and
the Smad signal transduction pathway. Biochem. Cell
Biol. 80,605
-622.[CrossRef][Medline]
Miller-Bertoglio, V. E., Fisher, S., Sanchez, A., Mullins, M. C.
and Halpern, M. E. (1997). Differential regulation of
chordin expression domains in mutant zebrafish. Dev.
Biol. 192,537
-550.[CrossRef][Medline]
Moloney, D. J., Panin, V. M., Johnston, S. H., Chen, J., Shao,
L., Wilson, R., Wang, Y., Stanley, P., Irvine, K. D., Haltiwanger, R.
S. et al. (2000). Fringe is a glycosyltransferase that
modifies Notch. Nature
406,369
-375.[CrossRef][Medline]
Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J.,
Brand, M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Haffter, P.,
Heisenberg, C. P. et al. (1996). Genes establishing
dorsoventral pattern formation in the zebrafish embryo: the ventral specifying
genes. Development 123,81
-89.[Abstract]
Nasevicius, A. and Ekker, S. C. (2000).
Effective targeted gene `knockdown' in zebrafish. Nat.
Genet. 26,216
-220.[CrossRef][Medline]
Nechiporuk, A., Linbo, T. and Raible, D. W.
(2005). Endoderm-derived Fgf3 is necessary and sufficient for
inducing neurogenesis in the epibranchial placodes in zebrafish.
Development 132,3717
-3730.
Nguyen, V. H., Schmid, B., Trout, J., Connors, S. A., Ekker, M.
and Mullins, M. C. (1998). Ventral and lateral regions
of the zebrafish gastrula, including the neural crest progenitors, are
established by a bmp2b/swirl pathway of genes. Dev.
Biol. 199,93
-110.[CrossRef][Medline]
Norton, W. H. J., Ledin, J., Grandel, H. and Neumann, C. J.
(2005). HSPG synthesis by zebrafish Ext2 and Ext13 is required
for Fgf10 signaling during limb development.
Development 132,4963
-4973.
O'Connor, M. B., Umulis, D., Othmer, H. G. and Blair, S. S.
(2006). Shaping BMP morphogen gradients in the Drosophila embryo
and pupal wing. Development
133,183
-193.
Padgett, R. W., Das, P. and Krishna, S. (1998).
TGF-beta signaling, Smads, and tumor suppressors.
BioEssays 20,382
-390.[CrossRef][Medline]
Paine-Saunders, S., Viviano, B. L., Economides, A. N. and
Saunders, S. (2002). Heparan sulfate proteoglycans retain
Noggin at the cell surface: a potential mechanism for shaping bone
morphogenetic protein gradients. J. Biol. Chem.
277,2089
-2096.
Pfeffer, P. L., Gerster, T., Lun, K., Brand, M. and Busslinger,
M. (1998). Characterization of three novel members of the
zebrafish Pax2/5/8 family: dependency of Pax5 and Pax8 expression on the
Pax2.1 (noi) function. Development
125,3063
-3074.[Abstract]
Piccolo, S., Sasai, Y., Lu, B. and De Robertis, E. M.
(1996). Dorsoventral patterning in Xenopus: inhibition of ventral
signals by direct binding of chordin to BMP-4. Cell
86,589
-598.[CrossRef][Medline]
Solnica-Krezel, L. and Driever, W. (2001). The
role of the homeodomain protein Bozozok in zebrafish axis formation.
Int. J. Dev. Biol. 45,299
-310.[Medline]
Sugahara, K. and Kitagawa, H. (2000). Recent
advances in the study of the biosynthesis and functions of sulfated
glycosaminoglycans. Curr. Opin. Struct. Biol.
10,518
-527.[CrossRef][Medline]
Suzuki, H., Maegawa, S., Nishibu, T., Sugiyama, T., Yasuda, K.
and Inoue, K. (2000). Vegetal localization of the maternal
mRNA encoding an EDEN-BP/Bruno-like protein in zebrafish. Mech.
Dev. 93,205
-209.[CrossRef][Medline]
Thisse, C. and Thisse, B. (1998). High
resolution whole-mount in situ hybridization. In The Zebrafish
Science Monitor. Vol. 5 (ed. M.
Westerfield), pp. 8-9. Eugene, OR: ZFIN.
Thompson, J. D., Higgins, D. G. and Gibson, T. J.
(1994). CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res.
22,4673
-4680.
Topczewski, J., Sepich, D. S., Myers, D. C., Walker, C., Amores,
A., Lele, Z., Hammerschmidt, M., Postlethwait, J. and Solnica-Krezel,
L. (2001). The zebrafish glypican knypek controls cell
polarity during gastrulation movements of convergent extension.
Dev. Cell 1,251
-264.[CrossRef][Medline]
Tsang, M., Maegawa, S., Kiang, A., Habas, R., Weinberg, E. and
Dawid, I. B. (2004). A role for MKP3 in axial patterning of
the zebrafish embryo. Development
131,2769
-2779.
Varki, A. (1993). Biological roles of
oligosaccharides: all of the theories are correct.
Glycobiology 3,97
-130.
Wandall, H. H., Pizette, S., Pedersen, J. W., Eichert, H.,
Levery, S. B., Mandel, U., Cohen, S. M. and Clausen, H.
(2005). Egghead and brainiac are essential for glycosphingolipid
biosynthesis in vivo. J. Biol. Chem.
280,4858
-4863.
Westerfield, M. (1993). The
Zebrafish Book: A Guide for the Laboratory use of Zebrafish (Brachydanio
rerio). Eugene, OR: M. Westerfield.
Wrana, J. L. and Attisano, L. (2000). The Smad
pathway. Cytokine Growth Factor Rev.
11, 5-13.[CrossRef][Medline]
Yan, Y.-L., Willoughby, J., Liu, D., Crump, J. G., Wilson, C.,
Miller, C. T., Singer, A., Kimmel, C., Westerfield, M. and
Postlethwait, J. H. (2005). A pair of Sox: distinct and
overlapping functions of zebrafish sox9 co-orthologs in craniofacial and
pectoral fin development. Development
132,1069
-1083.
Zimmerman, L. B., De Jesus-Escobar, J. M. and Harland, R. M.
(1996). The Spemann organizer signal noggin binds and inactivates
bone morphogenetic protein 4. Cell
86,599
-606.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
P. Herr, G. Korniychuk, Y. Yamamoto, K. Grubisic, and M. Oelgeschlager Regulation of TGF-{beta} signalling by N-acetylgalactosaminyltransferase-like 1 Development, May 15, 2008; 135(10): 1813 - 1822. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||