|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online May 23, 2006
doi: 10.1242/10.1242/dev.02400
1 JT Biohistory Research Hall, 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125,
Japan.
2 PRESTO, Japan Science and Technology Agency, Saitama, Japan.
* Authors for correspondence (e-mail: yasuko{at}brh.co.jp and hoda{at}brh.co.jp)
Accepted 10 April 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Spider, Embryogenesis, dpp, sog, Antagonist, Body axis formation, RNAi
| INTRODUCTION |
|---|
|
|
|---|
In the fruit fly Drosophila melanogaster, a homologue of
vertebrate BMP2/4, Decapentaplegic (Dpp), and a homologue of chordin, Short
gastrulation (Sog), have also been shown to function antagonistically in
dorsoventral (DV) pattern formation of the embryo
(Irish and Gelbart, 1987
;
Padgett et al., 1987
;
Ferguson and Anderson, 1992a
;
Ferguson and Anderson, 1992b
;
François et al., 1994
).
Sog is the only Dpp antagonist that is known to function in the early
Drosophila embryo, and two different roles for the molecule have been
identified. The first role is to prevent the Dpp signal from invading the
neuroectoderm that forms at the ventrolateral region
(François et al., 1994
;
Biehs et al., 1996
). The second
role is to contribute to the formation of a sharp stripe of Dpp signaling
activation at the dorsal-most region that will become the extra-embryonic
amnioserosa (Ashe and Levine,
1999
; Decotto and Ferguson,
2001
). Although the latter role is considered to be unique to the
fly, the former role is markedly similar to that of BMP antagonists in the
development of vertebrate dorsal structures. This similarity has raised the
hypothesis that the orientation of the Drosophila DV axis is opposite
to that of the vertebrate DV axis, assuming that these axes had a common
origin (Holley et al., 1995
;
De Robertis and Sasai, 1996
;
Ferguson, 1996
;
Holley and Ferguson, 1997
;
Bier, 1997
). Despite the
fascinating implications this would have for DV axis evolution, however, the
null mutation for Drosophila sog only slightly reduces the
neuroectoderm and barely affects the differentiation of the ventral midline
(Fig. S1 in supplementary material)
(François et al., 1994
)
not validating the potential importance of Dpp/BMP antagonism in DV axis
specification in the common ancestor of Drosophila and vertebrates.
The only organism other than Drosophila and vertebrates in which a
Dpp/BMP antagonist has been studied is the ascidian, in which function of the
antagonist has not been related to DV axis development or neural induction
(Darras and Nishida, 2001
).
In the phylum Arthropoda, twinned embryos can be produced spontaneously
(see Fig. S2 in the supplementary material) or experimentally in spiders,
horseshoe crabs and short-germ insects
(Holm, 1952
;
Sekiguchi, 1957
;
Seitz, 1970
;
Sander, 1976
;
Itow et al., 1991
). These may
indicate the existence of different modes of axis specification from that of
Drosophila. A study of the Dpp-Sog system within Arthropoda would
contribute to a better understanding of DV axis evolution. Spiders and
horseshoe crabs are chelicerate arthropods that are phylogenetically distant
from the insect Drosophila
(Friedrich and Tautz, 1995
;
Hwang et al., 2001
;
Giribet et al., 2001
). In
early development of spiders, such as Achaearanea tepidariorum, the
future DV axis becomes predictable by the onset of directional movement of a
cellular thickening called the cumulus, which is formed at the center of the
radially symmetrical germ disc and then shifts centrifugally to the rim
(Akiyama-Oda and Oda, 2003
).
Graft experiments using Agelena labyrinthica showed that the cumulus
has the ability to induce a secondary body axis
(Holm, 1952
). The shift of the
cumulus is followed by formation of the extra-embryonic area and
rearrangements of the germ disc cells. These morphogenetic events transform
the germ disc into the bilaterally symmetrical germ band. Our previous study
showed that, in the spider Achaearanea tepidariorum, a cluster of the
mesenchymal cells at the cumulus (CM cells) is the source of Dpp signals
(Akiyama-Oda and Oda, 2003
). In
this study, we investigated the roles of dpp and sog in DV
axis development of the Achaearanea embryo.
