|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 25 May 2006
doi: 10.1242/dev.02420
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Carolina Cardiovascular Biology Center, 5109 Neuroscience Research Building,
Chapel Hill, NC 27599-7126, USA.
2 Department of Biology, Fordham Hall, UNC-Chapel Hill, Chapel Hill, NC
27599-3280, USA.
3 Department of Genetics, Fordham Hall, UNC-Chapel Hill, Chapel Hill, NC
27599-3280, USA.
* Author for correspondence (e-mail: frank_conlon{at}med.unc.edu)
Accepted 28 April 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Tbx5, Holt-Oram Syndrome, Cardiogenesis, Cardiac, Heart, Xenopus, Cell cycle, S-phase, Proliferation, T-box
| INTRODUCTION |
|---|
|
|
|---|
During the embryonic stage of cell proliferation, the cardiac cells express
the first molecular markers of cardiac development, including Tbx5,
Tbx20 and the homolog of the Drosophila tinman gene,
Nkx2.5 (Harvey, 2002
;
Stennard and Harvey, 2005
).
Tbx5 is a member of the T-box family of transcription factors, a
family of proteins that are required for normal vertebrate patterning and
differentiation (Papaioannou and Silver,
1998
; Showell et al.,
2004
; Stennard and Harvey,
2005
; Wilson and Conlon,
2002
). Clinical studies have provided direct evidence for a role
for human Tbx5 in heart development, with Tbx5 frequently
mutated in patients with the congenital heart disease Holt-Oram syndrome (HOS)
(Basson et al., 1997
;
Li et al., 1997
;
Mandel et al., 2005
). HOS is a
highly penetrant autosomal dominant condition that is associated with skeletal
and cardiac malformations. The HOS cardiac developmental abnormalities include
atrial and ventricular septal defects, as well as conductivity defects and
aberrant chamber formation (Basson et al.,
1999
; Benson et al.,
1996
; Newbury-Ecob et al.,
1996
). A role for Tbx5 in HOS is supported by the
observation that mice heterozygous for mutations in Tbx5 display many
of the cardiac abnormalities associated with human patients suffering from HOS
(Bruneau et al., 2001
). Genetic
studies of a Tbx5 mutation in zebrafish and TBX5 depletion in
Xenopus are also consistent with a role for TBX5 in heart development
(Brown et al., 2005
;
Garrity et al., 2002
;
Horb and Thomsen, 1999
). The
evolutionarily conserved role for Tbx5 is further emphasized by
molecular experiments carried out in tissue culture, zebrafish,
Xenopus, chicken and mouse, all of which show a role for TBX5
transcriptional activity in regulating the expression of heart-specific genes
(Brown et al., 2005
;
Bruneau et al., 2001
;
Garrity et al., 2002
;
Hatcher et al., 2001
;
Hiroi et al., 2001
;
Liberatore et al., 2000
;
Plageman and Yutzey,
2004
).
Recently, we have shown that depletion of TBX5 in Xenopus leads to
profound morphological defects in the heart, including pericardial edema, loss
of circulation and a concomitant decrease in cardiac cell number
(Brown et al., 2005
). In the
present study, we demonstrate that the observed decrease in cell number
results from defects in embryonic cardiac cell proliferation. We go on to
define the expression pattern of an extensive panel of CDK and cyclin proteins
in early embryonic cardiac tissue, and show that TBX5 depletion leads to a
G1/S-phase arrest, as demonstrated by a dramatic increase in the
expression of proteins associated with the cardiac cell cycle S-phase,
including CDC6, cyclin E2, SLBP and PCNA. This suggests that TBX5 is involved
in either G1/S-phase or the early stages of S-phase progression.
