|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 14 June 2006
doi: 10.1242/dev.02435
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institute of Neuroscience, 1254 University of Oregon, Eugene, OR, USA.
* Author for correspondence (e-mail: gage{at}uoneuro.uoregon.edu)
Accepted 9 May 2006
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Craniofacial, Skeleton, Zebrafish, Moz, Hox, Morphogenesis
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
),
yet how Hox genes control segment-specific organ shape at the cellular level
is poorly understood. The vertebrate facial skeleton is derived from cranial
neural crest cells (CNC) arranged into a series of segments, or `arches', of
the pharynx (Le Douarin,
1982). In zebrafish, CNC of the second (hyoid) segment express
hoxa2b and hoxb2a and generate the support skeleton for the
jaw and gill cover, whereas first (mandibular) segment CNC do not express Hox
genes and generate the jaw skeleton (Hunt
et al., 1991; Schilling and
Kimmel, 1994). In diverse vertebrates, loss of the Hox2 genes,
Hoxa2 or hoxa2b/hoxb2a, causes a mirror-image duplication of
the jaw skeleton to form in the second segment
(Gendron-Maguire et al., 1993;
Hunter and Prince, 2002;
Miller et al., 2004;
Rijli et al., 1993). In a
reciprocal manner, forced expression of Hoxa2 throughout the first
segment causes partial transformation of the jaw skeleton toward a
second-segment skeletal morphology
(Grammatopoulos et al., 2000;
Hunter and Prince, 2002;
Pasqualetti et al., 2000).
moz encodes a histone acetyltransferase required to maintain Hox
expression in the hindbrain and in postmigratory CNC and epithelia of the
second segment (Fig. 1)
(Miller et al., 2004). In
wild-type larvae, the first-segment-derived skeleton includes Meckel's (M) and
palatoquadrate (Pq) cartilages, which form the primary lower and upper jaw
elements, respectively. The second-segment-derived support skeleton includes
the ceratohyal (Ch) cartilage, the hyosymplectic (Hs) cartilage [composed of
hyomandibular (Hm) and symplectic (Sy) elements], which bridges the upper jaw
to the ear, and opercular (Op) and branchiostegal ray (Br) dermal bones, which
support the gill cover (Fig.
2A). In moz mutants, second-segment support cartilages
are replaced by an extra set of jaw-like cartilages, M-like (M') and Pq-like
(Pq'), and second-segment dermal bones are lost
(Fig. 2B)
(Miller et al., 2004). This
`homeotic' phenotype resembles that seen in zebrafish with hoxa2b and
hoxb2a function reduced by morpholinos
[Fig. 2C and Hunter and Price
(Hunter and Prince, 2002);
hereafter referred to as hox2-MO animals]. We chose to focus our
study on the moz mutant for several reasons. First, the moz
mutant phenotype is more consistently expressive than the phenotype seen in
hox2-MO larvae. Second, whereas Moz is required for the maintenance
of Hox expression in postmigratory CNC, Moz is not required for earlier Hox
expression at premigratory stages (Miller
et al., 2004). Because early Hox expression and neural crest
induction and migration are normal in moz mutants, studying
moz allows us to selectively probe the postmigratory functions of Hox
genes in skeletal patterning.
Moz is required not only for hoxa2b and hoxb2a expression
in second-segment CNC but also for hoxa2b expression in a subset of
ectoderm and endoderm that surrounds second-segment CNC (this work)
(Miller et al., 2004). It is
clear from studies in chicken, zebrafish and mouse that signals from the
ectoderm and endoderm pattern the CNC-derived facial skeleton
(Couly et al., 2002;
Crump et al., 2004a;
Crump et al., 2004b;
Eberhart et al., 2006;
Helms and Schneider, 2003;
Piotrowski and Nusslein-Volhard,
2000; Ruhin et al.,
2003). Although Hox2 genes are expressed in the ectoderm and
endoderm, the skeletal patterning function of Hox2 expression in these tissues
has not been directly tested. Using tissue mosaic experiments in zebrafish, in
which we selectively restored or removed Moz or Hoxa2b/Hoxb2a function from
specific facial tissues, we demonstrate that Moz and Hox2 genes function in
CNC, but not in the ectoderm or endoderm, for patterning of the
second-segment-derived skeleton. Next, we used single cell labelling and
time-lapse analysis to show that Moz specifies the fate map of second-segment
skeletal precursors. In particular, dorsal second-segment CNC, which form part
of the Hs cartilage and Op dermal bone in wild type, fail to undergo skeletal
differentiation in moz mutants, effectively positioning the duplicate
jaw-like skeleton more ventrally. Additionally, whereas p1 endoderm is crucial
for normal Hs cartilage development (Crump
et al., 2004b), the moz- jaw-like cartilage
(Pq') that replaces Hs does not require p1. We conclude that an important
CNC-intrinsic function of Moz is to confer competence on skeletogenic CNC to
respond to spatially restricted endodermal, and perhaps ectodermal, signals.