| MATERIALS AND METHODS |
|---|
|
|
|---|
cDNA cloning
We cloned Achaearanea sog (At-sog), Pholcus sog
(Pp-sog), Artemia sog (Af-sog), and the
Achaearanea genes single minded (At-sim),
prospero (At-pros), engrailed (At-en) and
optomotor blind (At-omb). Details of cDNA cloning are
presented in Table 1. The
sequences are available from the DNA Data Bank of Japan with the following
accession numbers: At-sog, AB236147; Pp-sog, AB236148;
Af-sog, AB236149; At-sim, AB236150; At-pros,
AB236151; At-en, BAD01489; At-omb, AB177876. To characterize
the deduced amino acid sequences of the cloned genes, BLASTP, BLAST 2
sequences
(http://www.ncbi.nlm.nih.gov/blast/),
PHYLIP version 3.5 and HarrPlot 2.0 (GENETYX Mac version 12) were used. BLASTP
search analyses revealed that the sequences of At-Pros and At-En are very
close to those of Cs-Pros (Weller and
Tautz, 2003
) and Cs-En (Damen
et al., 1998
), respectively, which were previously reported in
another spider species Cupiennius salei. Molecular phylogenetic trees
were constructed for At-Sim and At-Omb (see Fig. S3 in the supplementary
material).
|
Double-stranded RNA preparation
Double-stranded RNAs (dsRNAs) for the 706-bp [nucleotide (nt) 334-1039] and
1041-bp (nt 1947-2987) regions of the At-sog cDNA, the 736-bp (nt
1005-1740) region of At-dpp
(Akiyama-Oda and Oda, 2003
),
and the coding region of the gene for jellyfish green fluorescent protein
(gfp) (Quantum) were prepared according to Niimi et al.
(Niimi et al., 2005
), except
that the dsRNAs were denatured at 95°C for 5 minutes, and annealed. The
dsRNAs were used at concentrations of 1.5 to 2.5 µg/µl.
dsRNA injection to the spider Achaearanea tepidariorum
Mature spider females, either virgins or postmated, were used for dsRNA
injection. Under a stereomicroscope, 1-2 µl of dsRNA solution was
introduced into the opisthosoma of each female from the dorsal side using a
pulled glass capillary whose tip was broken with forceps. This injection
process was repeated two to six times at intervals of 2-3 days. The virgin
females were mated after the second cycle of injection. However, the timing of
mating essentially did not affect the final results. Egg sacs made by the
injected females were each analyzed separately. Some eggs from every egg sac
were submerged in halocarbon oil 700 (Sigma) to examine the development of the
embryo. To evaluate the effects of At-sog dsRNA injection, the
numbers of segments bearing unseparated limb buds at stage 9 (a normal spider
embryo has six pairs of limb buds) were counted after dechorionation with
commercial bleach. Embryos with four to six unseparated limb buds were
classified as having the severe phenotype, and those with one to three
unseparated limb bud(s) as having the mild phenotype. Achaearanea
embryos show spontaneous developmental errors at frequencies depending on
individuals or egg sacs. To minimize non-specific effects, egg sacs in which
more than 40% of eggs failed to form a germ band were discarded. Females that
repeated such abnormal egg production three or more consecutive times were
also discarded.
RT-PCR
Semi-quantitative RT-PCR was performed to compare the levels of gene
expression at stage 9 (for At-sog dsRNA injected and non injected),
or stage 5 (for At-dpp dsRNA injected and non injected) embryos.
Total RNA was extracted from 30 eggs of each type using a MagExtractor RNA kit
(Toyobo). The total RNA was treated with DNaseI (Stratagene), and a
first-strand cDNA was prepared using an oligo(dT) primer and SuperScript II
reverse transcriptase (Invitrogen). The cDNA was used as a template for PCR
reactions. The PCR conditions were as follows: 20 or more cycles of 95°C
for 1 minute, 55°C for 1 minute, and 72°C for 1 minute. The primer
sets used are as follows: for At-sog in At-sog RNAi
experiments, tacgaactggaggagaga and tgttccgtatgcctctgt; for At-sog in
At-dpp RNAi experiments, aagtgcgatcgaatcacg and gttgccgtacctttctgt;
for At-sim, taggaagccagaacctct and aggtcctaaggcacttgt; for
At-dpp, ttgatcctacaaggaaaggc and gacttgattccacctatgagg; for
histone H3, taccaagcaaacagctcg and gcttttcggctgcttgtaa; for
EF1
, tggacacaagtgaaccac and tctgaccaggatggttca. The sequences
for histone H3 and EF1
were designed according to
data from our Achaearanea EST project (unpublished results).
| RESULTS |
|---|
|
|
|---|
|
The At-sog expression domain expanded anterior to the
At-orthodenticle (At-otd)
(Akiyama-Oda and Oda, 2003
)
expression domain (Fig. 2O,P).
