spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online May 23, 2006
doi: 10.1242/10.1242/dev.02400


Development 133, 2347-2357 (2006)
Published by The Company of Biologists 2006


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Akiyama-Oda, Y.
Right arrow Articles by Oda, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Akiyama-Oda, Y.
Right arrow Articles by Oda, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Axis specification in the spider embryo: dpp is required for radial-to-axial symmetry transformation and sog for ventral patterning

Yasuko Akiyama-Oda1,2,* and Hiroki Oda1,*

1 JT Biohistory Research Hall, 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125, Japan.
2 PRESTO, Japan Science and Technology Agency, Saitama, Japan.

* Authors for correspondence (e-mail: yasuko{at}brh.co.jp and hoda{at}brh.co.jp)

Accepted 10 April 2006


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The mechanism by which Decapentaplegic (Dpp) and its antagonist Short gastrulation (Sog) specify the dorsoventral pattern in Drosophila embryos has been proposed to have a common origin with the mechanism that organizes the body axis in the vertebrate embryo. However, Drosophila Sog makes only minor contributions to the development of ventral structures that hypothetically correspond to the vertebrate dorsum where the axial notochord forms. In this study, we isolated a homologue of the Drosophila sog gene in the spider Achaearanea tepidariorum, and characterized its expression and function. Expression of sog mRNA initially appeared in a radially symmetrical pattern and later became confined to the ventral midline area, which runs axially through the germ band. RNA interference-mediated depletion of the spider sog gene led to a nearly complete loss of ventral structures, including the axial ventral midline and the central nervous system. This defect appeared to be the consequence of dorsalization of the ventral region of the germ band. By contrast, the extra-embryonic area formed normally. Furthermore, we showed that embryos depleted for a spider homologue of dpp failed to break the radial symmetry, displaying evenly high levels of sog expression except in the posterior terminal area. These results suggest that dpp is required for radial-to-axial symmetry transformation of the spider embryo and sog is required for ventral patterning. We propose that the mechanism of spider ventral specification largely differs from that of the fly. Interestingly, ventral specification in the spider is similar to the process in vertebrates in which the antagonism of Dpp/BMP signaling plays a central role in dorsal specification.

Key words: Spider, Embryogenesis, dpp, sog, Antagonist, Body axis formation, RNAi


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The fertilized eggs of Xenopus, as well as those of many other vertebrates, are transformed from a radially symmetrical form to a bilaterally symmetrical form with an axis (Gerhart, 2004Go; Kimelman and Bjornson, 2004Go). The dorsal lip of the blastopore in the amphibian embryo, known as Spemann's organizer, can organize surrounding cells to form a complete body axis (Spemann and Mangold, 1924Go). This organizer itself contributes to the axial (dorsal-most) mesoderm becoming the notochord, concomitant with the patterning of the more ventral mesoderm and neural tissues. Molecular studies have suggested that the organizing activity is exerted by antagonizing bone morphogenetic protein (BMP) and Wnt signals (Piccolo et al., 1996Go; Harland and Gerhart, 1997Go; De Robertis et al., 2000Go). Chordin, noggin and follistatin are BMP antagonists expressed at the organizer (Lamb et al., 1993Go; Hemmati-Brivanlou et al., 1994Go; Sasai et al., 1994Go; Fainsod et al., 1997Go). Simultaneous depletion of these three BMP antagonists leads to a gross failure in the development of dorsal structures, including the notochord and neural tissues (Khokha et al., 2005Go).

In the fruit fly Drosophila melanogaster, a homologue of vertebrate BMP2/4, Decapentaplegic (Dpp), and a homologue of chordin, Short gastrulation (Sog), have also been shown to function antagonistically in dorsoventral (DV) pattern formation of the embryo (Irish and Gelbart, 1987Go; Padgett et al., 1987Go; Ferguson and Anderson, 1992aGo; Ferguson and Anderson, 1992bGo; François et al., 1994Go). Sog is the only Dpp antagonist that is known to function in the early Drosophila embryo, and two different roles for the molecule have been identified. The first role is to prevent the Dpp signal from invading the neuroectoderm that forms at the ventrolateral region (François et al., 1994Go; Biehs et al., 1996Go). The second role is to contribute to the formation of a sharp stripe of Dpp signaling activation at the dorsal-most region that will become the extra-embryonic amnioserosa (Ashe and Levine, 1999Go; Decotto and Ferguson, 2001Go). Although the latter role is considered to be unique to the fly, the former role is markedly similar to that of BMP antagonists in the development of vertebrate dorsal structures. This similarity has raised the hypothesis that the orientation of the Drosophila DV axis is opposite to that of the vertebrate DV axis, assuming that these axes had a common origin (Holley et al., 1995Go; De Robertis and Sasai, 1996Go; Ferguson, 1996Go; Holley and Ferguson, 1997Go; Bier, 1997Go). Despite the fascinating implications this would have for DV axis evolution, however, the null mutation for Drosophila sog only slightly reduces the neuroectoderm and barely affects the differentiation of the ventral midline (Fig. S1 in supplementary material) (François et al., 1994Go) not validating the potential importance of Dpp/BMP antagonism in DV axis specification in the common ancestor of Drosophila and vertebrates. The only organism other than Drosophila and vertebrates in which a Dpp/BMP antagonist has been studied is the ascidian, in which function of the antagonist has not been related to DV axis development or neural induction (Darras and Nishida, 2001Go).

In the phylum Arthropoda, twinned embryos can be produced spontaneously (see Fig. S2 in the supplementary material) or experimentally in spiders, horseshoe crabs and short-germ insects (Holm, 1952Go; Sekiguchi, 1957Go; Seitz, 1970Go; Sander, 1976Go; Itow et al., 1991Go). These may indicate the existence of different modes of axis specification from that of Drosophila. A study of the Dpp-Sog system within Arthropoda would contribute to a better understanding of DV axis evolution. Spiders and horseshoe crabs are chelicerate arthropods that are phylogenetically distant from the insect Drosophila (Friedrich and Tautz, 1995Go; Hwang et al., 2001Go; Giribet et al., 2001Go). In early development of spiders, such as Achaearanea tepidariorum, the future DV axis becomes predictable by the onset of directional movement of a cellular thickening called the cumulus, which is formed at the center of the radially symmetrical germ disc and then shifts centrifugally to the rim (Akiyama-Oda and Oda, 2003Go). Graft experiments using Agelena labyrinthica showed that the cumulus has the ability to induce a secondary body axis (Holm, 1952Go). The shift of the cumulus is followed by formation of the extra-embryonic area and rearrangements of the germ disc cells. These morphogenetic events transform the germ disc into the bilaterally symmetrical germ band. Our previous study showed that, in the spider Achaearanea tepidariorum, a cluster of the mesenchymal cells at the cumulus (CM cells) is the source of Dpp signals (Akiyama-Oda and Oda, 2003Go). In this study, we investigated the roles of dpp and sog in DV axis development of the Achaearanea embryo.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals
The two spider species Achaearanea tepidariorum and Pholcus phalangioides were collected at Kyoto University (Kyoto, Japan) and in Takatsuki city (Osaka, Japan). Dried eggs of Artemia franciscana were purchased (Tetra). Developmental stages of Achaearanea embryos were determined according to previous studies (Akiyama-Oda and Oda, 2003Go; Yamazaki et al., 2005Go). At-dpp depleted embryos, which exhibited gross malformations, could not be staged on the basis of morphological characteristics; instead, they were staged based on the time past stage 5.

cDNA cloning
We cloned Achaearanea sog (At-sog), Pholcus sog (Pp-sog), Artemia sog (Af-sog), and the Achaearanea genes single minded (At-sim), prospero (At-pros), engrailed (At-en) and optomotor blind (At-omb). Details of cDNA cloning are presented in Table 1. The sequences are available from the DNA Data Bank of Japan with the following accession numbers: At-sog, AB236147; Pp-sog, AB236148; Af-sog, AB236149; At-sim, AB236150; At-pros, AB236151; At-en, BAD01489; At-omb, AB177876. To characterize the deduced amino acid sequences of the cloned genes, BLASTP, BLAST 2 sequences (http://www.ncbi.nlm.nih.gov/blast/), PHYLIP version 3.5 and HarrPlot 2.0 (GENETYX Mac version 12) were used. BLASTP search analyses revealed that the sequences of At-Pros and At-En are very close to those of Cs-Pros (Weller and Tautz, 2003Go) and Cs-En (Damen et al., 1998Go), respectively, which were previously reported in another spider species Cupiennius salei. Molecular phylogenetic trees were constructed for At-Sim and At-Omb (see Fig. S3 in the supplementary material).