Hence, normal Moz-dependent Hox expression determines where in the second
segment skeletal differentiation occurs, thus establishing the spatial
geometry of a support skeleton.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Lawson and Weinstein, 2002;
Miller et al., 2004). In the
construction of the moz; fli1:GFP strain we discovered that
fli1:GFP and moz were tightly linked on LG5 (2/100
recombinants from a moz x fli1:GFP cross). Once
constructed, the brighter fluorescence of homozygous moz;
fli1:GFP embryos allowed us to greatly enrich for moz
mutants at 24 hours postfertilization (hpf).
Phenotypic analysis
Facial skeletons were stained with Alcian Green, and flat mount dissections
were performed as described (Crump et al.,
2004a; Crump et al.,
2004b). Whole-mount in-situ hybridization and the hoxb2a
probe are as described (Miller et al.,
2004). As the previously described hoxa2b probe
(Miller et al., 2004) was
found to cross-react with fli1:GFP, we used genespecific primers
containing the T3 promoter to amplify and synthesize the probe. Primers used
were 5': ACCCTGGTCCACTATACTTC and 3':
CGCGCAATTAACCCTCACTAAAGGGGAAATCAAAGGCCTCCGTAG. For frozen sections, larvae
were embedded in a mixture of 0.9% agar, 1% low melt agarose and 5% sucrose,
frozen by suspension above liquid nitrogen, and cut at 16-µm intervals with
a Leica CM3050S cryotome. Insitu hybridization was then performed on frozen
sections as described (Rodriguez-Mari et
al., 2005). hoxa2b-MO and hoxb2a-MO were
injected together into 1-cell embryos at 5 mg/ml each in a 3-nl volume
(Miller et al., 2004).
Transplants and microelectroporation
Alexa-568-labelled CNC, endoderm and neural precursors were transplanted at
shield stages as described (Crump et al.,
2004a; Crump et al.,
2004b). The transplant technique for facial surface ectoderm
precursors was similar to that described for CNC transplants
(Crump et al., 2004b), except
that donor ectoderm was placed 120° from dorsal and midway between the
margin and animal pole of host embryos at shield stage. All transplants were
unilateral, and, except where indicated otherwise, both donors and hosts
harboured fli1:GFP. For CNC, ectoderm and endoderm transplants,
animals were selected for analysis if donor tissue constituted at least half
of second-segment CNC, ectoderm or endoderm based on inspection in a
fluorescence dissecting microscope. Microelectroporations were performed as
described (Crump et al., 2004b;
Lyons et al., 2003). Each
point represents a cell or the centroid of a pair of cells in an individual.
Lateral and dorsal cross-sectional views were made at the level of labelled
cells using Zeiss LSM software and plotted onto schematics of generalized
pharyngeal segments.
|
) at the one-cell stage. At 28-32 hpf, embryos were
mounted in 0.2% agarose and, using a Biorad Radiance 2100 multi-photon
microscope, a preliminary scan was performed to localize p1. Then, using the
ROI tool of the Biorad Lasersharp software to select only p1, we irradiated p1
for 5 minutes with a 10 W Millenia/Tsunami (Spectraphysics) laser tuned to 780
nm and at 100% power. Scans taken immediately after irradiation showed that
the Kaede protein was efficiently converted to red emission specifically in p1
(data not shown). Embryos were re-imaged 4 hours post-irradiation using
Nomarski polarization and fixed at 5 days postfertilization (dpf) for Alcian
staining. In approximately half of irradiated animals, Nomarski imaging
revealed that p1 cells were visibly damaged compared with neighbouring
unirradiated cells. In a fraction of animals, p1 cells did not appear damaged
and no cartilage defects were observed. Thus, we only used animals in which p1
was visibly damaged for our skeletal analysis.