The At-sog expression domain also expanded posteriorly in accordance
with the production of segments in the growing opisthosomal region
(Fig. 2G,L), although the
caudal lobe did not express At-sog. The axial pattern of
At-sog expression in the germ-band stage embryo appeared to result
from expansion of the expression along the emerging anterior-posterior (AP)
axis and reduction of the expression along the emerging DV axis in accordance
with dynamic cell rearrangements converting the germ disc to the germ
band.
Similar to At-sog, Drosophila sog shows restricted expression at
the ventral midline in the germ-band stage embryo
(François et al.,
1994
). Similar ventral midline expression was also observed for
Pp-sog (Fig. 2Q,R) and
Af-sog (Fig.
2S,S'). The ventral midline expression of sog genes
may be a conserved feature of the phylum Arthropoda.
Depletion of At-sog expression by RNA interference
To investigate the function of At-sog, we depleted At-sog
expression from early spider embryos by parental RNA interference (pRNAi).
Adult females were repeatedly injected with dsRNA corresponding to a 706-bp
region (nt 334-1039) of At-sog cDNA, and their eggs were examined. In
control experiments, dsRNA for gfp was used. Embryos derived from
females injected with At-sog dsRNA, but not those from females
injected with gfp dsRNA, showed abnormal development of limbs in the
prosomal region (Fig. 4A-C).
Time-lapse microscopy of live embryos and DNA staining of fixed embryos
revealed that the abnormalities were due to lack of separation of extending
limb buds in the individual segments (see Movie 1 in the supplementary
material; Fig. 4A,B). The
phenotypes of the abnormal embryos were classified as `severe' and `mild'
based on the number of segments bearing unseparated limb buds
(Fig. 4A,B,F-P; see Materials
and methods). Such abnormal embryos were first found in the second or third
round of egg laying after the first dsRNA injection
(Fig. 4F-M). Whole-mount in
situ hybridization revealed that, in the embryos exhibiting severe phenotypes,
the level of At-sog mRNA was drastically reduced compared to the
control embryos (Fig. 4D,E). A
specific reduction in At-sog expression caused by pRNAi treatment was
also confirmed by RT-PCR (Fig.
4Q). In addition, injection of dsRNA synthesized using another
section of the At-sog cDNA (nt 1947-2987) also resulted in
unseparated limbs (data not shown). The phenotypes obtained with injection of
At-sog dsRNA were different from those obtained with injection of
At-dpp dsRNA (see below), suggesting gene-specific effects. Taken
together, these data suggest that pRNAi works in Achaearanea to
deplete the expression of specific genes, as has been reported in other animal
species (Fire et al., 1998
;
Bucher et al., 2002
;
Liu and Kaufman, 2003
;
Mito et al., 2005
). Embryos in
which At-sog expression was depleted by pRNAi, designated
At-sog RNAi embryos hereafter, were further analyzed to understand
the role of At-sog in the early development of the spider.
|
|
A homologue of omb, designated At-omb, was specifically
expressed at the dorsal side of each limb bud that had started to extend
(Fig. 5J), as described for
Cupiennius omb (Prpic et al.,
2003
). In At-sog RNAi embryos exhibiting severe
phenotypes, the domains of At-omb expression were fused to cover the
entire width of the germ band (Fig.
5L). Similar alterations in the expression pattern were observed
in the opisthosomal region (Fig.
5K,M). As shown previously, At-twist (At-twi) is
expressed in mesodermal cell populations
(Yamazaki et al., 2005
).
During stage 7, At-twi-expressing mesodermal cells become segmentally
arranged in the prosoma. During later stages, additional stripes of
At-twi-expressing cells appear in the opisthosoma. Each stripe of
At-twi-expressing cells initially displays little unevenness along
the predictable DV axis and then dorsally splits into two separate clusters at
the sites of appendage formation (Fig.
5N,O), with At-twi-expressing cells becoming absent in
the ventral areas. However, in At-sog RNAi embryos, in which the
At-twi-expressing mesoderm developed normally until at least stage 7
(not shown), no dorsal separation of the mesodermal cells was observed in the
prosoma or opisthosoma (Fig.