View this table:
[in this window]
[in a new window]
 
Table 1. Sequences of degenerate primers used for cloning of short gastrulation (sog), single-minded (sim), prospero (pros), engrailed (en) and optomotor blind (omb) genes

 
Staining of embryos
Achaearanea and Pholcus embryos and Artemia larvae were fixed as described previously (Akiyama-Oda and Oda, 2003Go; Oda et al., 2005Go). Whole-mount in situ hybridization was performed as described previously (Lehmann and Tautz, 1994Go; Akiyama-Oda and Oda, 2003Go). For single-staining, digoxigenin (DIG)-labeled probe was used. For double-staining, embryos were incubated with a mixture of DIG- and fluorescein-labeled probes. The DIG-labeled probe was visualized in the same way as the single staining, followed by post-fixation and subsequent inactivation of alkaline phosphatase with 0.1 M glycine-HCl (pH 2.2). Then, the fluorescein-labeled probe was visualized using an alkaline phosphatase-conjugated rabbit anti-FITC antibody (DAKO, 1:200 dilution) and INT/BCIP solution (Roche). For nuclear staining, DAPI (Sigma) was used. To detect phosphorylated Mothers against dpp (pMad) protein for visualizing nuclei of cells responding Dpp signals, the PS1 antibody (Persson et al., 1998Go) was used as described (Akiyama-Oda and Oda, 2003Go). For sectioning, stained Achaearanea embryos were dehydrated in a graded ethanol-xylene series, embedded in TissuePrep (Fisher Scientific), and then serially sectioned at 5 µm.

Double-stranded RNA preparation
Double-stranded RNAs (dsRNAs) for the 706-bp [nucleotide (nt) 334-1039] and 1041-bp (nt 1947-2987) regions of the At-sog cDNA, the 736-bp (nt 1005-1740) region of At-dpp (Akiyama-Oda and Oda, 2003Go), and the coding region of the gene for jellyfish green fluorescent protein (gfp) (Quantum) were prepared according to Niimi et al. (Niimi et al., 2005Go), except that the dsRNAs were denatured at 95°C for 5 minutes, and annealed. The dsRNAs were used at concentrations of 1.5 to 2.5 µg/µl.

dsRNA injection to the spider Achaearanea tepidariorum
Mature spider females, either virgins or postmated, were used for dsRNA injection. Under a stereomicroscope, 1-2 µl of dsRNA solution was introduced into the opisthosoma of each female from the dorsal side using a pulled glass capillary whose tip was broken with forceps. This injection process was repeated two to six times at intervals of 2-3 days. The virgin females were mated after the second cycle of injection. However, the timing of mating essentially did not affect the final results. Egg sacs made by the injected females were each analyzed separately. Some eggs from every egg sac were submerged in halocarbon oil 700 (Sigma) to examine the development of the embryo. To evaluate the effects of At-sog dsRNA injection, the numbers of segments bearing unseparated limb buds at stage 9 (a normal spider embryo has six pairs of limb buds) were counted after dechorionation with commercial bleach. Embryos with four to six unseparated limb buds were classified as having the severe phenotype, and those with one to three unseparated limb bud(s) as having the mild phenotype. Achaearanea embryos show spontaneous developmental errors at frequencies depending on individuals or egg sacs. To minimize non-specific effects, egg sacs in which more than 40% of eggs failed to form a germ band were discarded. Females that repeated such abnormal egg production three or more consecutive times were also discarded.

RT-PCR
Semi-quantitative RT-PCR was performed to compare the levels of gene expression at stage 9 (for At-sog dsRNA injected and non injected), or stage 5 (for At-dpp dsRNA injected and non injected) embryos. Total RNA was extracted from 30 eggs of each type using a MagExtractor RNA kit (Toyobo). The total RNA was treated with DNaseI (Stratagene), and a first-strand cDNA was prepared using an oligo(dT) primer and SuperScript II reverse transcriptase (Invitrogen). The cDNA was used as a template for PCR reactions. The PCR conditions were as follows: 20 or more cycles of 95°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute. The primer sets used are as follows: for At-sog in At-sog RNAi experiments, tacgaactggaggagaga and tgttccgtatgcctctgt; for At-sog in At-dpp RNAi experiments, aagtgcgatcgaatcacg and gttgccgtacctttctgt; for At-sim, taggaagccagaacctct and aggtcctaaggcacttgt; for At-dpp, ttgatcctacaaggaaaggc and gacttgattccacctatgagg; for histone H3, taccaagcaaacagctcg and gcttttcggctgcttgtaa; for EF1{alpha}, tggacacaagtgaaccac and tctgaccaggatggttca. The sequences for histone H3 and EF1{alpha} were designed according to data from our Achaearanea EST project (unpublished results).


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of sog homologues
We have cloned sog homologues from the spiders Achaearanea tepidariorum and Pholcus phalangioides, and the brine shrimp Artemia franciscana. The predicted amino acid sequences of these genes are comparable to those of Drosophila sog and vertebrate chordin through the entire length (Fig. 1). Four cysteine-rich domains, characteristic of Sog/chordin, are present at the expected positions in the spider and Artemia sequences. Therefore, the cloned genes were designated At-sog, Pp-sog and Af-sog, respectively.


Figure 1
View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1. The deduced amino acid sequences of At-sog, Pp-sog and Af-sog display high similarity to Drosophila Sog and vertebrate chordin. (A) HarrPlot analysis of the entire amino acid sequences of At-Sog and Drosophila Sog (Dm-Sog). The parameter `unit size to compare' was 8 and the parameter `dot plot scores' was 2. The four cysteine-rich domains characteristic of Sog/chordin (CRs 1-4) are indicated by black bars. (B) Amino acid sequence comparisons of At-Sog and the Sog/chordin protein of Pholcus (Pp), Artemia (Af), Anopheles (Ag), Drosophila (Dm) and Xenopus (Xl). Percentage identity and similarity (parentheses) were calculated for each of the CR1-4 domains and the region intervening between the CR1 and CR2 domains (INT) using the BLAST2 sequences tool. Accession numbers of the proteins used are as follows: Ag-Sog, EAA06317.3; Dm-Sog, AAA89117.1; Xl-chordin, AAC42222.