The G1/S-phase delay or arrest coincides with a decrease in the
embryonic cardiac mitotic index. These events are associated with an
alteration in the timing of the cardiac differentiation program, defects in
cardiac sarcomere formation and ultimately, cardiac programmed cell death. By
contrast, overexpression of Tbx5, which we show also leads to
heart-specific defects, results in an increase in the cardiac mitotic index
and has a converse effect on the timing of the cardiac differentiation
program. Collectively, these studies demonstrate that TBX5 is both necessary
and sufficient to determine the length of cardiac G1/S-phase and
the timing of the cardiac differentiation program.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Immunohistochemistry and whole-mount in-situ hybridization
Embryos were prepared for whole-mount immunohistochemistry according to
Kolker and colleagues (Kolker et al.,
2000
). Briefly, fixed embryos were incubated overnight at 4°C
with an antibody against tropomyosin (Developmental Studies Hybridoma Bank),
at a dilution of 1:50. Following washes, the embryos were incubated overnight
at 4°C with a Cy3-conjugated anti-mouse secondary antibody (Sigma) at a
dilution of 1:100. For imaging, embryos were cleared with 2:1 benzyl benzoate:
benzyl alcohol and viewed on a Leica MZFLIII fluorescent dissecting
microscope. For immunostaining of histological sections, embryos were
collected at the indicated stages, fixed for 2 hours in 4% paraformaldehyde,
and embedded in OCT cryosectioning medium (Tissue Tek). Cryostat sections (14
µm) were rinsed with wash buffer (PBS with 1% Triton and 1% heat
inactivated calf serum), and incubated at 4°C overnight, as indicated,
with mouse anti-tropomyosin 1:50, mouse anti-troponin 1:20, mouse
anti-fibrillin 1:50 (all from Developmental Studies Hybridoma Bank), mouse
anti-MHC (Abcam) rabbit anti-fibronectin 1:50 (Sigma), rabbit
anti-Beta-catenin all at 1:1000 (Sigma), rabbit anti-phosphohistone H3 1:50
(Upstate) and rabbit anti-cleaved caspase 3 1:50 (Cell Signaling). The
sections were rinsed with wash buffer and the appropriate fluorescent
conjugated secondary antibody diluted in wash buffer: anti-mouse-Cy3 1:100
(Sigma), anti-mouse Cy2 1:100 (Jackson), anti-rabbit-Cy3 1:100 (Sigma) and
anti-rabbit-FITC 1:150 (Sigma). Samples were incubated for 30 minutes at room
temperature with DAPI (Sigma) to stain nuclei, or phalloidin conjugated to
Alexa 488 (Molecular Probes, 1:1000) to stain actin filaments. The samples
were imaged on a Zeiss LSM410 confocal microscope. Whole-mount in-situ
hybridization was performed as previously described
(Harland, 1991
).
RT-PCR primers
The primers used and cycle number were as follows.
EF1-
F, CCTGAACCACCCAGGCCAGATTGGTG; EF1-
R,
GAGGTTAGTCAGAGAAGCTCTCCACG (Agius et al.,
2000
); 25 cycles.
MHC F, GCCAACGCGAACCTCTCCAAGTTCCG; MHC R, GGTCACATTTTATTTCATGCTGGTTAACAGG (Lab designed); 30 cycles.
Muscle actin F, GCTTGTCCCGATCTGAAC; R, TTGCTTGGAGGAGTGTGT (Lab designed); 30 cycles.
MyoD F, AGGTCCAACTGCTCCGACGGCATGAA; R, AGGAGAGAATCCAGTTGATGGAAACA
(Hopwood et al., 1989
); 25
cycles.
Nkx2.5 F, GAGCTACAGTTGGGTGTGTGTGGT; Nkx2.5 R, GTGAAGCGACTAGGTATGTGTTCA (DeRobertis, unpublished); 25 cycles.
Tropomyosin F, TGGAGATGGCGGAGAAGAAG; tropomyosin R, GCAGCAAGTGGCAGTCACGA
(Charbonnier et al., 2002
); 30
cycles.
Troponin I F, GCTGACAGAATGCAGAAG; troponin I R, GAGATTGGCCCGTAGATC (DeRobertis, unpublished); 30 cycles.
All primers were designed to span introns to enable PCR products amplified from cDNA to be distinguished from those amplified by remnant genomic DNA.
RT-PCR reactions
RNA was isolated from five embryos per stage per condition using the RNeasy
kit (Qiagen) according to the manufacturer's instructions. The resulting RNA
was quantitiated using a UV spectrophotometer (Shimadzu UV-1601), and 100 ng
of RNA for each reaction was used to synthesize cDNA with Superscript II
reverse transcriptase (Invitrogen). Total reaction volume for cDNA synthesis
was 20 µl. Resulting cDNA (2 µl) was then used as template in PCR
reactions with Taq polymerase. The number of cycles amplified for each primer
(shown above) was determined by running a test PCR reaction and removing an
aliquot of each sample after 20, 25, 30 and 35 rounds of amplification to
determine the point at which reactions for each primer pair reached
saturation. The cycle number used in subsequent experiments for each primer
was five amplification cycles prior to the saturation point. For each primer
pair, 55°C was used as the annealing temperature.
Western blots
Heart tissue from a minimum of 300 embryos per condition was dissected at
stage 33 and snap frozen. Tissue was homogenized, subjected to SDS-PAGE, and
transferred according to established protocols. Blots were probed overnight at
4°C with antibodies against Cdc6, Cdt1 [gift from M. Coué, both
1:500 (Whitmire et al.,
2002
)], cyclin E2 (Abcam, 1:500), PCNA (Zymed, 1:1000), MCM 4
(Abcam, 1:2000), MCM 5 (Abcam 1:400), MCM7 (LabVision, 1:200), Cdk1 (Zymed,
1:1000), Cdk2 (Upstate, 1:1000), cyclin A1, cyclin A2 (Abcam, both 1:1000),
SLBP [gift from W. Marzluff, 1:1000 (Wang
et al., 1999
)], and cyclin B2 [gift from T. Hunt, 1:500
(Hochegger et al., 2001
)].
Blots were rinsed and probed with the appropriate HRP-conjugated secondary
antibody (Jackson, 1:10,000), and detected with ECL. As a loading control,
blots were reprobed with antibodies against Total MEK (Cell Signaling,
1:2000), alpha tubulin (Abcam, 1:1000) and/or SHP2 (BD Biosciences,
1:2500).