5P,Q). Taken together, these data indicated that the loss of the
ventral structures caused by At-sog pRNAi appeared to result from
gross dorsalization of the germ band.
Persistent radial symmetry in At-dpp RNAi embryos
Next, we conducted pRNAi experiments for At-dpp, which is
initially expressed in the CM cells and later expressed in the dorsal region
of the germ band where limb buds are formed
(Akiyama-Oda and Oda, 2003
). A
specific reduction in At-dpp expression caused by the pRNAi treatment
was confirmed by RT-PCR, although a very small amount of At-dpp
transcripts was still detectable (Fig.
6I). In At-dpp RNAi embryos, the cumulus appeared and
shifted normally (Fig. 6).
However, the At-dpp RNAi embryos began to exhibit defects from the
beginning of stage 6, when the extra-embryonic area starts to differentiate.
DNA staining revealed that the extra-embryonic area, which can be easily
recognized by the sparse distribution of nuclei
(Fig. 7A), was reduced in size
(Fig. 7B) or lost
(Fig. 7C). The defective germ
disc was extended longitudinally to envelop the entire yolk mass.
Consequently, in severe cases, morphologically monotonous embryos were formed
with little asymmetry (Fig. 6,
Fig. 7C). Staining of such
At-dpp RNAi embryos for a homologue of en, designated
At-en, revealed rings of At-en expression instead of the
two-ended bands of At-en expression observed in normal embryos
(Fig. 7D-F). Similarly, a ring
of expression was observed for At-otd in severely defective
At-dpp RNAi embryos (Fig.
7G-I). These persistent circular patterns of gene expression
probably reflected the loss of the extra-embryonic area. Striped expression of
At-en (Fig. 7E) and
anterior and posterior expression of At-otd and At-caudal
(Akiyama-Oda and Oda, 2003
),
respectively, in At-dpp RNAi embryos
(Fig. 7G-L) imply that
At-dpp RNAi had little effect on AP patterning, although there were
fewer At-en stripes than normal.
Furthermore, we examined At-sog expression in At-dpp RNAi embryos at different stages. RT-PCR showed that there was no detectable difference in the level of At-sog transcripts between untreated and At-dpp RNAi embryos at late stage 5 (Fig. 6I). Expression patterns of At-sog transcripts were observed in more than 29 late stage 5 embryos derived from the egg sac that was used for the RT-PCR experiment. It was found that all of the embryos showed more or less reduced asymmetry of the At-sog expression pattern (not shown), but none displayed complete symmetry, indicating that At-sog transcription was still affected by the shifting cumulus even in the At-dpp RNAi embryos. However, in severely defective At-dpp RNAi embryos at the later stages (stages 8 and 9) the entire surface ectoderm except for the posterior terminal area expressed At-sog transcripts at evenly high levels (Fig. 7M-O). Little asymmetry was recognized in the At-sog expression pattern. At-dpp RNAi embryos at the later stages were further examined for genes whose expression patterns reflect differences along the DV axis in the normal germ band. Staining for At-twi showed rings of At-twi-expressing mesodermal cells (Fig. 7P-R). No significant staining for At-pros, At-sim, or At-omb was obtained (Fig. 7S; not shown for At-sim and At-omb). In addition, the patterns of At-fkh expression, which varied among embryos, were radially symmetrical (not shown). Taken together, these data suggested that the At-dpp-depleted embryos were prevented from breaking the radial symmetry.
|
| DISCUSSION |
|---|
|
|
|---|
Depletion of At-dpp prevented the embryo from breaking the radial
symmetry, therefore, the At-Dpp-mediated specification of the extra-embryonic
area is crucial for radial-to-axial symmetry transformation of the spider
embryo (Fig. 8, yellow).
Despite the asymmetric patterns of At-sog expression from late stage
5 onward (Fig. 2),
At-sog function appears not to be involved in the formation of the
extra-embryonic area or the germ band (Fig.
5A). However, our data cannot exclude the possibility that the
suppressed At-sog is sufficient to play a role in the early events.