Microscopy
Digital images of facial skeletons and in situ hybridization were obtained
on a Zeiss Axiophot 2 microscope using Axiocam software. Levels were uniformly
adjusted using Adobe Photoshop CS2 software. Fluorescent imaging and
time-lapse recordings were done on a Zeiss LSM5 Pascal confocal microscope as
described (Crump et al.,
2004b). Except when indicated otherwise, anterior is to the left
and ventral is down in all panels.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Hunt et al., 1991;
Maconochie et al., 1999) and
hoxa2b and hoxb2a in zebrafish
(Hunter and Prince, 2002;
Miller et al., 2004) are less
well characterized outside the CNC. Hence, we examined hoxa2b and
hoxb2a expression in horizontal sections of zebrafish larvae at 34
hpf, a time after CNC migration (11-18 hpf) but before the first
skeletogenesis (52 hpf) (Fig.
1A,C). In accord with previous whole-mount analysis
(Hunter and Prince, 2002;
Miller et al., 2004), sections
show that both hoxa2b and hoxb2a are expressed in
postmigratory CNC. In addition, hoxa2b, but not hoxb2a, is
expressed in a small region of ventral ectoderm extending from the anterior
portion of the second pharyngeal segment into the first segment. This
ectodermal expression appears similar to that described for mouse
Hoxa2 (Maconochie et al.,
1999). However, we did not detect widespread expression of
hoxa2b or hoxb2a in second-segment ectoderm. In the
endoderm, hoxa2b, but not hoxb2a, was expressed in the
second pouch but not in the first pouch or endoderm medial to second-segment
CNC. Thus, as reported for Hoxa2 in other vertebrates, zebrafish
hoxa2b is expressed in a very limited pattern in the pharyngeal
ectoderm and endoderm, and hoxb2a pharyngeal expression is restricted
to CNC. Lastly, we found hoxa2b and hoxb2a expression to be
either absent or very reduced in the CNC, ectoderm, and endoderm of
moz- larvae (Fig.
1B,D).
|
The rescue of moz- skeletal transformations by wild-type CNC shows that Moz need only be functional in second-segment CNC for a normal support skeleton to develop. In order to test if Moz is required in CNC for support skeletal development, we transplanted moz- CNC precursors into wild-type hosts to generate animals in which Moz is selectively lost in CNC. When we examined animals in which a large proportion of the second segment consisted of moz- CNC, the support skeleton was largely transformed into a jaw-like character (Fig. 2M-P), similar to that seen in fully moz- animals. Further analysis suggested that the lack of a complete transformation was due to remaining wild-type CNC in the second segment. In order to create animals in which the entire second segment was populated by moz- CNC, we made use of a newly discovered mutant, b1092. Homozygous b1092 mutants lack all CNC-derived skeletal elements due to a defect in CNC generation, and this defect is completely rescued by wild-type CNC transplants (J.G.C., unpublished). When instead of wild-type CNC we transplanted moz- CNC into b1092 mutants, we observed that second segments of normal appearance formed early (Fig. 2Q,R) and hoxa2b expression was lost in second-segment CNC (Fig. 1E). In these `rescued' moz- second segments, we observed transformed jaw-like skeletons, indistinguishable from those seen in fully moz- animals (Fig. 2S,T). Thus, the function of Moz in CNC is both necessary and sufficient to explain all the facial skeleton defects seen in moz mutants.
Our results from CNC transplants suggest that Moz has no skeletal patterning functions in non-CNC tissues. In order to examine functions of Moz directly in the ectoderm, endoderm and neural tube, we tested whether wild-type transplants of each of these tissues could restore normal skeletal development to moz- hosts (Fig. 3). We used high-resolution confocal imaging to confirm that wild-type donor cells were targeted to individual tissues (Fig. 3), and for wild-type ectoderm transplants we verified that hoxa2b was expressed in the ectoderm but not the CNC of moz- hosts (Fig. 1F). However, we found that transplants of wild-type ectoderm, endoderm or neural tube precursors were unable to rescue moz- skeletal transformations. Thus, we do not detect a role for ectodermal and endodermal hoxa2b expression in patterning the support skeleton.
Hox genes are CNC-autonomous effectors of Moz in facial skeletal patterning
Previous analysis of moz mutants strongly suggested that Moz
regulates skeletal patterning through the regulation of Hox2 genes:
hoxa2b and hoxb2a expression are lost in moz
mutants and the knockdown of hoxa2b and hoxb2a largely
phenocopies the homeotic transformations seen in moz
(Hunter and Prince, 2002;
Miller et al., 2004). Thus, we
tested whether Hox2 function, like Moz, is also sufficient in CNC to specify a
support skeleton. In order to create embryos in which Hox2 function is
eliminated in all tissues except CNC, we transplanted wild-type CNC precursors
into hox2-MO larvae (Fig.
2C,D). Upon skeletal analysis, we observed that wild-type CNC
fully rescued hox2-MO skeletal transformations. Thus, Hox2 genes need
only be functional in CNC for support skeleton development.