Transmission electron microscopy
Stage 37 embryos were fixed in 2% paraformaldehyde/2.5% gluteraldehyde
overnight. Embryos were post-fixed in ferrocyanide-reduced osmium and embedded
in Spurr's epoxy resin. Transverse ultra-thin (70 nm) sections were mounted on
copper grids, and post-stained with 4% aqueous uranyl acetate followed by
Reynolds' lead citrate. Sections were imaged with a LEO EM-910 transmission
electron microscope.
| RESULTS |
|---|
|
|
|---|
To determine if the decrease in cardiac cell number is due to cell proliferation or programmed cell death, we analyzed the mitotic index (Fig. 1G-L,T) and apoptosis (Fig. 1M-R,U) at defined time points during heart development: stage 29, which corresponds to the stage when the heart field rounds up to begin forming the bilaminar heart tube; stage 33, at which time cardiac looping is initiated; and stage 37, corresponding to early chamber formation. For these studies CMO and T5MO embryos at each stage were serial-sectioned through the cardiac regions and triple immunostained with anti-tropomyosin (Tmy) to mark cardiomyocytes, DAPI to mark cell nuclei and either anti-phosphohistone H3 (pH3) to mark cells in M-phase (Fig. 1G-L), or anti-cleaved caspase 3 to mark cells undergoing apoptosis (Fig. 1M-R). In each study all cardiomyocytes and endocardial cells encompassed by the cardiomyocytes for each heart at each stage were scored for pH3 or cleaved caspase 3.
CMO embryos showed that the total cardiomyocyte cell numbers underwent a doubling every four stages, or 9 hours, at room temperature between stages 33 and 37 (Fig. 1G-I,M-O). As the majority of the cardiomyocytes appeared to be undergoing mitosis (based on serial sections of multiple embryos at these stages), the embryonic cardiac cell cycle in Xenopus was approximately 9 hours in length with M-phase lasting approximately 20 minutes, with the mitotic index gradually decreasing with age (Fig. 1T). We note there was little to no cardiomyocyte programmed cell death during these stages (Fig. 1U).
|
|
TBX5 depletion leads to a cardiac cell cycle delay or arrest in G1/S-phase
Inference from other systems implies that the integration of growth factor
signal cascades with G1/S cell cycle passage is regulated by the
cyclin/CDK complexes CDK2/cyclin E, CDK2/cyclin A and CDK1/cylin D, many of
which are expressed in Xenopus in a stage- and tissue-specific
fashion (Vernon and Philpott,
2003
). Although much is known about the cardiac cell cycle during
neonatal periods, little is known about the expression of CDKs and cyclins
during the early stages of embryonic heart development. To address this issue,
we isolated hearts from the first stage at which we could anatomically isolate
pure cardiac tissue (stage 33). The resultant tissues were analyzed relative
to corresponding whole embryo lysates with an extensive panel of antibodies
specific for individual cyclins and CDKs
(Fig. 2A). Results from this
analysis show that Xenopus cardiac tissue at stage 33 expressed
cyclin E2, CDC6, PCNA, SLBP, CDK2, cyclin A2 and CDK1, as well as proteins
that are expressed uniformly throughout the cell cycle, such as MCM4 and MCM7.
Although we could detect high levels of CDT1, cyclin A1, cyclin B2 and MCM5 in
stage 33 embryos, we were able to detect little to no expression of these
proteins in the heart (Fig.
2A). However, due to the relative amount of cardiac tissue to that
of whole embryos, we cannot formally rule out the possibility that these
proteins were present at relatively lower amounts. We note that we were unable
to identify any antibody that marked D cyclins in Xenopus. However,
previous studies have suggested that neither of the Xenopus D
cyclins, cyclin D1 or D2, are expressed in the heart at these stages
(Vernon and Philpott,
2003
).
We next analyzed cell cycle proteins in heart tissue derived from T5MO and CMO embryos (Fig. 2B). These studies show that depletion of TBX5 led to a dramatic upregulation of the S-phase proteins cyclin E2, CDC6 and CDK2, while proteins associated with other cell cycle phases, cyclin A2 and CDK1, or proteins expressed throughout the cell cycle, such as MCM4 and MCM7, showed no significant differences between T5MO- and CMO-derived heart tissues (Fig. 2B). Together with the mitotic index data, our results strongly suggest that depletion of TBX5 led to a prolonged/arrested G1- or S-phase and a concomitant decrease in the proportion of cardiac cells in M-phase.
To confirm these findings, we also analyzed CMO- and T5MO-derived hearts for the non-CDK/cyclin S-phase proteins stem loop binding protein (SLBP) and proliferating cell nuclear antigen (PCNA) (Fig. 2C). Western blots of CMO- and T5MO-derived heart tissue show that relative to the loading controls SHP2 and total MEK, depleting TBX5 led to an increase in both SLBP and PCNA levels. Collectively, these results strongly suggest that TBX5 depletion leads to a delay or block in the G1- or S-phase of the cardiac cell cycle.
|
|
To confirm these findings, we carried out whole-mount antibody staining on
T5MO and CMO embryos for tropomyosin. Consistent with the RT-PCR analysis, we
observed a delay in the expression of tropomyosin in T5MO embryos in
comparison with CMO embryos (Fig.