Since we failed to observe At-dpp RNAi embryos showing radially
symmetrical At-sog expression at late stage 5, it remains unclear
whether At-dpp is needed to make the initial At-sog
expression asymmetric. The ubiquitous expression of At-sog
transcripts at high levels in the later At-dpp RNAi embryo
(Fig. 7N) suggested that
At-sog transcription is negatively regulated by Dpp signaling. The
gradual expansion of the pMad-positive area from the dorsal side
(Fig. 2K,L) might be achieved
by the combination of positive feedback loops of Dpp signaling, as proposed in
Drosophila (Biehs et al.,
1996
), antagonism of Dpp signaling by Sog and progressive
repression of At-sog transcription by the Dpp signals.
|
|
Comparison of axis specification between fly and spider
There are two major differences in the roles of Drosophila and
Achaearanea Sog. First, fly Sog is necessary for specifying the
extra-embryonic area (Ashe and Levine,
1999
; Decotto and Ferguson,
2001
) but spider Sog probably is not
(Fig. 5A). Second, spider Sog
(Fig. 5D-I) but not fly Sog
(François et al., 1994
)
(see Fig. S1 in the supplementary material) is essential for specifying the
ventral tissues that run axially through the germ band. These differences may
reflect evolutionary changes in the gene regulatory networks.
|
In contrast to the Dorsal-based mechanism that organizes the DV axis in
Drosophila, a mechanism controlling the direction of CM cell
migration is important for initial DV polarity in Achaearanea,
although its molecular basis remains unclear. As is evident from this study,
the spider system appears to require a series of cell-cell interactions
involving At-Dpp and At-Sog to initiate ventral-specific gene expression.
These cell-cell interactions may well account for the regulative nature of
body axis formation of spider embryos proposed by classical experiments
(Holm, 1952
;
Sekiguchi, 1957
;
Seitz, 1970
), although the
mechanism of secondary axis induction in spiders remains to be studied. Based
on the results obtained in the analyses of spider dpp and
sog, we propose that one of the most fundamental differences in the
mechanisms that pattern the early fly and spider embryos is ventral
specification. This difference may reflect different degrees of contribution
made by maternal determinants and zygotic cell-cell interactions.
In addition, the mesoderm originates from between two separate lines of
presumptive ventral midline cells in the Drosophila embryo
(Leptin, 2004
). This situation
is completely different from that of the Achaearanea mesoderm, which
was suggested by At-twi expression patterns at stages 5 and 6 to have
radially symmetrical origins at the peripheral and central areas of the germ
disc (Yamazaki et al., 2005
).
In spider development, independent gene regulatory networks appear to specify
the DV pattern and the mesoderm.
Comparison of axis specification between vertebrates and spider
Our discovery of the differences between the fly and spider provide an
opportunity to rethink how arthropod embryos can be compared with vertebrate
embryos from the viewpoint of developmental evolution. Interestingly, the
spider situation in which sog activity is essential to specify the
ventral domains is similar to the vertebrate situation in which the antagonism
of Dpp/BMP signaling plays a central role in dorsal specification
(De Robertis et al., 2000
;
Oelgeschläger et al.,
2003
; Khokha et al.,
2005
). The ventral midline area in the spider embryo is comparable
to the presumptive notochord area in the vertebrate embryo in that both areas
are the centers of the Dpp/BMP antagonism and adjoin the CNS. In addition, the
axial expression of At-fkh and At-sim
(Fig. 2M,N) is reminiscent of
the expression of their homologues in chordate notochords
(Ruiz i Altaba et al., 1993
;
Sasaki and Hogan, 1993
;
Strähle et al., 1993
;
Shimauchi et al., 1997
;
Shimeld, 1997
;
Terazawa and Satoh, 1997
;
Mazet and Shimeld, 2002
).
Whether the spider ventral midline is homologous to the vertebrate notochord
is the emerging question. To satisfactorily answer this question, we will need
to consider the reason why the arthropod ventral midline is ectodermal and the
vertebrate notochord is mesodermal. The milder phenotypes of At-sog
RNAi embryos (Fig. 5E,H)
appeared to reflect concomitant development of the ventral midline and the
CNS. It is intriguing to investigate similarities and differences in the
mechanisms of neural induction in the spider and vertebrate embryos. Finally,
the Achaearanea experimental system could contribute to a better
understanding of the evolutionary relationships between the development of
arthropod and vertebrate embryos.
|
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/12/2347/DC1
| REFERENCES |
|---|
|
|
|---|
Akiyama-Oda, Y. and Oda, H. (2003). Early
patterning of the spider embryo: a cluster of mesenchymal cells at the cumulus
produces Dpp signals received by germ disc epithelial cells.