In addition, we tested whether Moz regulates Hox2 expression cell-autonomously. Using wild type to moz- and moz- to wild type CNC transplants, we created second segment mosaics for wild-type and moz- CNC and then examined these segments for hoxb2a expression (Fig. 4). We found a striking positive correlation between hoxb2a expression and the localization of wild-type CNC in the mosaic segments. Interestingly, we frequently observed a spatial segregation of wild-type and moz- CNC, with moz- CNC occupying more ventral and anterior regions. Thus, whereas in fully moz- animals CNC can occupy the entire second segment, our mosaic experiments suggest that there may be adhesive differences between wild-type and moz- CNC that are revealed by competition.
|
). We
extend our previous work (Crump et al.,
2004b; Eberhart et al.,
2006) and present here a fate map of wild-type animals at 24 hpf
that includes cartilage (chondrocyte) precursors of the first two segments and
dermal bone (osteocyte) precursors of the second segment
(Fig. 5; see Fig. S1 in the
supplementary material). In the second segment, the anterior portion of the Hm
cartilage, the uppermost element, arises from a dorsal CNC domain along p1
endoderm. The Sy cartilage derives from dorsoventrally intermediate CNC, also
along p1, and a more ventral CNC domain, close to medial pharyngeal endoderm,
gives rise to Ch. By contrast, Op and Br dermal bone precursors map to the
lateral domain of the second segment, immediately below the surface ectoderm.
In the first segment, precursors of the Pq cartilage, the uppermost element,
are located in a dorsoventrally intermediate domain, and M precursors are
located in the ventral domain. Thus, the differences in the dorsoventral
extent of the normal jaw and support skeletons result from the first-segment
upper element, Pq, deriving from dorsoventrally intermediate CNC and the
second-segment upper element, Hm, deriving from dorsal CNC.
|
|
Moz is required for the development of cartilage precursors adjacent to p1
As second-segment CNC along dorsal p1 endoderm fail to make cartilage in
moz mutants, we made time-lapse recordings of wild-type and
moz- skeletal development to further examine the
Moz-dependent interaction of dorsal cartilage precursors with p1. In the
wild-type example, CNC are doubly labelled by fli1:GFP
(Lawson and Weinstein, 2002)
and mosaic transplantation of dye-labelled CNC
(Fig. 6A; see Movie 1 in the
supplementary material). As we reported previously
(Crump et al., 2004b), in the
wild-type second segment, dorsal CNC adjacent (and posterior) to p1 at 36 hpf
form the anterior half of the Hm cartilage by 84 hpf. By contrast, in the
first segment, dorsal CNC adjacent (and anterior) to p1 do not contribute to
jaw cartilage by 84 hpf. Instead, in agreement with our 24 hpf fate map
analysis, dorsoventrally intermediate first-segment CNC contribute to the Pq
cartilage.
Next, we made time-lapse recordings of moz-
second-segment skeletal development (Fig.
6B; see Movie 2 in the supplementary material). Consistent with
previous analyses (Miller et al.,
2004), we observe that the structure of the CNC segments at the
beginning of the recordings is largely normal in moz-
animals. By the end of the recordings, we observe that dorsal CNC of the
second segment do not form cartilage and instead a more ventral domain of CNC
contributes to Pq'. In particular, by contrast to wild-type CNC,
moz- CNC along the dorsal portion of p1 fail to chondrify.
To test if Moz controls chondrification cell-autonomously in CNC, we made
time-lapse recordings of moz- hosts in which a small
number of transplanted wild-type CNC precursors populated the dorsal second
segment (Fig. 6C; see Movie 3
in the supplementary material). The wild-type CNC along the dorsal portion of
p1 expanded normally and formed cartilage in an otherwise
moz- environment (Fig.
6D). We conclude that Hox2 expression in zebrafish specifies the
dorsal support skeleton by promoting, in a cell-autonomous manner, the
expansion and chondrification of CNC adjacent to p1 endoderm.