 
Radial-to-axial shift of At-sog expression
We examined expression patterns of At-sog transcripts by whole-mount in situ hybridization. At-sog transcripts were first detected at stage 5, when the cumulus shifts from the center to the rim of the germ disc (Akiyama-Oda and Oda, 2003Go). The signals appeared in the germ disc as a ring (Fig. 2A). This ring of At-sog expression was broken by the insertion of an At-sog-negative area (Fig. 2B), which corresponded to the presumptive extra-embryonic area as revealed by double staining for At-sog transcripts and pMad (Fig. 2J,J'). During stages 6 and 7, when the extra-embryonic area is expanded and the germ disc cells are dynamically rearranged, a large part of the embryonic area, excluding the forming caudal lobe and the periphery of the embryonic area, expressed At-sog (Fig. 2B-E). As the germ band formed and extended, the At-sog expression domain progressively narrowed (Fig. 2F). This narrowing At-sog expression domain was complementary to the pMad expression domain expanding from the dorsal side (Fig. 2K,L,L'). Eventually, the At-sog expression was confined to the ventral midline area (Fig. 2G). Sectioning revealed that At-sog staining was localized at the surface ectoderm, with no signal detectable in the mesodermal layer (Fig. 2H,I). Although the cells at the ventral midline area were morphologically indistinguishable from the neighboring ectoderm cells at this stage, this ventral midline area was characterized by specific expression of At-fork head (At-fkh) (Akiyama-Oda and Oda, 2003Go) and a sim homologue (At-sim) (Fig. 2M,N). The onset of At-fkh expression at the ventral midline area was at late stage 7, whereas the onset of At-sim expression was at stage 9. The expressions of At-sog, At-fkh, and At-sim were initially observed in nearly the same cell population (Fig. 2M,N). Later, however, different patterns of expression became evident (Fig. 3). This appeared to reflect the differentiation of several cell types within the ventral midline area.

The At-sog expression domain expanded anterior to the At-orthodenticle (At-otd) (Akiyama-Oda and Oda, 2003Go) expression domain (Fig. 2O,P). The At-sog expression domain also expanded posteriorly in accordance with the production of segments in the growing opisthosomal region (Fig. 2G,L), although the caudal lobe did not express At-sog. The axial pattern of At-sog expression in the germ-band stage embryo appeared to result from expansion of the expression along the emerging anterior-posterior (AP) axis and reduction of the expression along the emerging DV axis in accordance with dynamic cell rearrangements converting the germ disc to the germ band.

Similar to At-sog, Drosophila sog shows restricted expression at the ventral midline in the germ-band stage embryo (François et al., 1994Go). Similar ventral midline expression was also observed for Pp-sog (Fig. 2Q,R) and Af-sog (Fig. 2S,S'). The ventral midline expression of sog genes may be a conserved feature of the phylum Arthropoda.

Depletion of At-sog expression by RNA interference
To investigate the function of At-sog, we depleted At-sog expression from early spider embryos by parental RNA interference (pRNAi). Adult females were repeatedly injected with dsRNA corresponding to a 706-bp region (nt 334-1039) of At-sog cDNA, and their eggs were examined. In control experiments, dsRNA for gfp was used. Embryos derived from females injected with At-sog dsRNA, but not those from females injected with gfp dsRNA, showed abnormal development of limbs in the prosomal region (Fig. 4A-C). Time-lapse microscopy of live embryos and DNA staining of fixed embryos revealed that the abnormalities were due to lack of separation of extending limb buds in the individual segments (see Movie 1 in the supplementary material; Fig. 4A,B). The phenotypes of the abnormal embryos were classified as `severe' and `mild' based on the number of segments bearing unseparated limb buds (Fig. 4A,B,F-P; see Materials and methods). Such abnormal embryos were first found in the second or third round of egg laying after the first dsRNA injection (Fig. 4F-M). Whole-mount in situ hybridization revealed that, in the embryos exhibiting severe phenotypes, the level of At-sog mRNA was drastically reduced compared to the control embryos (Fig. 4D,E). A specific reduction in At-sog expression caused by pRNAi treatment was also confirmed by RT-PCR (Fig. 4Q). In addition, injection of dsRNA synthesized using another section of the At-sog cDNA (nt 1947-2987) also resulted in unseparated limbs (data not shown). The phenotypes obtained with injection of At-sog dsRNA were different from those obtained with injection of At-dpp dsRNA (see below), suggesting gene-specific effects. Taken together, these data suggest that pRNAi works in Achaearanea to deplete the expression of specific genes, as has been reported in other animal species (Fire et al., 1998Go; Bucher et al., 2002Go; Liu and Kaufman, 2003Go; Mito et al., 2005Go). Embryos in which At-sog expression was depleted by pRNAi, designated At-sog RNAi embryos hereafter, were further analyzed to understand the role of At-sog in the early development of the spider.


Figure 2
View larger version (91K):
[in this window]
[in a new window]
 
Fig. 2. Changes in the At-sog expression pattern. (A-F) At-sog expression is shown in embryos at mid-stage 5 (A) and stage 6 (B) viewed from the top of the germ disc, in an early stage 7 embryo viewed from the caudal (C) and lateral (D) sides, in a stage 7 embryo viewed from the lateral side (E), and in a stage 8 embryo viewed from the ventrolateral side (F). (A'-F') Schematic illustrations of the embryos shown in A-F. At-sog expression is shown in purple, yolk mass in yellow, the extra-embryonic area in orange, and the At-sog negative embryonic area in gray. Asterisks indicate the posterior of each embryo. Arrows in A and A' indicate the cumulus. Expansion of the extra-embryonic area and convergent extension of the embryonic area (D',E', arrows) transform the germ disc into the germ band. (G) A flat-mounted, stage 9 embryo stained for At-sog. (H,I) A transverse section of a stage 9 embryo stained for At-sog (H) and DNA (I). Arrowheads indicate limb buds, and brackets indicate the ventral midline area. (J) A flat-mounted, stage 5 germ disc stained for At-sog (purple) and pMad (brown). (J') High magnification of the region boxed in J. (K) Lateral view of a stage 7 embryo stained for pMad. The bracket indicates the extra-embryonic area, and the arrow indicates the boundary between the extra-embryonic and embryonic areas. (L) A flat-mounted, stage 8 embryo stained for At-sog (purple) and pMad (brown). (L') High magnification of the region boxed in L. (M,N) Flat-mounted, stage 9 embryos stained for At-sog (M, N, red) and At-fkh (M, purple) or At-sim (N, purple). (O,P) Stage 7 (O) and stage 8 (P) embryos stained for At-sog (red) and At-otd (purple). (Q,R,S,S') Expression of Pp-sog (Q,R) and Af-sog (S,S') transcripts. A ventral view of a Pholcus embryo at the germ band stage (Q). The tail part of a late-stage embryo (R). A ventral view of an Artemia nauplius (S). The region boxed in S is magnified in S'. a, anterior; p, posterior; d, dorsal; v, ventral; Ch, chelicerae; Pp, pedipalps; L1-L4, first to fourth walking legs. If not specified, anterior is to the top. Scale bars: 100 µm.

 
Loss of ventral structures in At-sog RNAi embryos
In At-sog RNAi embryos, the cumulus appeared and shifted, followed by the formation of the extra-embryonic area and the conversion of the germ disc to the germ band (Fig. 5A, compare with Fig. 7A). No apparent defects were found before or during these processes (see Movie 1 in the supplementary material). A marked difference between At-sog RNAi and untreated embryos was first detected in the pattern of pMad expression at the germ-band stage (Fig. 5B,C). In At-sog RNAi embryos, the embryonic area was overwhelmed by nuclear pMad. In older At-sog RNAi embryos exhibiting extremely severe phenotypes, the ventral midline expression of At-sim and At-fkh was almost entirely missing (Fig. 5D,F, not shown for At-fkh); only low levels of expression that were coincident with persistent At-sog RNA at the posterior terminal area were detected. The reduction of At-sim expression in stage 9 At-sog RNAi embryos was confirmed by RT-PCR (Fig. 4Q). In At-sog RNAi embryos exhibiting milder phenotypes, spots of At-sim and At-fkh expression were occasionally observed in the prosomal region (Fig. 5E arrow, not shown for At-fkh). These spots were always located between separated limb buds and coincided with persistent expression of At-sog.