Development 130,1735
-1747.
Ashe, H. L. (2005). BMP signalling: synergy and feedback create a step gradient. Curr. Biol. 15,R375 -R377.[CrossRef][Medline]
Ashe, H. L. and Levine, M. (1999). Local inhibition and long-range enhancement of Dpp signal transduction by Sog. Nature 398,427 -431.[CrossRef][Medline]
Biehs, B., Fraçois, V. and Bier, E.
(1996). The Drosophila short gastrulation gene prevents
Dpp from autoactivating and suppressing neurogenesis in the neuroectoderm.
Genes Dev. 10,2922
-2934.
Bier, E. (1997). Anti-neural-inhibition: a conserved mechanism for neural induction. Cell 89,681 -684.[CrossRef][Medline]
Bucher, G., Scholten, J. and Klingler, M. (2002). Parental RNAi in Tribolium (Coleoptera). Curr. Biol. 12,R85 -R86.[CrossRef][Medline]
Damen, W. G. M., Hausdorf, M., Seyfarth, E.-A. and Tautz, D.
(1998). A conserved mode of head segmentation in arthropods
revealed by the expression pattern of Hox genes in a spider. Proc.
Natl. Acad. Sci. USA 95,10665
-10670.
Darras, S. and Nishida, H. (2001). The BMP/CHORDIN antagonism controls sensory pigment cell specification and differentiation in the ascidian embryo. Dev. Biol. 236,271 -288.[CrossRef][Medline]
De Robertis, E. M. and Sasai, Y. (1996). A common plan for dorsoventral patterning in Bilateria. Nature 380,37 -40.[CrossRef][Medline]
De Robertis, E. M., Larraín, J., Oelgeschläger, M. and Wessely, O. (2000). The establishment of Spemann's organizer and patterning of the vertebrate embryo. Nat. Rev. Genet. 1,171 -181.[CrossRef][Medline]
Decotto, E. and Ferguson, E. L. (2001). A
positive role for Short gastrulation in modulating BMP signaling during
dorsoventral patterning in the Drosophila embryo.
Development 128,3831
-3841.
Fainsod, A., Deißler, K., Yelin, R., Marom, K., Epstein, M., Pillemer, G., Steinbeisser, H. and Blum, M. (1997). The dorsalizing and neural inducing gene follistatin is an antagonist of BMP-4. Mech. Dev. 63,39 -50.[CrossRef][Medline]
Ferguson, E. L. (1996). Conservation of dorsal-ventral patterning in arthropods and chordates. Curr. Opin. Genet. Dev. 6,424 -431.[CrossRef][Medline]
Ferguson, E. L. and Anderson, K. V. (1992a). decapentaplegic acts as a morphogen to organize dorsal-ventral pattern in the Drosophila embryo. Cell 71,451 -461.[CrossRef][Medline]
Ferguson, E. L. and Anderson, K. V. (1992b). Localized enhancement and repression of the activity of the TGF-ß family member, decapentaplegic, is necessary for dorsal-ventral pattern formation in the Drosophila embryo. Development 114,583 -597.[Abstract]
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.Nature 391,806 -811.[CrossRef][Medline]
François, V., Solloway, M., O'Neill, J. W., Emery, J. and
Bier, E. (1994). Dorsal-ventral patterning of the
Drosophila embryo depends on a putative negative growth factor
encoded by the short gastrulation gene. Genes
Dev. 8,2602
-2616.
Friedrich, M. and Tautz, D. (1995). Ribosomal DNA phylogeny of the major extant arthropod classes and the evolution of myriapods. Nature 376,165 -167.[CrossRef][Medline]
Gerhart, J. (2004). Symmetry breaking in the egg of Xenopus laevis. In Gastrulation: From Cells to Embryo (ed. C. D. Stern), pp. 341-351. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Giribet, G., Edgecombe, G. D. and Wheeler, W. C. (2001). Arthropod phylogeny based on eight molecular loci and morphology. Nature 413,157 -161.[CrossRef][Medline]
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann's organizer. Annu. Rev. Cell Dev. Biol. 13,611 -667.[CrossRef][Medline]
Hemmati-Brivanlou, A., Kelly, O. G. and Melton, D. A. (1994). Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell 77,283 -295.[CrossRef][Medline]
Holley, S. A. and Ferguson, E. L. (1997). Fish are like flies are like frogs: conservation of dorsal-ventral patterning mechanisms. BioEssays 19,281 -284.[CrossRef][Medline]
Holley, S. A., Jackson, P. D., Sasai, Y., Lu, B., De Robertis, E. M., Hoffman, F. M. and Ferguson, E. L. (1995). A conserved system for dorsal-ventral patterning in insects and vertebrates involving sog and chordin. Nature 376,249 -253.[CrossRef][Medline]
Holm, Å. (1952). Experimentelle untersuchungen über die entwicklung und entwicklungsphysiologie des spinnenembryos. Zool. Bidr. Uppsala 29,293 -424.