|
), we asked
whether p1 is required for the development of the jaw-like Pq' cartilage that
replaces Hm and Sy in moz- animals. In
itga5b926 mutants, in which p1 fails to develop,
second-segment-derived anterior Hm and Sy cartilage elements are selectively
lost, yet the first-segment-derived Pq and M cartilages form normally
(Fig. 7A-D)
(Crump et al., 2004b). In our
previous study (Crump et al.,
2004b), the presence of the fli1:GFP transgene allowed us
to select itga5b926 mutants in which p1 was absent. This
live selection was crucial, as only itga5b926 mutants
lacking p1 have subsequent cartilage loss. Thus, we used live selection to
examine skeletal morphology in moz-; itga5b926;
fli1:GFP double mutants in which p1 was completely absent. In
moz-; itga5b926; fli1:GFP mutants
lacking p1, the second-segment-derived Pq' and M' cartilages were similar in
morphology to those in moz single mutants
(Fig. 7G-J). However, we did
observe increased fusions between Pq' and Pq in moz-;
itga5b926 mutants, consistent with pouches also acting as
barriers between the cartilage-forming CNC of neighbouring segments
(Crump et al., 2004a;
Piotrowski and Nusslein-Volhard,
2000). We also independently probed the requirement for p1 in
wild-type and moz- skeletal development by eliminating p1
with laser ablation. As with the genetic loss of p1, the laser ablation
resulted in the loss of wild-type, but not moz-,
second-segment skeletal derivatives (Fig.
7E,F,K,L). In conclusion, we find that, by contrast to normal
second-segment derivatives, the duplicate jaw-like cartilages that form from
moz- second segments do not require p1 endoderm, and, by
inference, must be responding to a different source of signals from those that
induce the wild-type support skeleton.
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Rijli et al.,
1993), Hox genes have largely been assumed to function within
skeletal precursors to confer their distinct characters. Yet Hox genes also
have limited expression in the ectoderm and endoderm that surround the
skeletogenic CNC (this study) (Couly et
al., 1998; Hunt et al.,
1991; Maconochie et al.,
1999). Indeed, misexpression studies suggest that Hoxa2
confers regional identity on the ectoderm and endoderm and that this
specification is important for inductive signalling to CNC
(Couly et al., 1998;
Grammatopoulos et al., 2000).
By contrast, our mosaic analyses revealed a Hox2 skeletal patterning role only
in CNC in moz- and hox2-MO embryos, which lack
hoxa2b and hoxb2a expression and function in all facial
tissues: specific loss of Moz function in CNC gives homeotic skeletal
transformations as severe as those seen in fully moz-
animals, and restoring Moz function specifically in CNC completely rescues
moz- support skeleton development. Moz probably acts
through Hox2 genes, as we find that Moz controls Hox2 expression
cell-autonomously in CNC, and wild-type CNC also completely rescue
hox2-MO skeletal defects. Furthermore, as Moz is required for the
maintenance of Hox2 expression in postmigratory CNC, but not for Hox
expression in premigratory CNC, our moz- CNC into
wild-type mosaics demonstrate a late skeletal patterning function for Hox2
expression in postmigratory CNC. Recent experiments in mouse, in which
Hoxa2 function was eliminated specifically in postmigratory CNC,
demonstrate that the late CNC-specific function of Hox2 genes in skeletal
patterning is conserved from fish to mammals
(Santagati et al., 2005).
We find that Moz-dependent Hox2 expression in CNC, in the absence of Hox2
expression in the endoderm and ectoderm, is entirely sufficient to generate a
second-segment-derived support skeleton. The lack of a role for Hox2 genes in
the ectoderm might seem to contradict previous experiments in avian and
amphibian embryos (Couly et al.,
1998; Creuzet et al.,
2002; Grammatopoulos et al.,
2000), showing that Hoxa2 needs to be misexpressed
throughout the embryo, not just in CNC, in order to induce the formation of
second-segment skeletal derivatives from first-segment CNC. The results were
interpreted to mean that CNC require a signal from Hoxa2-expressing
ectoderm. Alternatively, it is known that first and second arch ectoderm
differ in more than just Hox expression, e.g. pitx2 expression,
normally present in the first segment, does not turn on ectopically in the
moz- second segment
(Miller et al., 2004).
Strikingly, in mice, new elements (e.g. a pterygoquadrate-like cartilage)
arise in the Hoxa2-/- second segment that do not form in
the wild-type first segment (Rijli et al.,
1993), suggesting that first and second arch epithelia (including
the ectoderm) have different skeletal-inducing properties even in the absence
of Hox2 expression. One possibility is that first, but not second, segment
epithelium has an inhibitory influence on the development of Hox-expressing
CNC. Our analyses would not detect such an influence, but the misexpression
studies would. Nonetheless, our work shows that Hox2 expression in the
ectoderm and endoderm is not required for the specification of second-segment
skeletal derivatives.
Furthermore, our detailed expression analyses support the same conclusion.