4B-I). As further confirmation that the timing of differentiation
is altered in response to TBX5 depletion in vivo, we injected embryos carrying
the cardiac actin:GFP transgene (Latinkic
et al., 2002
) with T5MO or CMO and monitored skeletal muscle and
heart development in living staged-matched embryos
(Fig. 4J-Q). Although we could
not detect any alteration in the timing of GFP expression in skeletal muscle
(data not shown), we observed a consistent and significant delay in the time
at which GFP was first expressed in the hearts of the T5MO embryos.
Collectively, these results suggest that control of the cardiac cell cycle by
TBX5 leads to an alteration in the timing of the cardiac program.
TBX5 depletion leads to abnormal sarcomere formation
To determine if cardiomyocyte differentiation in T5MO hearts occurs in all
cardiomyocytes or only in a subset of cells, we analyzed cardiomyocyte
differentiation by immunohistochemistry on cross-sections of CMO- and
T5MO-derived tissues (Fig.
5A-H). Results clearly showed that by stage 37 we could detect
staining of troponin T (cTnT), MHC and Tmy throughout the myocardium of
control and T5MO hearts, suggesting that all cardiomyocytes in T5MO undergo
terminal differentiation.
|
To confirm these structural alterations in TBX5-depleted heart tissue, we carried out ultrastructural analyses on CMO and T5MO hearts by high magnification confocal microscopy (Fig. 5O,P) and transmission electron microscopy (TEM) (Fig. 5Q-V). High magnification imaging of cardiac tissue immunostained with Tmy revealed that the cardiac cells in CMO embryos formed myofibrils that were distributed throughout the myocardium (Fig. 5O). By contrast, the myofibrils in T5MO cardiac cells were poorly organized and formed only adjacent to the cardiac lumen (Fig. 5P).
Consistent with immunostaining for cardiac muscle, we found in transverse
TEM sections of CMO embryos that cardiac muscle bundles were located
throughout the myocardium, positioned in both longitudinal and concentric
arrays (Fig. 5Q). By contrast,
T5MO hearts showed far fewer sarcomeres than controls, and the cells bordering
the pericardial space of T5MO hearts, in contrast with those bordering the
heart lumen, completely lacked bundles of cardiac muscle fibers
(Fig. 5R,S,V). Moreover, the
sarcomeres that formed frequently lacked distinct A- and Z-bands, and the A-
and Z-bands that were present were poorly defined
(Fig. 5T,U). This does not
appear to represent simply a delay in myofibril formation, as during normal
development myofibrils form throughout the myocardium and do not show any
temporal differences in differentiation between distal and proximal
cardiomyocytes (Kolker et al.,
2000
) (Y. Langdon and F.L.C., unpublished).
|
TBX5 is both necessary and sufficient for the progression of the embryonic cardiac cell cycle
Our analysis of T5MO embryos shows a requirement for TBX5 in embryonic cell
cycle progression and a role in controlling the correct timing of cardiac
differentiation. To determine if TBX5 is sufficient to regulate these two
processes, we misexpressed Tbx5 in early Xenopus embryos
(Fig. 6). Although injection of
Tbx5 RNA at the single cell stage caused Tbx5 misexpression
throughout the embryo, phenotypic abnormalities were restricted to the
anterior and cardiac regions of the early tadpole
(Fig. 6A-C; data not shown). To
further analyze these defects, we carried out whole-mount in-situ
hybridization analyses on uninjected control and Tbx5-injected
embryos (Fig. 6D-G; data not
shown). Similar to results from TBX5 depletion, this analysis shows that
Tbx5 misexpression did not block cardiac commitment, migration or
terminal differentiation, as judged by Nkx2.5 and myosin light chain
(MLC) expression (Fig.
6D-G).
To test if Tbx5 cardiac defects are associated with alteration in the cardiac cell cycle, we serial-sectioned embryos at stage 37 and stained with the mitotic marker anti-pH3. We found that Tbx5 misexpression had the opposite effect of depleting TBX5, leading to a two-fold increase in the cardiac cell mitotic index (Fig. 6H).
To ensure that the increase in mitotic index is tissue-specific, we calculated the mitotic index in the ventricular zone of the neural tube in the same sections as those containing the heart tissue, i.e. sections that correspond exactly to the same point along the anterior-posterior axis. We could not detect a difference between control or Tbx5-misexpressing-derived neural tissue. Therefore, the increase in mitotic index within appears to be cardiac-specific.