Figure 3
View larger version (89K):
[in this window]
[in a new window]
 
Fig. 3. Expression of At-sog, At-fkh and At-sim transcripts in embryos at late stage 9 (A,C,E) and stage 10 (B,D,F). (A,B) Embryos stained for At-sog. At-sog expression at the ventral midline area is lost from the medial part (A), splitting into two lines (B). (C,D) Embryos double-stained for At-sog (red) and At-fkh (purple). At-fkh expression is detected at the most medial part, complementary to At-sog expression (C). The At-fkh expression is mostly lost at the ventral midline area, but starts in a pair of cell clusters in every hemisegment (D). Note that the clusters are included in the lines of At-sog. Arrows indicate the expression at the stomodeum. (E,F) Embryos double-stained for At-sog (red) and At-sim (purple). At-sim expression is observed at the most medial part, similar to At-fkh expression (E), then it fades, leaving a pattern different from those of At-sog and At-fkh (F). All embryos were flat-mounted. Anterior is to the top. Ch, chelicerae; Pp, pedipalps; L1 and L2, first and second walking legs. Scale bar: 100 µm.

 
In Achaearanea, the central nervous system (CNS) develops from the areas adjacent to the At-sog-expressing ventral midline area. RNA staining of late stage 9 embryos for a homologue of pros, designated At-pros, visualized the developing neural cells (Fig. 5G), which were distributed in a pattern similar to that described for another spider species, Cupiennius salei (Stollewerk et al., 2001Go; Weller and Tautz, 2003Go). The dorsal area of each limb-bearing hemisegment is subdivided into a limb and a non-limb section. One At-pros-positive cell cluster, tentatively called the dorsal-most cluster, was present at a regular position in each non-limb section (Fig. 5G arrows). In At-sog RNAi embryos exhibiting very severe phenotypes, the At-pros-positive neural cell clusters were mostly missing except for a few regularly aligned clusters located at similar AP positions to those of the dorsal-most clusters (Fig. 5G,I). In At-sog RNAi embryos exhibiting milder phenotypes, however, At-pros-positive cell clusters formed around the sites where At-sog was persistently expressed (Fig. 5H). These results suggest that the severe phenotypes caused by At-sog pRNAi were due to an almost complete loss of the ventral structures, including the ventral midline area and the CNS. The milder phenotypes generated by At-sog RNAi treatment imply that the ventral midline and the CNS form concomitantly by a mechanism requiring At-sog activity.

A homologue of omb, designated At-omb, was specifically expressed at the dorsal side of each limb bud that had started to extend (Fig. 5J), as described for Cupiennius omb (Prpic et al., 2003Go). In At-sog RNAi embryos exhibiting severe phenotypes, the domains of At-omb expression were fused to cover the entire width of the germ band (Fig. 5L). Similar alterations in the expression pattern were observed in the opisthosomal region (Fig. 5K,M). As shown previously, At-twist (At-twi) is expressed in mesodermal cell populations (Yamazaki et al., 2005Go). During stage 7, At-twi-expressing mesodermal cells become segmentally arranged in the prosoma. During later stages, additional stripes of At-twi-expressing cells appear in the opisthosoma. Each stripe of At-twi-expressing cells initially displays little unevenness along the predictable DV axis and then dorsally splits into two separate clusters at the sites of appendage formation (Fig. 5N,O), with At-twi-expressing cells becoming absent in the ventral areas. However, in At-sog RNAi embryos, in which the At-twi-expressing mesoderm developed normally until at least stage 7 (not shown), no dorsal separation of the mesodermal cells was observed in the prosoma or opisthosoma (Fig. 5P,Q). Taken together, these data indicated that the loss of the ventral structures caused by At-sog pRNAi appeared to result from gross dorsalization of the germ band.

Persistent radial symmetry in At-dpp RNAi embryos
Next, we conducted pRNAi experiments for At-dpp, which is initially expressed in the CM cells and later expressed in the dorsal region of the germ band where limb buds are formed (Akiyama-Oda and Oda, 2003Go). A specific reduction in At-dpp expression caused by the pRNAi treatment was confirmed by RT-PCR, although a very small amount of At-dpp transcripts was still detectable (Fig. 6I). In At-dpp RNAi embryos, the cumulus appeared and shifted normally (Fig. 6). However, the At-dpp RNAi embryos began to exhibit defects from the beginning of stage 6, when the extra-embryonic area starts to differentiate. DNA staining revealed that the extra-embryonic area, which can be easily recognized by the sparse distribution of nuclei (Fig. 7A), was reduced in size (Fig. 7B) or lost (Fig. 7C). The defective germ disc was extended longitudinally to envelop the entire yolk mass. Consequently, in severe cases, morphologically monotonous embryos were formed with little asymmetry (Fig. 6, Fig. 7C). Staining of such At-dpp RNAi embryos for a homologue of en, designated At-en, revealed rings of At-en expression instead of the two-ended bands of At-en expression observed in normal embryos (Fig. 7D-F). Similarly, a ring of expression was observed for At-otd in severely defective At-dpp RNAi embryos (Fig. 7G-I). These persistent circular patterns of gene expression probably reflected the loss of the extra-embryonic area. Striped expression of At-en (Fig. 7E) and anterior and posterior expression of At-otd and At-caudal (Akiyama-Oda and Oda, 2003Go), respectively, in At-dpp RNAi embryos (Fig. 7G-L) imply that At-dpp RNAi had little effect on AP patterning, although there were fewer At-en stripes than normal.

Furthermore, we examined At-sog expression in At-dpp RNAi embryos at different stages. RT-PCR showed that there was no detectable difference in the level of At-sog transcripts between untreated and At-dpp RNAi embryos at late stage 5 (Fig. 6I). Expression patterns of At-sog transcripts were observed in more than 29 late stage 5 embryos derived from the egg sac that was used for the RT-PCR experiment. It was found that all of the embryos showed more or less reduced asymmetry of the At-sog expression pattern (not shown), but none displayed complete symmetry, indicating that At-sog transcription was still affected by the shifting cumulus even in the At-dpp RNAi embryos. However, in severely defective At-dpp RNAi embryos at the later stages (stages 8 and 9) the entire surface ectoderm except for the posterior terminal area expressed At-sog transcripts at evenly high levels (Fig. 7M-O). Little asymmetry was recognized in the At-sog expression pattern. At-dpp RNAi embryos at the later stages were further examined for genes whose expression patterns reflect differences along the DV axis in the normal germ band. Staining for At-twi showed rings of At-twi-expressing mesodermal cells (Fig. 7P-R). No significant staining for At-pros, At-sim, or At-omb was obtained (Fig. 7S; not shown for At-sim and At-omb). In addition, the patterns of At-fkh expression, which varied among embryos, were radially symmetrical (not shown). Taken together, these data suggested that the At-dpp-depleted embryos were prevented from breaking the radial symmetry.