In the pharynx, only hoxa2b is expressed outside CNC, and it is
expressed in very limited domains of first and second-segment ectoderm and
endoderm. We detect no hoxa2b or hoxb2a expression in p1
endoderm, an epithelial domain that we have shown to be crucial for support
skeleton development (Crump et al.,
2004a; Crump et al.,
2004b). Moreover, zebrafish hoxa2b and mouse
Hoxa2 are expressed in only a small domain of ectoderm at the first
and second segment boundary (this study)
(Hunter and Prince, 2002;
Maconochie et al., 1999), and
avian Hoxa2 ectoderm expression is reported only in a small domain at
the second and third segment boundaries
(Couly et al., 1998). Thus, the
lack of widespread Hox2 expression in second-segment ectoderm and endoderm is
consistent with Hox2 genes not having skeletal patterning functions in
second-segment epithelia. However, we stress that Hox genes probably have
other functions in the facial ectoderm and endoderm, separate from skeletal
patterning, that we have not addressed here. The facial ectoderm and pouch
endoderm undergo complex patterns of morphogenesis that generate endocrine
organs and gill elaborations (Hogan et
al., 2004), and Hoxa3, for example, has been suggested to function
in the endoderm for development of the thymus and parathyroid
(Manley and Capecchi,
1998).
CNC-intrinsic factors regulate skeletogenesis in response to spatially restricted extrinsic signals
A longstanding debate is the extent to which extrinsic and intrinsic cues
instruct facial skeletal patterning. Noden proposed that CNC are intrinsically
`prepatterned' (Noden, 1983;
Trainor et al., 2002). By
contrast, numerous studies suggest that extrinsic signals from the pharyngeal
endoderm and oral ectoderm pattern the facial skeleton
(Couly et al., 2002;
Crump et al., 2004a;
Crump et al., 2004b;
Eberhart et al., 2006;
Helms and Schneider, 2003;
Piotrowski and Nusslein-Volhard,
2000; Ruhin et al.,
2003). Hox genes determine segment-specific organ structure in
diverse animals and have been assumed to pattern distinct `identities' within
sets of cells that begin development identically from segment to segment.
However, our wild-type and moz- fate maps show that the
CNC skeletal primordia are positionally non-equivalent in adjacent segments.
Thus, Hox genes select which cells in a segment will make skeleton, rather
than selecting what sort of skeleton comes from pre-specified cells.
How are these preskeletal CNC subsets selected? We show that Hox2 genes instruct CNC to respond to cues from particular local epithelia, one of which is p1 endoderm. Wild-type second-segment CNC along dorsal p1 form support cartilage, yet positionally equivalent wild-type first-segment, or moz- second-segment CNC, do not contribute to jaw-like cartilages. A few wild-type first-segment CNC and moz- second-segment CNC near ventral-medial p1 do in fact give rise to jaw and jaw-like cartilages. However, when p1 is genetically removed or laser ablated, jaw and jaw-like cartilages are not affected. Thus, even those non-Hox-expressing CNC close to p1 may not depend on p1 for their development.
In addition, a prominent feature of zebrafish moz mutants and mouse Hoxa2 mutants is the mirror-image symmetry of the skeletal duplications, with the axis of symmetry at the boundary between the first and second segment. p1 endoderm, at this boundary, is clearly not responsible for mirror-image skeletal duplications, because jaw and jaw-like cartilages are unaffected by its absence. Furthermore, both the jaw and moz- jaw-like cartilages derive from intermediate and ventral segmental domains, whereas p1 is dorsal. Thus, there are probably additional segmental boundary epithelial signalling centres that account for the mirror-image symmetry. Medial endoderm (Fig. S1A) and bmp4-expressing ventral ectoderm are good candidates.
Wild-type cartilage precursors fate map close to endoderm, whereas dermal
bone precursors develop adjacent to surface ectoderm. This segregation
suggests a model in which endoderm locally induces cartilage fate and ectoderm
induces dermal bone fate. Intriguingly, in moz mutants second-segment
Op and Br dermal bones fail to form, yet we know from work on the
itga5b926 mutant that dermal bone development does not
depend on the presence of p1 endoderm
(Crump et al., 2004b). Thus,
Moz-dependent Hox expression probably controls the response of CNC to more
than just p1 endoderm; signals to dermal bone precursors may come from the
ectoderm (Tyler and Hall,
1977). In addition, there is considerable overlap between the
wild-type and moz- fate maps in the ventral second
segment, and thus differences between support and jaw skeletons may also arise
by Hox2 genes controlling distinct morphogenetic behaviours of spatially
equivalent CNC in the first two segments
(O'Gorman, 2005).