To test whether TBX5 is also sufficient for the correct timing of cardiac differentiation, we again collected stage-matched embryos from stage 10 to stage 38 and carried out RT-PCR with primers specific for the early cardiac marker Nkx2.5, and for markers of cardiac and skeletal muscle differentiation (Fig. 6J). Consistent with our results for the in-situ hybridization experiment, we found no alteration in Nkx2.5 expression in Tbx5-injected embryos. Results for the cardiac differentiation markers showed the exact opposite of those for TBX5 depletion: Tbx5-injected embryos initially expressed Troponin and MHC at later stages than controls (stage 38 in Tbx-injected embryos versus stage 28 in control embryos) but turned on Tmy at earlier stages (stage 16 in Tbx5-injected embryos versus 22 in control embryos). As we did not observe any changes in the timing at which skeletal muscle markers were expressed, the alteration in timing of expression again appeared to be specific to cardiac tissue. Collectively, these studies strongly suggest that TBX5 is both necessary and sufficient to regulate progression of the embryonic cardiac cell cycle and the timing of the cardiac program.
| DISCUSSION |
|---|
|
|
|---|
|
TBX5 and embryonic cardiac cell cycle control
Like other members of the T-box gene family, TBX5 has been shown to
function as a transcription factor; TBX5 is localized to the nucleus, it binds
to DNA in a sequence specific fashion and it regulates the transcriptional
level of its target genes. Our present studies suggest that at least one of
the targets of TBX5 either directly or indirectly functions to control the
progression of the embryonic cardiac cell cycle. What are the mechanisms by
which this may occur? One possibility is that TBX5 could function to induce
the expression of a growth factor, for example EGF or FGF, which in turn is
required for cell cycle progression. In the absence of this growth factor the
cell cycle may not proceed through to the completion of G1
(Fig. 7). Alternatively, TBX5
may function to regulate the expression of a key component of the
pre-replication complex. In the absence of this key component the
pre-replication complex may not assemble or may not load onto the origins of
replication (ORCs), thus blocking DNA synthesis and hence cell cycle
progression (Fig. 7).
Cell cycle progression through G1/S is regulated by members of
the E2F family of transcription factors, the function of which is governed
through their interaction with the retinoblastoma protein (Rb). In its
hypophosphorylated state, Rb interacts with E2F, inhibiting its
transcriptional activation activity. Upon Rb phosphorylation, the Rb-E2F
interaction is disrupted and E2F is released and able to activate its
downstream genes required for S-phase entry
(Cobrinik, 2005
). Thus, one
function of TBX5 may be to indirectly regulate the state of Rb
phosphorylation. Finally, TBX5 may function to negatively regulate general
cell cycle inhibitors such as p27Xic
(Fig. 7). Our data cannot
distinguish between these possibilities, and the exact molecular pathway by
TBX5 functions awaits the identification of TBX5 cell cycle target genes.
Tbx5 misexpression leads to cardiac-specific defects
We have shown that misexpression of Tbx5 leads to cardiac defects
in vivo. This effect appeared to be specific, as misexpression of other
T-box-containing genes does not give a similar phenotype
(Showell et al., 2004
). These
results demonstrate that the absolute levels of TBX5 are crucial for normal
heart development in vivo; increased levels of TBX5 results in abnormal heart
formation and reduction of TBX5 levels by just half leads to HOS.
Interestingly, the defects we observed with Tbx5 misexpression were
specific to the anterior and cardiac regions of the embryo, with the cardiac
defects resembling those seen with Nkx2.5 misexpression
(Cleaver, 1996
;
Tonissen et al., 1994
). The
similarity between the Tbx5 and Nkx2.5 overexpression
phenotypes raises the possibility that the misexpression phenotype we observed
in TBX5 was due to an upregulation of Nkx2.5. However, a number of
our findings would suggest that this is not the case. Most crucially, we have
conducted in-situ hybridization as well as RT-PCR to examine Nkx2.5
expression in embryos misexpressing Tbx5 during early stages of early
heart development. We have shown that misexpression of Tbx5 did not
lead to altered spatial or temporal patterns or levels of Nkx2.5
expression at any stage. These results are consistent with our previously
published results showing that the loss of TBX5 has no effect on the temporal
or spatial expression of Nkx2.5
(Brown et al., 2005
).
Therefore, misexpression of Tbx5 appears to alter the cardiac mitotic
index in an Nkx2.5-independent fashion.
Our finding that Tbx5 misexpression resulted in an increased
mitotic index differs from two previous studies implying that Tbx5
expression inhibits cell growth or survival
(Hatcher et al., 2001
;
Liberatore et al., 2000
).
However, in these reports Tbx5 is misexpressed after expression of
endogenous Tbx5 is initiated and, consequently, after the commitment
and differentiation of the heart have taken place. Thus, it may be possible
that TBX5 has two opposing functions during development: an early function in
regulating cardiac cell cycle progression and a late function instructing
cardiac cells to undergo cell cycle arrest. Alternatively, overexpression of
TBX5 may lead to it binding and activating non-endogenous targets, in
particular those of other T-box genes, such as TBX2, TBX3, TBX18 or TBX20
(Harvey, 2002
;
Stennard and Harvey, 2005
),
which may function during the later stages of cardiogenesis to regulate cell
cycle exit.