Figure 4
View larger version (73K):
[in this window]
[in a new window]
 
Fig. 4. Depletion of At-sog by dsRNA injection results in unseparated limb buds. (A-C) Flat preparations of DNA-stained stage 9 embryos derived from females injected with At-sog dsRNA (A,B) or gfp dsRNA (C). The limb bud defects were classified as severe (A) and mild (B) (see Materials and methods). (D,E) Comparison of At-sog expression by whole-mount in situ hybridization in stage 9 embryos derived from females injected with At-sog (D) or gfp (E) dsRNA. (F-P) Time course of phenotype expression in limb buds following dsRNA injection. Each graph refers to one female injected with At-sog (F-M) or gfp (N-P) dsRNA. Each vertical bar indicates the relative numbers of embryos exhibiting severe (red), mild (yellow), and normal (blue) phenotype in each egg sac. Unfertilized eggs or embryos exhibiting non-specific defects before germ band formation were not considered. The day when the first dsRNA injection was performed was defined as day 0. The numbers in parentheses indicate how many times dsRNA injection was performed. Asterisks indicate unhealthy egg sacs (see Materials and methods). Eggs from the egg sacs labeled D,E,Q in graphs F and N were used for the experiments shown in D,E,Q, respectively. (Q) RT-PCR comparison of the levels of At-sog, At-sim, ef1{alpha} and histone H3 transcripts in At-sog RNAi (sog Ri) and untreated (u.t.) embryos at stage 9. `+' and `-' indicate reactions with and without reverse transcriptase, respectively. Note that faint bands of At-sog and At-sim transcripts are visible in the `+' lanes of the At-sog RNAi sample. Ch, chelicerae; Pp, pedipalps; L1-L4, first to fourth walking legs; sog Ri, At-sog RNAi, gfp Ri, gfp RNAi. Scale bars: 100 µm.

 

    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Roles of spider Sog and Dpp in axis specification
In this study, we have molecularly dissected how the embryo of the spider Achaearanea tepidariorum establishes the axial symmetry during development (Fig. 8). Our data suggest that Dpp signaling is essential to specify the extra-embryonic area at the future dorsal side in the germ disc (Fig. 7), and that the subsequent antagonism of Dpp signaling by Sog appears to specify the ventral-most and flanking domains, which will become the ventral midline and the CNS (Fig. 5).

Depletion of At-dpp prevented the embryo from breaking the radial symmetry, therefore, the At-Dpp-mediated specification of the extra-embryonic area is crucial for radial-to-axial symmetry transformation of the spider embryo (Fig. 8, yellow). Despite the asymmetric patterns of At-sog expression from late stage 5 onward (Fig. 2), At-sog function appears not to be involved in the formation of the extra-embryonic area or the germ band (Fig. 5A). However, our data cannot exclude the possibility that the suppressed At-sog is sufficient to play a role in the early events. Since we failed to observe At-dpp RNAi embryos showing radially symmetrical At-sog expression at late stage 5, it remains unclear whether At-dpp is needed to make the initial At-sog expression asymmetric. The ubiquitous expression of At-sog transcripts at high levels in the later At-dpp RNAi embryo (Fig. 7N) suggested that At-sog transcription is negatively regulated by Dpp signaling. The gradual expansion of the pMad-positive area from the dorsal side (Fig. 2K,L) might be achieved by the combination of positive feedback loops of Dpp signaling, as proposed in Drosophila (Biehs et al., 1996Go), antagonism of Dpp signaling by Sog and progressive repression of At-sog transcription by the Dpp signals.


Figure 5
View larger version (102K):
[in this window]
[in a new window]
 
Fig. 5. The germ bands are dorsalized in sog RNAi embryos. (A) An At-sog RNAi embryo at stage 8 stained for DNA and At-otd transcripts. (B,C) Ventral views of untreated (B) and At-sog RNAi-treated (C) stage 8 embryos stained for pMad. (D-F) Flat preparations of untreated (D) and At-sog RNAi (E,F) stage 9 embryos stained for At-sog (red) and At-sim (purple). The arrow in E indicates the L1 segment, in which a patch of At-sog and At-sim expression intervenes between separated limb buds. (G-I) Flat preparations of untreated (G) and At-sog RNAi (H,I) late stage 9 embryos stained for At-sog (red) and At-pros (purple). Arrows in G indicate dorsal-most neural cell clusters. (J-Q) Prosomal (J,L,N,P) and opisthosomal (K,M,O,Q) regions of untreated (J,K,N,O) and At-sog RNAi (L,M,P,Q) stage 9 embryos stained for At-omb (J-M) or At-twi (N-Q) transcripts. a, anterior; p, posterior; Ch, chelicerae; Pp, pedipalps; L1-L4, first to fourth walking legs; sog Ri, At-sog RNAi. If not specified, anterior is to the top. Scale bars: 100 µm.

 
The patterning defects in the At-sog RNAi embryo were consistent with the At-sog expression being confined to the ventral midline area in the normal embryo (Figs 2, 5). One of the most intriguing issues in understanding the At-sog-mediated mechanism of ventral specification is how At-sog expression persists at the presumptive ventral midline area to trigger specific gene expression. In the mild At-sog RNAi phenotype, neural marker expression was observed around patches of persistent At-sog expression (Fig. 5H). This observation suggests that neural development depends on At-sog expression rather than position in the germ band.


Figure 6
View larger version (90K):
[in this window]
[in a new window]
 
Fig. 6. The At-dpp RNAi embryos exhibit defects in formation of the extra-embryonic area and germ band. (A-E,A'-E') Time course of a developing At-dpp RNAi embryo. (F-H,F'-H') Time course of a developing normal embryo. Images were taken at the time points indicated (day: hour: minute). For both embryos, time point 0:00:00 is adjusted to mid-stage 5, when the cumulus (arrows) is midway through shifting. The images in A-E, F-H show posterior views (or the top of the germ disc), and those in A',B',F'-H' show lateral views with the posterior to the bottom. The DV orientation of the embryo shown in C'-E' could not be determined, but the posterior side is to the bottom. Arrows in A,A',B,B',F,F' indicate the cumulus, and arrowheads in G,G',H indicate the expanding extra-embryonic area (ex) in the normal embryo. Since the cells at the extra-embryonic area are very thin, the yolk mass is seen through them. By contrast, the embryonic area or the germ band (gb) is seen as opaque (or white) material. Note that the extra-embryonic area is not formed in the At-dpp RNAi embryo (C-E,C'-E'). (I) RT-PCR comparison of the levels of At-dpp, At-sog, ef1{alpha} and histone H3 transcripts in At-dpp RNAi (dpp Ri) and untreated (u.t.) embryos at stage 5. `+' and `-' indicate reactions with and without reverse transcriptase, respectively. Note that a faint band of At-dpp transcripts is visible in the `+' lane of the At-dpp RNAi sample. Scale bar: 100 µm.

 
How is the AP axis specified in the Achaearanea embryo? In the germ disc, although its center is presumably determined to be the posterior pole, every point at its rim may have the potential to become the anterior pole (Akiyama-Oda and Oda, 2003Go). The germ-disc stage embryo has an axis that is probably equivalent to the animal-vegetal axis in other phyla, but does not yet have the AP axis specified. AP axis specification is considered to involve two processes; one is development (or refinement) of AP positional information, and the other is specification of the anterior pole. The former, which was little affected in At-dpp RNAi embryos (Fig. 7), probably does not depend on Dpp signals, but the latter does depend on Dpp signals. In the normal germ disc, an anterior pole is predicted to be the most distant point from the extra-embryonic area induced by Dpp signals (Akiyama-Oda and Oda, 2003Go). This rule may be extended to account for duplicated AP axes caused by grafting of the cumulus in Holm's experiments (Holm, 1952Go). In this experimental situation, two anterior poles are predictable at the halfway points along the germ disc rim between the native and ectopic extra-embryonic areas. The later At-dpp RNAi embryo had a recognizable anterior pole despite lacking the extra-embryonic area (Fig. 7C). However, this anterior pole simply resulted from symmetric longitudinal extension of the germ disc, the periphery of which converged at the pole of the yolk side. In addition, the longitudinal extension of the At-dpp RNAi germ disc implies that Dpp signaling may not be necessary to induce the dynamic cell rearrangements during germ band formation.