In our model, postmigratory CNC encounter endodermal and ectodermal
epithelia that have the ability to induce cartilage and bone differentiation
in specific locations. Hox genes, functioning intrinsically, then instruct CNC
to undergo skeletogenesis in response to a subset of these epithelia, thus
positioning cartilage and dermal bone elements in the appropriate geometry.
Our findings are consistent with avian grafting experiments showing that
distinct domains of head endoderm control the shape and position of facial
skeletal elements (Couly et al.,
2002; Ruhin et al.,
2003). These studies concluded that non-Hox-expressing and
Hox-expressing CNC form separate equivalence groups, and that within these
equivalence groups the type of skeleton can be reprogrammed by the type of
grafted endoderm. However, the interaction might not be direct, as endoderm
has a role at premigratory CNC stages, when the avian endoderm grafts were
done, in patterning the facial ectoderm
(Haworth et al., 2004), which
is known to provide signals to skeletogenic CNC. In the future, the generation
of p1-specific markers will allow us to test whether p1 endoderm is sufficient
at postmigratory CNC stages to induce dorsal support cartilage in Hox-positive
but not Hox-negative CNC. At the same time, it will be important to identify
the downstream effectors of Hox2, and how this Hox2-dependent `set' regulates
the responses of CNC to specific epithelia.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/14/2661/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Ando, R., Hama, H., Yamamoto-Hino, M., Mizuno, H. and Miyawaki,
A. (2002). An optical marker based on the UV-induced
green-to-red photoconversion of a fluorescent protein. Proc. Natl.
Acad. Sci. USA 99,12651
-12656.
Couly, G., Grapin-Botton, A., Coltey, P., Ruhin, B. and Le Douarin, N. M. (1998). Determination of the identity of the derivatives of the cephalic neural crest: incompatibility between Hox gene expression and lower jaw development. Development 125,3445 -3459.[Abstract]
Couly, G., Creuzet, S., Bennaceur, S., Vincent, C. and Le Douarin, N. M. (2002). Interactions between Hox-negative cephalic neural crest cells and the foregut endoderm in patterning the facial skeleton in the vertebrate head. Development 129,1061 -1073.[Medline]
Creuzet, S., Couly, G., Vincent, C. and Le Douarin, N. M. (2002). Negative effect of Hox gene expression on the development of the neural crest-derived facial skeleton. Development 129,4301 -4313.
Crump, J. G., Maves, L., Lawson, N. D., Weinstein, B. M. and
Kimmel, C. B. (2004a). An essential role for Fgfs in
endodermal pouch formation influences later craniofacial skeletal patterning.
Development 131,5703
-5716.
Crump, J. G., Swartz, M. E. and Kimmel, C. B. (2004b). An integrin-dependent role of pouch endoderm in hyoid cartilage development. PLoS Biol. 2, E244.[CrossRef][Medline]
Eberhart, J. K., Swartz, M. E., Crump, J. G. and Kimmel, C.
B. (2006). Early Hedgehog signaling from neural to oral
epithelium organizes anterior craniofacial development.
Development 133,1069
-1077.
Gendron-Maguire, M., Mallo, M., Zhang, M. and Gridley, T. (1993). Hoxa-2 mutant mice exhibit homeotic transformation of skeletal elements derived from cranial neural crest. Cell 75,1317 -1331.[CrossRef][Medline]
Grammatopoulos, G. A., Bell, E., Toole, L., Lumsden, A. and Tucker, A. S. (2000). Homeotic transformation of branchial arch identity after Hoxa2 overexpression. Development 127,5355 -5365.[Abstract]
Haworth, K. E., Healy, C., Morgan, P. and Sharpe, P. T.
(2004). Regionalisation of early head ectoderm is regulated by
endoderm and prepatterns the orofacial epithelium.
Development 131,4797
-4806.
Helms, J. A. and Schneider, R. A. (2003). Cranial skeletal biology. Nature 423,326 -331.[CrossRef][Medline]
Hogan, B. M., Hunter, M. P., Oates, A. C., Crowhurst, M. O., Hall, N. E., Heath, J. K., Prince, V. E. and Lieschke, G. J. (2004). Zebrafish gcm2 is required for gill filament budding from pharyngeal ectoderm. Dev. Biol. 276,508 -522.[CrossRef][Medline]
Hombria, J. C. and Lovegrove, B. (2003). Beyond homeosis-HOX function in morphogenesis and organogenesis. Differentiation 71,461 -476.[CrossRef][Medline]
Hunt, P., Gulisano, M., Cook, M., Sham, M. H., Faiella, A., Wilkinson, D., Boncinelli, E. and Krumlauf, R. (1991). A distinct Hox code for the branchial region of the vertebrate head. Nature 353,861 -864.[CrossRef][Medline]
Hunter, M. P. and Prince, V. E. (2002). Zebrafish hox paralogue group 2 genes function redundantly as selector genes to pattern the second pharyngeal arch. Dev. Biol. 247,367 -389.[CrossRef][Medline]
Lawson, N. D. and Weinstein, B. M. (2002). In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol. 248,307 -318.[CrossRef][Medline]
Le Douarin, N. M. (1982). The Neural Crest. Cambridge: Cambridge University Press.