Holt-Oram syndrome
HOS is an autosomal dominant disease arising from haploinsufficiency of
TBX5 and is associated with conduction-system abnormalities, secundum atrial
defect and ventricular septal defects
(Basson et al., 1997
;
Li et al., 1997
;
Newbury-Ecob et al., 1996
).
Consistent with these phenotypic abnormalities, Tbx5 has been shown
to be expressed in the atrial wall, the atrial septa and the atrial aspects of
the atrioventricular valves (Hatcher et
al., 2000
). The role of TBX5 in heart development is further
emphasized by the observation that mice heterozygous for mutations in
Tbx5 display many of the abnormalities described in HOS patients
(Bruneau et al., 2001
).
However, the cellular basis for defects in HOS remains unclear. Our results
would suggest that TBX5 functions to regulate the length of the
G1/S cycle within the subset of heart tissues in which it is
expressed. In HOS, G1/S-phase would be significantly lengthened or
blocked, leading to a decrease in cell cycle progression and defects in cell
proliferation due to a successive decrease in the number of cell divisions,
and ultimately programmed cell death in the affected regions.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Agius, E., Oelgeschlager, M., Wessely, O., Kemp, C. and De
Robertis, E. M. (2000). Endodermal Nodal-related signals and
mesoderm induction in Xenopus. Development
127,1173
-1183.[Abstract]
Anversa, P. and Kajstura, J. (1998).
Ventricular myocytes are not terminally differentiated in the adult mammalian
heart. Circ. Res. 83,1
-14.
Basson, C. T., Bachinsky, D. R., Lin, R. C., Levi, T., Elkins,
J. A., Soults, J., Grayzel, D., Kroumpouzou, E., Traill, T. A.,
Leblanc-Straceski, J. et al. (1997). Mutations in human TBX5
[corrected] cause limb and cardiac malformation in Holt-Oram syndrome.
Nat. Genet. 15,30
-35.[CrossRef][Medline]
Basson, C. T., Huang, T., Lin, R. C., Bachinsky, D. R.,
Weremowicz, S., Vaglio, A., Bruzzone, R., Quadrelli, R., Lerone, M., Romeo, G.
et al. (1999). Different TBX5 interactions in heart and limb
defined by Holt-Oram syndrome mutations. Proc. Natl. Acad. Sci.
USA 96,2919
-2924.
Benson, D. W., Basson, C. T. and MacRae, C. A.
(1996). New understandings in the genetics of congenital heart
disease. Curr. Opin. Pediatr.
8, 505-511.[CrossRef][Medline]
Brown, D. D., Martz, S. N., Binder, O., Goetz, S. C., Price, B.
M., Smith, J. C. and Conlon, F. L. (2005). Tbx5 and Tbx20 act
synergistically to control vertebrate heart morphogenesis.
Development 132,553
-563.
Bruneau, B. G., Nemer, G., Schmitt, J. P., Charron, F.,
Robitaille, L., Caron, S., Conner, D. A., Gessler, M., Nemer, M., Seidman, C.
E. et al. (2001). A murine model of Holt-Oram syndrome
defines roles of the T-box transcription factor Tbx5 in cardiogenesis and
disease. Cell 106,709
-721.[CrossRef][Medline]
Burton, P. B., Raff, M. C., Kerr, P., Yacoub, M. H. and Barton,
P. J. (1999). An intrinsic timer that controls cell-cycle
withdrawal in cultured cardiac myocytes. Dev. Biol.
216,659
-670.[CrossRef][Medline]
Charbonnier, F., Gaspera, B. D., Armand, A. S., Van der Laarse,
W. J., Launay, T., Becker, C., Gallien, C. L. and Chanoine, C.
(2002). Two myogenin-related genes are differentially expressed
in Xenopus laevis myogenesis and differ in their ability to transactivate
muscle structural genes. J. Biol. Chem.
277,1139
-1147.
Cleaver, O. B., Patterson, K. D. and Krieg, P. A.
(1996). Overexpressoin of the tinman-related genes
XNkx-2.5 and XNkx-2.3 in Xenopus embryos results in myocardial
hyperplasia. Development
122,3549
-3556.[Abstract]
Cobrinik, D. (2005). Pocket proteins and cell
cycle control. Oncogene
24,2796
-2809.[CrossRef][Medline]
Fishman, M. C. and Chien, K. R. (1997).
Fashioning the vertebrate heart: earliest embryonic decisions.
Development 124,2099
-2117.[Abstract]
Garrity, D. M., Childs, S. and Fishman, M. C.
(2002). The heartstrings mutation in zebrafish causes heart/fin
Tbx5 deficiency syndrome. Development
129,4635
-4645.
Harland, R. M. (1991). In situ hybridization:
an improved whole-mount method for Xenopus embryos. Methods Cell
Biol. 36,685
-695.[Medline]
Harvey, R. P. (2002). Patterning the vertebrate
heart. Nat. Rev. Genet.