Comparison of axis specification between fly and spider
There are two major differences in the roles of Drosophila and Achaearanea Sog. First, fly Sog is necessary for specifying the extra-embryonic area (Ashe and Levine, 1999Go; Decotto and Ferguson, 2001Go) but spider Sog probably is not (Fig. 5A). Second, spider Sog (Fig. 5D-I) but not fly Sog (François et al., 1994Go) (see Fig. S1 in the supplementary material) is essential for specifying the ventral tissues that run axially through the germ band. These differences may reflect evolutionary changes in the gene regulatory networks.


Figure 7
View larger version (51K):
[in this window]
[in a new window]
 
Fig. 7. At-dpp RNAi embryos fail to break the radial symmetry. (A-C) DNA staining of untreated (A) and At-dpp RNAi (B,C) embryos at stage 8. All these embryos were also stained for At-otd transcripts. (D-R) Expression of At-en (D-F), At-otd (G-I), At-caudal (J-L), At-sog (M-O), and At-twi (P-R) transcripts in untreated (D,G,J,M,P) and At-dpp RNAi (E,F,H,I,K,L,N,O,Q,R) embryos at stage 9 (D-F,M-R) or stage 8 (G-L). D,G,J and P are lateral views and M is a ventral view; F,I,L,O,R are viewed from the directions indicated by arrows in E,H,K,N,Q. (S,S1,S2) Expression of At-pros transcripts in untreated (left in S) and At-dpp RNAi (right in S) late stage 9 embryos. The two boxed regions in S are magnified in S1 and S2. a, anterior; p, posterior; dpp Ri, At-dpp RNAi. Scale bars: 100 µm.

 
DV axis specification in the Drosophila embryo essentially relies on a nuclear gradient of the maternal transcription factor Dorsal, which simultaneously determines the differential expression domains of sog, dpp and many other genes (Roth et al., 1989Go; Ray et al., 1991Go; Stathopoulos and Levine, 2002Go; Stathopoulos and Levine, 2004Go). This fly system could have reduced the contribution of cell-cell interactions, explaining the relatively minor role of Drosophila Sog in ventral specification. However, the Dorsal gradient, which peaks at the ventral-most site, may have a lower resolution in the dorsal half than in the ventral half (Jiang and Levine, 1993Go). A Sog-mediated mechanism that sharpens the Dpp-activating domain at the dorsal-most region was recently proposed (Ashe, 2005Go; Shimmi et al., 2005Go; Wang and Ferguson, 2005Go). This mechanism might have been needed to compensate for the low resolution of the Dorsal gradient in this dorsal region.

In contrast to the Dorsal-based mechanism that organizes the DV axis in Drosophila, a mechanism controlling the direction of CM cell migration is important for initial DV polarity in Achaearanea, although its molecular basis remains unclear. As is evident from this study, the spider system appears to require a series of cell-cell interactions involving At-Dpp and At-Sog to initiate ventral-specific gene expression. These cell-cell interactions may well account for the regulative nature of body axis formation of spider embryos proposed by classical experiments (Holm, 1952Go; Sekiguchi, 1957Go; Seitz, 1970Go), although the mechanism of secondary axis induction in spiders remains to be studied. Based on the results obtained in the analyses of spider dpp and sog, we propose that one of the most fundamental differences in the mechanisms that pattern the early fly and spider embryos is ventral specification. This difference may reflect different degrees of contribution made by maternal determinants and zygotic cell-cell interactions.

In addition, the mesoderm originates from between two separate lines of presumptive ventral midline cells in the Drosophila embryo (Leptin, 2004Go). This situation is completely different from that of the Achaearanea mesoderm, which was suggested by At-twi expression patterns at stages 5 and 6 to have radially symmetrical origins at the peripheral and central areas of the germ disc (Yamazaki et al., 2005Go). In spider development, independent gene regulatory networks appear to specify the DV pattern and the mesoderm.

Comparison of axis specification between vertebrates and spider
Our discovery of the differences between the fly and spider provide an opportunity to rethink how arthropod embryos can be compared with vertebrate embryos from the viewpoint of developmental evolution. Interestingly, the spider situation in which sog activity is essential to specify the ventral domains is similar to the vertebrate situation in which the antagonism of Dpp/BMP signaling plays a central role in dorsal specification (De Robertis et al., 2000Go; Oelgeschläger et al., 2003Go; Khokha et al., 2005Go). The ventral midline area in the spider embryo is comparable to the presumptive notochord area in the vertebrate embryo in that both areas are the centers of the Dpp/BMP antagonism and adjoin the CNS. In addition, the axial expression of At-fkh and At-sim (Fig. 2M,N) is reminiscent of the expression of their homologues in chordate notochords (Ruiz i Altaba et al., 1993Go; Sasaki and Hogan, 1993Go; Strähle et al., 1993Go; Shimauchi et al., 1997Go; Shimeld, 1997Go; Terazawa and Satoh, 1997Go; Mazet and Shimeld, 2002Go). Whether the spider ventral midline is homologous to the vertebrate notochord is the emerging question. To satisfactorily answer this question, we will need to consider the reason why the arthropod ventral midline is ectodermal and the vertebrate notochord is mesodermal. The milder phenotypes of At-sog RNAi embryos (Fig. 5E,H) appeared to reflect concomitant development of the ventral midline and the CNS. It is intriguing to investigate similarities and differences in the mechanisms of neural induction in the spider and vertebrate embryos. Finally, the Achaearanea experimental system could contribute to a better understanding of the evolutionary relationships between the development of arthropod and vertebrate embryos.


Figure 8
View larger version (27K):
[in this window]
[in a new window]
 
Fig. 8. Schematic representation summarizing developmental events in the normal Achaearanea embryo and primary defects in the At-dpp and At-sog RNAi embryos. The state of the embryo symmetry is shown at the top. Time (hours; h) after egg laying at 25°C and the stages of development are also shown. Each developmental event takes place during the period indicated by the solid bar (faded areas indicate uncertain start or end points). In illustrations for the respective stages, the yolk area, the embryonic area, the extra-embryonic area and the limb buds are outlined. Stages 6 and 8 are shown in yellow and blue, respectively, when primary defects were observed in At-dpp RNAi and At-sog RNAi embryos (see the insides of the boxes). a, anterior; p, posterior; d, dorsal; v, ventral.

 

    ACKNOWLEDGMENTS
 
We thank T. Tabata for the PS1 antibody, E. Bier for the Drosophila sog and sim cDNA clones, A. Stollewerk and D. Tautz for the anti-Cupiennius Pros antibody, F. Matsuzaki for the MR1A antibody, T. Niimi for instruction on dsRNA preparation, the Drosophila Bloomington stock center for the sog mutant line, and K. Agata and H. Tarui for sharing Achaearanea EST data before publication. We are grateful to M. Irie, M. Okubo, S. Okajima and A. Noda for technical assistance. We also thank G. Eguchi and members of the PRESTO research group of `Recognition and Formation' for helpful discussion, and Sh. Tsukita and K. Nakamura for support.