Lyons, D. A., Guy, A. T. and Clarke, J. D.
(2003). Monitoring neural progenitor fate through multiple rounds
of division in an intact vertebrate brain. Development
130,3427
-3436.
Maconochie, M., Krishnamurthy, R., Nonchev, S., Meier, P., Manzanares, M., Mitchell, P. J. and Krumlauf, R. (1999). Regulation of Hoxa2 in cranial neural crest cells involves members of the AP-2 family. Development 126,1483 -1494.[Abstract]
Manley, N. R. and Capecchi, M. R. (1998). Hox group 3 paralogs regulate the development and migration of the thymus, thyroid, and parathyroid glands. Dev. Biol. 195, 1-15.[CrossRef][Medline]
Miller, C. T., Maves, L. and Kimmel, C. B.
(2004). moz regulates Hox expression and pharyngeal segmental
identity in zebrafish. Development
131,2443
-2461.
Noden, D. M. (1983). The role of the neural crest in patterning of avian cranial skeletal, connective, and muscle tissues. Dev. Biol. 96,144 -165.[CrossRef][Medline]
O'Gorman, S. (2005). Second branchial arch lineages of the middle ear of wild-type and Hoxa2 mutant mice. Dev. Dyn. 234,124 -131.[Medline]
Pasqualetti, M., Ori, M., Nardi, I. and Rijli, F. M. (2000). Ectopic Hoxa2 induction after neural crest migration results in homeosis of jaw elements in Xenopus. Development 127,5367 -5378.[Abstract]
Piotrowski, T. and Nusslein-Volhard, C. (2000). The endoderm plays an important role in patterning the segmented pharyngeal region in zebrafish (Danio rerio). Dev. Biol. 225,339 -356.[CrossRef][Medline]
Rijli, F. M., Mark, M., Lakkaraju, S., Dierich, A., Dolle, P. and Chambon, P. (1993). A homeotic transformation is generated in the rostral branchial region of the head by disruption of Hoxa-2, which acts as a selector gene. Cell 75,1333 -1349.[CrossRef][Medline]
Rodriguez-Mari, A., Yan, Y. L., Bremiller, R. A., Wilson, C., Canestro, C. and Postlethwait, J. H. (2005). Characterization and expression pattern of zebrafish Anti-Mullerian hormone (Amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr. Patterns 5,655 -667.[CrossRef][Medline]
Ruhin, B., Creuzet, S., Vincent, C., Benouaiche, L., Le Douarin, N. M. and Couly, G. (2003). Patterning of the hyoid cartilage depends upon signals arising from the ventral foregut endoderm. Dev. Dyn. 228,239 -246.[CrossRef][Medline]
Santagati, F., Minoux, M., Ren, S. Y. and Rijli, F. M.
(2005). Temporal requirement of Hoxa2 in cranial neural crest
skeletal morphogenesis. Development
132,4927
-4936.
Schilling, T. F. and Kimmel, C. B. (1994). Segment and cell type lineage restrictions during pharyngeal arch development in the zebrafish embryo. Development 120,483 -494.[Abstract]
Trainor, P. A., Ariza-McNaughton, L. and Krumlauf, R.
(2002). Role of the isthmus and FGFs in resolving the paradox of
neural crest plasticity and prepatterning. Science
295,1288
-1291.
Tyler, M. S. and Hall, B. K. (1977). Epithelial influences on skeletogenesis in the mandible of the embryonic chick. Anat. Rec. 188,229 -239.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  C. B. Kimmel and J. K. Eberhart The midline, oral ectoderm, and the arch-0 problem Integr. Comp. Biol., June 2, 2008; (2008) icn048v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Laue, S. Daujat, J. G. Crump, N. Plaster, H. H. Roehl, Tubingen 2000 Screen Consortium, C. B. Kimmel, R. Schneider, and M. Hammerschmidt The multidomain protein Brpf1 binds histones and is required for Hox gene expression and segmental identity Development, June 1, 2008; 135(11): 1935 - 1946. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