3, 544-556.[CrossRef][Medline]
Hatcher, C. J., Goldstein, M. M., Mah, C. S., Delia, C. S. and
Basson, C. T. (2000). Identification and localization of TBX5
transcription factor during human cardiac morphogenesis. Dev.
Dyn. 219,90
-95.[CrossRef][Medline]
Hatcher, C. J., Kim, M. S., Mah, C. S., Goldstein, M. M., Wong,
B., Mikawa, T. and Basson, C. T. (2001). TBX5 transcription
factor regulates cell proliferation during cardiogenesis. Dev.
Biol. 230,177
-188.[CrossRef][Medline]
Hiroi, Y., Kudoh, S., Monzen, K., Ikeda, Y., Yazaki, Y., Nagai,
R. and Komuro, I. (2001). Tbx5 associates with Nkx2-5 and
synergistically promotes cardiomyocyte differentiation. Nat.
Genet. 28,276
-280.[CrossRef][Medline]
Hochegger, H., Klotzbucher, A., Kirk, J., Howell, M., le
Guellec, K., Fletcher, K., Duncan, T., Sohail, M. and Hunt, T.
(2001). New B-type cyclin synthesis is required between meiosis I
and II during Xenopus oocyte maturation. Development
128,3795
-3807.
Hopwood, N. D., Pluck, A. and Gurdon, J. B.
(1989). MyoD expression in the forming somites is an early
response to mesoderm induction in Xenopus embryos. EMBO
J. 8,3409
-3417.[Medline]
Horb, M. E. and Thomsen, G. H. (1999). Tbx5 is
essential for heart development. Development
126,1739
-1751.[Abstract]
Kajstura, J., Leri, A., Castaldo, C., Nadal-Ginard, B. and
Anversa, P. (2004). Myocyte growth in the failing heart.
Surg. Clin. North Am.
84,161
-177.[CrossRef][Medline]
Kolker, S. J., Tajchman, U. and Weeks, D. L.
(2000). Confocal imaging of early heart development in Xenopus
laevis. Dev. Biol. 218,64
-73.[CrossRef][Medline]
Latinkic, B. V., Cooper, B., Towers, N., Sparrow, D., Kotecha,
S. and Mohun, T. J. (2002). Distinct enhancers regulate
skeletal and cardiac muscle-specific expression programs of the cardiac
alpha-actin gene in Xenopus embryos. Dev. Biol.
245, 57-70.[CrossRef][Medline]
Li, Q. Y., Newbury-Ecob, R. A., Terrett, J. A., Wilson, D. I.,
Curtis, A. R., Yi, C. H., Gebuhr, T., Bullen, P. J., Robson, S. C., Strachan,
T. et al. (1997). Holt-Oram syndrome is caused by mutations
in TBX5, a member of the Brachyury (T) gene family. Nat.
Genet. 15,21
-29.[CrossRef][Medline]
Liberatore, C. M., Searcy-Schrick, R. D. and Yutzey, K. E.
(2000). Ventricular expression of tbx5 inhibits normal heart
chamber development. Dev. Biol.
223,169
-180.[CrossRef][Medline]
MacLellan, W. R. and Schneider, M. D. (2000).
Genetic dissection of cardiac growth control pathways. Annu. Rev.
Physiol. 62,289
-319.[CrossRef][Medline]
Mandel, E. M., Callis, T., Wang, D.-Z. and Conlon, F. L.
(2005). Transcriptional mechanisms of congenital heart disease.
Drug Discov. Today Dis. Mech.
2, 33-38.
McKinsey, T. A., Zhang, C. L. and Olson, E. N.
(2002). MEF2: a calcium-dependent regulator of cell division,
differentiation and death. Trends Biochem. Sci.
27, 40-47.[CrossRef][Medline]
Mikawa, T., Borisov, A., Brown, A. M. and Fischman, D. A.
(1992a). Clonal analysis of cardiac morphogenesis in the chicken
embryo using a replication-defective retrovirus: I. Formation of the
ventricular myocardium. Dev. Dyn.
193, 11-23.[Medline]
Mikawa, T., Cohen-Gould, L. and Fischman, D. A.
(1992b). Clonal analysis of cardiac morphogenesis in the chicken
embryo using a replication-defective retrovirus. III: polyclonal origin of
adjacent ventricular myocytes. Dev. Dyn.
195,133
-141.[Medline]
Mohun, T., Orford, R. and Shang, C. (2003). The
origins of cardiac tissue in the amphibian, Xenopus laevis. Trends
Cardiovasc. Med. 13,244
-248.[CrossRef][Medline]
Mohun, T. J., Leong, L. M., Weninger, W. J. and Sparrow, D.
B. (2000). The morphology of heart development in Xenopus
laevis. Dev. Biol. 218,74
-88.[CrossRef][Medline]
Newbury-Ecob, R. A., Leanage, R., Raeburn, J. A. and Young, I.
D. (1996). Holt-Oram syndrome: a clinical genetic study.
J. Med. Genet. 33,300
-307.