Hwang, U. W., Friedrich, M., Tautz, D., Park, C. J. and Kim, W. (2001). Mitochondrial protein phylogeny joins myriapods with chelicerates. Nature 413,154 -157.[CrossRef][Medline]
Irish, V. F. and Gelbart, W. M. (1987). The
decapentaplegic gene is required for dorsal-ventral patterning of the
Drosophila embryo. Genes Dev.
1, 868-879.
Itow, T., Kenmochi, S. and Mochizuki, T. (1991). Induction of secondary embryos by intra- and interspecific grafts of center cells under the blastopore in horseshoe crabs. Dev. Growth Differ. 33,251 -258.[Medline]
Jiang, J. and Levine, M. (1993). Binding affinities and cooperative interactions with bHLH activators delimit threshold responses to the dorsal gradient morphogen. Cell 72,741 -752.[CrossRef][Medline]
Khokha, M. K., Yeh, J., Grammer, T. C. and Harland, R. M. (2005). Depletion of three BMP antagonists from Spemann's organizer leads to a catastrophic loss of dorsal structures. Dev. Cell 8,401 -411.[CrossRef][Medline]
Kimelman, D. and Bjornson, C. (2004). Vertebrate mesoderm induction. In Gastrulation: From Cells to Embryo (ed. C. D. Stern), pp. 363-372. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Lamb, T. M., Knecht, A. K., Smith, W. C., Stachel, S. E.,
Economides, A. N., Stahl, N., Yancopolous, G. D. and Harland, R. M.
(1993). Neural induction by the secreted polypeptide noggin.
Science 262,713
-718.
Lehmann, R. and Tautz, D. (1994). In situ hybridization to RNA. In Drosophila melanogaster: Practical Uses in Cell and Molecular Biology (ed. L. S. B. Goldstein and E. A. Fyrberg), pp. 575-598. San Diego: Academic Press.
Leptin, M. (2004). Gastrulation in Drosophila. In Gastrulation: From Cells to Embryo (ed. C. D. Stern), pp. 91-104. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Liu, P. Z. and Kaufman, T. C. (2003). hunchback is required for suppression of abdominal identity, and for proper germband growth and segmentation in the intermediate germband insect Oncopeltus fasciatus. Development 131,1515 -1527.
Mazet, F. and Shimeld, S. M. (2002). The evolution of chordate neural segmentation. Dev. Biol. 251,258 -270.[CrossRef][Medline]
Mito, T., Sarashina, I., Zhang, H., Iwahashi, A., Okamoto, H.,
Miyawaki, K., Shinmyo, Y., Ohuchi, H. and Noji, S. (2005).
Non-canonical functions of hunchback in segment patterning of the
intermediate germ cricket Gryllus bimaculatus.Development 132,2069
-2079.
Niimi, T., Kuwayama, H. and Yaginuma, T. (2005). Larval RNAi applied to the analysis of postembryonic development in the ladybird beetle, Harmonia axyridis. J. Insect Biotechnol. Sericology 74,95 -102.