    Footnotes
 
Supplementary material

Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/12/2347/DC1


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Akiyama-Oda, Y. and Oda, H. (2003). Early patterning of the spider embryo: a cluster of mesenchymal cells at the cumulus produces Dpp signals received by germ disc epithelial cells. Development 130,1735 -1747.[Abstract/Free Full Text]
Ashe, H. L. (2005). BMP signalling: synergy and feedback create a step gradient. Curr. Biol. 15,R375 -R377.[CrossRef][Medline]
Ashe, H. L. and Levine, M. (1999). Local inhibition and long-range enhancement of Dpp signal transduction by Sog. Nature 398,427 -431.[CrossRef][Medline]
Biehs, B., Fraçois, V. and Bier, E. (1996). The Drosophila short gastrulation gene prevents Dpp from autoactivating and suppressing neurogenesis in the neuroectoderm. Genes Dev. 10,2922 -2934.[Abstract/Free Full Text]
Bier, E. (1997). Anti-neural-inhibition: a conserved mechanism for neural induction. Cell 89,681 -684.[CrossRef][Medline]
Bucher, G., Scholten, J. and Klingler, M. (2002). Parental RNAi in Tribolium (Coleoptera). Curr. Biol. 12,R85 -R86.[CrossRef][Medline]
Damen, W. G. M., Hausdorf, M., Seyfarth, E.-A. and Tautz, D. (1998). A conserved mode of head segmentation in arthropods revealed by the expression pattern of Hox genes in a spider. Proc. Natl. Acad. Sci. USA 95,10665 -10670.[Abstract/Free Full Text]
Darras, S. and Nishida, H. (2001). The BMP/CHORDIN antagonism controls sensory pigment cell specification and differentiation in the ascidian embryo. Dev. Biol. 236,271 -288.[CrossRef][Medline]
De Robertis, E. M. and Sasai, Y. (1996). A common plan for dorsoventral patterning in Bilateria. Nature 380,37 -40.[CrossRef][Medline]
De Robertis, E. M., Larraín, J., Oelgeschläger, M. and Wessely, O. (2000). The establishment of Spemann's organizer and patterning of the vertebrate embryo. Nat. Rev. Genet. 1,171 -181.[CrossRef][Medline]
Decotto, E. and Ferguson, E. L. (2001). A positive role for Short gastrulation in modulating BMP signaling during dorsoventral patterning in the Drosophila embryo. Development 128,3831 -3841.[Abstract/Free Full Text]
Fainsod, A., Deißler, K., Yelin, R., Marom, K., Epstein, M., Pillemer, G., Steinbeisser, H. and Blum, M. (1997). The dorsalizing and neural inducing gene follistatin is an antagonist of BMP-4. Mech. Dev. 63,39 -50.[CrossRef][Medline]
Ferguson, E. L. (1996). Conservation of dorsal-ventral patterning in arthropods and chordates. Curr. Opin. Genet. Dev. 6,424 -431.[CrossRef][Medline]
Ferguson, E. L. and Anderson, K. V. (1992a). decapentaplegic acts as a morphogen to organize dorsal-ventral pattern in the Drosophila embryo. Cell 71,451 -461.[CrossRef][Medline]
Ferguson, E. L. and Anderson, K. V. (1992b). Localized enhancement and repression of the activity of the TGF-ß family member, decapentaplegic, is necessary for dorsal-ventral pattern formation in the Drosophila embryo. Development 114,583 -597.[Abstract]
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.Nature 391,806 -811.[CrossRef][Medline]
François, V., Solloway, M., O'Neill, J. W., Emery, J. and Bier, E. (1994). Dorsal-ventral patterning of the Drosophila embryo depends on a putative negative growth factor encoded by the short gastrulation gene. Genes Dev. 8,2602 -2616.[Abstract/Free Full Text]
Friedrich, M. and Tautz, D. (1995). Ribosomal DNA phylogeny of the major extant arthropod classes and the evolution of myriapods. Nature 376,165 -167.[CrossRef][Medline]
Gerhart, J. (2004). Symmetry breaking in the egg of Xenopus laevis. In Gastrulation: From Cells to Embryo (ed. C. D. Stern), pp. 341-351. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Giribet, G., Edgecombe, G. D. and Wheeler, W. C. (2001). Arthropod phylogeny based on eight molecular loci and morphology. Nature 413,157 -161.[CrossRef][Medline]
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol. 13,611 -667.[CrossRef][Medline]
Hemmati-Brivanlou, A., Kelly, O. G. and Melton, D. A. (1994). Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell 77,283 -295.[CrossRef][Medline]
Holley, S. A. and Ferguson, E. L. (1997). Fish are like flies are like frogs: conservation of dorsal-ventral patterning mechanisms. BioEssays 19,281 -284.[CrossRef][Medline]
Holley, S. A., Jackson, P. D., Sasai, Y., Lu, B., De Robertis, E. M., Hoffman, F. M. and Ferguson, E. L. (1995). A conserved system for dorsal-ventral patterning in insects and vertebrates involving sog and chordin. Nature 376,249 -253.[CrossRef][Medline]
Holm, Å. (1952). Experimentelle untersuchungen über die entwicklung und entwicklungsphysiologie des spinnenembryos. Zool. Bidr. Uppsala 29,293 -424.
Hwang, U. W., Friedrich, M., Tautz, D., Park, C. J. and Kim, W. (2001). Mitochondrial protein phylogeny joins myriapods with chelicerates. Nature 413,154 -157.[CrossRef][Medline]
Irish, V. F. and Gelbart, W. M. (1987). The decapentaplegic gene is required for dorsal-ventral patterning of the Drosophila embryo. Genes Dev. 1, 868-879.[Abstract/Free Full Text]
Itow, T., Kenmochi, S. and Mochizuki, T. (1991). Induction of secondary embryos by intra- and interspecific grafts of center cells under the blastopore in horseshoe crabs. Dev. Growth Differ. 33,251 -258.[Medline]
Jiang, J. and Levine, M. (1993). Binding affinities and cooperative interactions with bHLH activators delimit threshold responses to the dorsal gradient morphogen. Cell 72,741 -752.[CrossRef][Medline]
Khokha, M. K., Yeh, J., Grammer, T. C. and Harland, R. M. (2005). Depletion of three BMP antagonists from Spemann's organizer leads to a catastrophic loss of dorsal structures. Dev. Cell 8,401 -411.[CrossRef][Medline]
Kimelman, D. and Bjornson, C. (2004). Vertebrate mesoderm induction. In Gastrulation: From Cells to Embryo (ed. C. D. Stern), pp. 363-372. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Lamb, T. M., Knecht, A. K., Smith, W. C., Stachel, S. E., Economides, A. N., Stahl, N., Yancopolous, G. D. and Harland, R. M. (1993). Neural induction by the secreted polypeptide noggin. Science 262,713 -718.[Abstract/Free Full Text]
Lehmann, R. and Tautz, D. (1994). In situ hybridization to RNA. In Drosophila melanogaster: Practical Uses in Cell and Molecular Biology (ed. L. S. B. Goldstein and E. A. Fyrberg), pp. 575-598. San Diego: Academic Press.
Leptin, M. (2004). Gastrulation in Drosophila. In Gastrulation: From Cells to Embryo (ed. C. D. Stern), pp. 91-104. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Liu, P. Z. and Kaufman, T. C. (2003). hunchback is required for suppression of abdominal identity, and for proper germband growth and segmentation in the intermediate germband insect Oncopeltus fasciatus. Development 131,1515 -1527.
Mazet, F. and Shimeld, S. M. (2002). The evolution of chordate neural segmentation. Dev. Biol. 251,258 -270.[CrossRef][Medline]