Nieuwkoop, P. D. (1967). The
"organization centre". 3. Segregation and pattern formation in
morphogenetic fields. Acta Biotheor.
17,178
-194.[Medline]
Olson, E. N. and Schneider, M. D. (2003).
Sizing up the heart: development redux in disease. Genes
Dev. 17,1937
-1956.
Papaioannou, V. E. and Silver, L. M. (1998).
The T-box gene family. BioEssays
20, 9-19.[CrossRef][Medline]
Pasumarthi, K. B. and Field, L. J. (2002).
Cardiomyocyte cell cycle regulation. Circ. Res.
90,1044
-1054.
Plageman, T. F., Jr and Yutzey, K. E. (2004).
Differential expression and function of Tbx5 and Tbx20 in cardiac development.
J. Biol. Chem. 279,19026
-19034.
Rybkin, I. I., Markham, D. W., Yan, Z., Bassel-Duby, R.,
Williams, R. S. and Olson, E. N. (2003). Conditional
expression of SV40 T-antigen in mouse cardiomyocytes facilitates an inducible
switch from proliferation to differentiation. J. Biol.
Chem. 278,15927
-15934.
Showell, C., Binder, O. and Conlon, F. L.
(2004). T-box genes in early embryogenesis. Dev.
Dyn. 229,201
-218.[CrossRef][Medline]
Small, E. M. and Krieg, P. A. (2000).
Expression of atrial natriuretic factor (ANF) during Xenopus cardiac
development. Dev. Genes Evol.
210,638
-640.[CrossRef][Medline]
Soonpaa, M. H. and Field, L. J. (1998). Survey
of studies examining mammalian cardiomyocyte DNA synthesis. Circ.
Res. 83,15
-26.
Stennard, F. A. and Harvey, R. P. (2005). T-box
transcription factors and their roles in regulatory hierarchies in the
developing heart. Development
132,4897
-4910.
Tonissen, K. F., Drysdale, T. A., Lints, T. J., Harvey, R. P.
and Krieg, P. A. (1994). XNkx-2.5, a Xenopus gene related to
Nkx-2.5 and tinman: evidence for a conserved role in cardiac development.
Dev. Biol. 162,325
-328.[CrossRef][Medline]
Trinh, L. A. and Stainier, D. Y. (2004).
Fibronectin regulates epithelial organization during myocardial migration in
zebrafish. Dev. Cell 6,371
-382.[CrossRef][Medline]
Vernon, A. E. and Philpott, A. (2003). The
developmental expression of cell cycle regulators in Xenopus laevis.
Gene Expr. Patterns 3,179
-192.[CrossRef][Medline]
Wang, Z. F., Ingledue, T. C., Dominski, Z., Sanchez, R. and
Marzluff, W. F. (1999). Two Xenopus proteins that bind the
3' end of histone mRNA: implications for translational control of
histone synthesis during oogenesis. Mol. Cell. Biol.
19,835
-845.
Whitmire, E., Khan, B. and Coue, M. (2002).
Cdc6 synthesis regulates replication competence in Xenopus oocytes.
Nature 419,722
-725.[CrossRef][Medline]
Wilson, P. A. and Hemmati-Brivanlou, A. (1995).
Induction of epidermis and inhibition of neural fate by Bmp-4.
Nature 376,331
-333.[CrossRef][Medline]
Wilson, V. and Conlon, F. L. (2002). The T-box
family. Genome Biol. 3,REVIEWS3008
.[Medline]
This article has been cited by other articles:
![]() |
A. Rojas, S. W. Kong, P. Agarwal, B. Gilliss, W. T. Pu, and B. L. Black GATA4 Is a Direct Transcriptional Activator of Cyclin D2 and Cdk4 and Is Required for Cardiomyocyte Proliferation in Anterior Heart Field-Derived Myocardium Mol. Cell. Biol., September 1, 2008; 28(17): 5420 - 5431. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Movassagh and A. Philpott Cardiac differentiation in Xenopus requires the cyclin-dependent kinase inhibitor, p27Xic1 Cardiovasc Res, August 1, 2008; 79(3): 436 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Georges, G. Nemer, M. Morin, C. Lefebvre, and M. Nemer Distinct Expression and Function of Alternatively Spliced Tbx5 Isoforms in Cell Growth and Differentiation Mol. Cell. Biol., June 15, 2008; 28(12): 4052 - 4067. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. G. Langdon, S. C. Goetz, A. E. Berg, J. T. Swanik, and F. L. Conlon SHP-2 is required for the maintenance of cardiac progenitors Development, November 15, 2007; 134(22): 4119 - 4130. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kitamura, T. Takahashi, N. Nakajima, K. Isodono, S. Asada, H. Ueno, T. Ueyama, T. Yoshikawa, H. Matsubara, and H. Oh Stage-Specific Role of Endogenous Smad2 Activation in Cardiomyogenesis of Embryonic Stem Cells Circ. Res., July 6, 2007; 101(1): 78 - 87. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||