Oda, H., Tagawa, K. and Akiyama-Oda, Y. (2005). Diversification of epithelial adherens junctions with independent reductive changes in cadherin form: identification of potential molecular synapomorphies among bilaterians. Evol. Dev. 7, 376-389.[CrossRef][Medline]
Oelgeschläger, M., Kuroda, H., Reversade, B. and De Robertis, E. M. (2003). Chordin is required for the Spemann organizer transplantation phenomenon in Xenopus embryos. Dev. Cell 4,219 -230.[CrossRef][Medline]
Padgett, R. W., St. Johnston, R. D. and Gelbart, W. M. (1987). A transcript from a Drosophila pattern gene predicts a protein homologous to the transforming growth factor-ß family. Nature 325,81 -84.[CrossRef][Medline]
Persson, U., Izumi, H., Souchelnytskyi, S., Itoh, S., Grimsby, S., Engström, U., Heldin, C.-H., Funa, K. and ten Dijke, P. (1998). The L45 loop in type I receptors for TGF-ß family members is a critical determinant in specifying Smad isoform activation. FEBS Lett. 434,83 -87.[CrossRef][Medline]
Piccolo, S., Sasai, Y., Lu, B. and De Robertis, E. M. (1996). Dorsoventral patterning in Xenopus: inhibition of ventral signals by direct binding of Chordin to BMP-4. Cell 86,589 -598.[CrossRef][Medline]
Prpic, N.-M., Janssen, R., Wigand, B., Klingler, M. and Damen, W. G. M. (2003). Gene expression in spider appendages reveals reversal of exd/hth spatial specificity, altered leg gap gene dynamics, and suggests divergent distal morphogen signaling. Dev. Biol. 264,119 -140.[CrossRef][Medline]
Ray, R. P., Arora, K., Nüsslein-Volhard, C. and Gelbart, W. M. (1991). The control of cell fate along the dorsal-ventral axis of the Drosophila embryo. Development 113, 35-54.[Abstract]
Roth, S., Stein, D. and Nüsslein-Volhard, C. (1989). A gradient of nuclear localization of the dorsal protein determines dorsoventral pattern in the Drosophila embryo. Cell 59,1189 -1202.[CrossRef][Medline]
Ruiz i Altaba, A., Prezioso, V. R., Darnell, J. E. and Jessell,
T. M. (1993). Sequential expression of HNF-3ß and
HNF-3
by embryonic organizing centers: the dorsal lip/node, notochord
and floor plate. Mech. Dev.
44, 91-108.[CrossRef][Medline]
Sander, K. (1976). Specification of the basic body pattern in insect embryogenesis. Adv. Insect Physiol. 12,125 -238.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79,779 -790.[CrossRef][Medline]
Sasaki, H. and Hogan, B. L. M. (1993). Differential expression of multiple fork head related genes during gastrulation and axial pattern formation in the mouse embryo. Development 118,47 -59.[Abstract]
Seitz, K.-A. (1970). Embryonale defekt- und doppelbildungen im ei der spinne Cupiennius Salei (Ctenidae). Zool. Jb. Anat. 87,588 -639.
Sekiguchi, K. (1957). Reduplication in spider eggs produced by centrifugation. Sci. Rep. Tokyo Kyoiku Daigaku Sec. B 8,227 -280.
Shimauchi, Y., Yasuo, H. and Satoh, N. (1997). Autonomy of ascidian fork head/HNF-3 gene expression. Mech. Dev. 69,143 -154.[CrossRef][Medline]
Shimeld, S. M. (1997). Characterization of Amphioxus HNF-3 genes: conserved expression in the notochord and floor plate. Dev. Biol. 183,74 -85.[CrossRef][Medline]
Shimmi, O., Umulis, D., Othmar, H. and O'Connor, M. B. (2005). Facilitated transport of a Dpp/Scw heterodimer by Sog/Tsg leads to robust patterning of the Drosophila blastoderm embryo. Cell 120,873 -886.[CrossRef][Medline]
Spemann, H. and Mangold, H. (1924). Über induktion von embryonalanlagen durch Implantation artfremder organisatoren. Wilhelm Roux Arch. Entw. Mech. Org. 100,599 -638.
Stathopoulos, A. and Levine, M. (2002). Dorsal gradient networks in the Drosophila embryo. Dev. Biol. 246,57 -67.[CrossRef][Medline]
Stathopoulos, A. and Levin, M. (2004). Whole-genome analysis of Drosophila gastrulation. Curr. Opin. Genet. Dev. 14,477 -484.[CrossRef][Medline]
Stollewerk, A., Weller, M. and Tautz, D. (2001). Neurogenesis in the spider Cupiennius salei.Development 128,2673 -2688.[Medline]
Strähle, U., Blader, P., Henrique, D. and Ingham, P. W. (1993). Axial, a zebrafish gene expressed along the developing body axis, show altered expression in cyclops mutant embryos. <