Mito, T., Sarashina, I., Zhang, H., Iwahashi, A., Okamoto, H., Miyawaki, K., Shinmyo, Y., Ohuchi, H. and Noji, S. (2005). Non-canonical functions of hunchback in segment patterning of the intermediate germ cricket Gryllus bimaculatus.Development 132,2069 -2079.[Abstract/Free Full Text]
Niimi, T., Kuwayama, H. and Yaginuma, T. (2005). Larval RNAi applied to the analysis of postembryonic development in the ladybird beetle, Harmonia axyridis. J. Insect Biotechnol. Sericology 74,95 -102.
Oda, H., Tagawa, K. and Akiyama-Oda, Y. (2005). Diversification of epithelial adherens junctions with independent reductive changes in cadherin form: identification of potential molecular synapomorphies among bilaterians. Evol. Dev. 7, 376-389.[CrossRef][Medline]
Oelgeschläger, M., Kuroda, H., Reversade, B. and De Robertis, E. M. (2003). Chordin is required for the Spemann organizer transplantation phenomenon in Xenopus embryos. Dev. Cell 4,219 -230.[CrossRef][Medline]
Padgett, R. W., St. Johnston, R. D. and Gelbart, W. M. (1987). A transcript from a Drosophila pattern gene predicts a protein homologous to the transforming growth factor-ß family. Nature 325,81 -84.[CrossRef][Medline]
Persson, U., Izumi, H., Souchelnytskyi, S., Itoh, S., Grimsby, S., Engström, U., Heldin, C.-H., Funa, K. and ten Dijke, P. (1998). The L45 loop in type I receptors for TGF-ß family members is a critical determinant in specifying Smad isoform activation. FEBS Lett. 434,83 -87.[CrossRef][Medline]
Piccolo, S., Sasai, Y., Lu, B. and De Robertis, E. M. (1996). Dorsoventral patterning in Xenopus: inhibition of ventral signals by direct binding of Chordin to BMP-4. Cell 86,589 -598.[CrossRef][Medline]
Prpic, N.-M., Janssen, R., Wigand, B., Klingler, M. and Damen, W. G. M. (2003). Gene expression in spider appendages reveals reversal of exd/hth spatial specificity, altered leg gap gene dynamics, and suggests divergent distal morphogen signaling. Dev. Biol. 264,119 -140.[CrossRef][Medline]
Ray, R. P., Arora, K., Nüsslein-Volhard, C. and Gelbart, W. M. (1991). The control of cell fate along the dorsal-ventral axis of the Drosophila embryo. Development 113, 35-54.[Abstract]
Roth, S., Stein, D. and Nüsslein-Volhard, C. (1989). A gradient of nuclear localization of the dorsal protein determines dorsoventral pattern in the Drosophila embryo. Cell 59,1189 -1202.[CrossRef][Medline]
Ruiz i Altaba, A., Prezioso, V. R., Darnell, J. E. and Jessell, T. M. (1993). Sequential expression of HNF-3ß and HNF-3{alpha} by embryonic organizing centers: the dorsal lip/node, notochord and floor plate. Mech. Dev. 44, 91-108.[CrossRef][Medline]
Sander, K. (1976). Specification of the basic body pattern in insect embryogenesis. Adv. Insect Physiol. 12,125 -238.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79,779 -790.[CrossRef][Medline]
Sasaki, H. and Hogan, B. L. M. (1993). Differential expression of multiple fork head related genes during gastrulation and axial pattern formation in the mouse embryo. Development 118,47 -59.[Abstract]
Seitz, K.-A. (1970). Embryonale defekt- und doppelbildungen im ei der spinne Cupiennius Salei (Ctenidae). Zool. Jb. Anat. 87,588 -639.
Sekiguchi, K. (1957). Reduplication in spider eggs produced by centrifugation. Sci. Rep. Tokyo Kyoiku Daigaku Sec. B 8,227 -280.
Shimauchi, Y., Yasuo, H. and Satoh, N. (1997). Autonomy of ascidian fork head/HNF-3 gene expression. Mech. Dev. 69,143 -154.[CrossRef][Medline]
Shimeld, S. M. (1997). Characterization of Amphioxus HNF-3 genes: conserved expression in the notochord and floor plate. Dev. Biol. 183,74 -85.[CrossRef][Medline]
Shimmi, O., Umulis, D., Othmar, H. and O'Connor, M. B. (2005). Facilitated transport of a Dpp/Scw heterodimer by Sog/Tsg leads to robust patterning of the Drosophila blastoderm embryo. Cell 120,873 -886.[CrossRef][Medline]
Spemann, H. and Mangold, H. (1924). Über induktion von embryonalanlagen durch Implantation artfremder organisatoren. Wilhelm Roux Arch. Entw. Mech. Org. 100,599 -638.
Stathopoulos, A. and Levine, M. (2002). Dorsal gradient networks in the Drosophila embryo. Dev. Biol. 246,57 -67.[CrossRef][Medline]
Stathopoulos, A. and Levin, M. (2004). Whole-genome analysis of Drosophila gastrulation. Curr. Opin. Genet. Dev. 14,477 -484.[CrossRef][Medline]
Stollewerk, A., Weller, M. and Tautz, D. (2001). Neurogenesis in the spider Cupiennius salei.Development 128,2673 -2688.[Medline]
Strähle, U., Blader, P., Henrique, D. and Ingham, P. W. (1993). Axial, a zebrafish gene expressed along the developing body axis, show altered expression in cyclops mutant embryos. Genes Dev. 7,1436 -1446.[Abstract/Free Full Text]
Terazawa, K. and Satoh, N. (1997). Formation of the chordamesoderm in the amphioxus embryo: analysis with Brachyury and fork head/HNF-3 gene. Dev. Genes Evol. 207, 1-11.[CrossRef]
Wang, Y.-C. and Ferguson, E. L. (2005). Spatial bistability of Dpp-receptor interactions during Drosophila dorsal-ventral patterning. Nature 434,229 -234.[CrossRef][Medline]
Weller, M. and Tautz, D. (2003). Prospero and Snail expression during spider neurogenesis. Dev. Genes Evol. 213,554 -566.[CrossRef][Medline]
Yamazaki, K., Akiyama-Oda, Y. and Oda, H. (2005). Expression patterns of a twist-related gene in embryos of the spider Achaearanea tepidariorum reveal divergent aspects of mesoderm development in the fly and spider. Zool. Sci. 22,177 -185.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related articles in Development:

Spinning a developmental story

Development 2006 133: e1204. [Full Text]  

Spinning a developmental story

Development 2006 133: e1204. [Full Text]  



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Pechmann, A. P. McGregor, E. E. Schwager, N. M. Feitosa, and W. G. M. Damen
From the Cover: Dynamic gene expression is required for anterior regionalization in a spider
PNAS, February 3, 2009; 106(5): 1468 - 1472.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Oda, O. Nishimura, Y. Hirao, H. Tarui, K. Agata, and Y. Akiyama-Oda
Progressive activation of Delta-Notch signaling from around the blastopore is required to set up a functional caudal lobe in the spider Achaearanea tepidariorum
Development, June 15, 2007; 134(12): 2195 - 2205.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. v. d. Zee, O. Stockhammer, C. v. Levetzow, R. N. d. Fonseca, and S. Roth
Sog/Chordin is required for ventral-to-dorsal Dpp/BMP transport and head formation in a short germ insect
PNAS, October 31, 2006; 103(44): 16307 - 16312.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Akiyama-Oda, Y.
Right arrow Articles by Oda, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Akiyama-Oda, Y.
Right arrow Articles by Oda, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?