|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online July 11, 2006
doi: 10.1242/10.1242/dev.02466
Biologie du Développement, UMR 7009 CNRS/Universite Pierre et Marie Curie (Paris VI), Observatoire Océanologique, F-06230 Villefranche-sur-Mer, France.
e-mail: clare.hudson{at}obs-vlfr.fr; yasuo{at}obs-vlfr.fr
Accepted 30 May 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Nodal, Delta, Notch, Notochord, Ascidian, Ciona, Tunicate, Signalling relay
| INTRODUCTION |
|---|
|
|
|---|
We are using the invertebrate chordate embryos of Ciona
intestinalis as a model system to study cell fate specification during
embryogenesis. Ciona embryos develop with an invariant cell cleavage
pattern and development proceeds with a small number of cells, such that
gastrulation commences when the embryo consists of only 110 cells. Ascidian
embryogenesis has been traditionally considered an example of mosaic
development, as many embryonic territories are specified by the inheritance of
cytoplasmic determinants (Conklin,
1905
; Nishida,
2005
). Although this strategy undoubtedly plays an important role,
there are also an increasing number of examples in which cell-cell
interactions are indispensable for cell-type specification in ascidians
(reviewed by Nishida, 2002
;
Nishida, 2005
).
The notochord is one of the defining features of chordate embryos. It has
important structural and signalling roles during chordate development
(reviewed by Stemple, 2005
).
The ascidian larval notochord consists of 40 cells and is derived from two of
the four founder cell lineages of the eight-cell stage embryo. The anterior 32
notochord cells come from the A-line (anterior-vegetal) founder lineage,
whereas the posterior eight cells are generated from the B-line
(posterior-vegetal) founder lineage
(Nishida, 1987
). The former is
termed the primary notochord and the latter the secondary notochord.
Specification of both primary and secondary notochord fate depends upon
inductive cellular interactions (Nakatani
and Nishida, 1994
). FGF signalling during the 32- to 64-cell
stages is required for specification of all the notochord precursors, but
appears to act in a distinct manner in the two lineages (H.Y. and C.H.,
unpublished) (Darras and Nishida,
2001
; Kim and Nishida,
2001
; Minokawa et al.,
2001
; Nishida,
2003
). Each primary notochord precursor becomes fate restricted at
the 64-cell stage following a cell division that generates one notochord and
one neural precursor. FGF signals are required for the specification of the
fate restricted notochord precursors, which adopt a neural fate in the absence
of FGF signalling. In the secondary lineage, the temporal requirement of FGF
signalling during the 32- to 64-cell stages does not coincide with the fate
restriction of notochord precursors. Rather, it is required for the formation
of a precursor of mixed notochord and mesenchyme fate at the 64-cell stage,
which subsequently divides to give one notochord and one mesenchyme precursor
at the 76-cell stage. It remains to be fully understood how fate restricted
secondary notochord precursors are specified in the secondary lineages.
We have recently identified a localised signalling source, situated in
laterally positioned animal cells of the 32-cell embryo of Ciona
(Hudson and Yasuo, 2005
).
Nodal ligand was shown to be responsible for this activity and to pattern the
neural plate across its mediolateral axis. In this study, we show that Nodal
signals are required for the specification of the secondary notochord
precursor and that Nodal acts, in part, via a relay mechanism with a Delta
ligand.
| MATERIALS AND METHODS |
|---|
|
|
|---|
mRNA injection constructs and morpholinos
Ci-Su(H)DBM was generated by introducing mutations R218E, R220E,
R227E and Y228S into the DNA-binding domain of Ci-Su(H) by overlapextension
PCR. Mutations at these four sites result in a DNA-binding mutant that acts in
a dominant-negative manner (Wettstein et
al., 1997
). Three sets of PCR reactions were carried out using the
following primers on the cDNA clone citb043k14: Su(H)-RI-F,
5'-ggaattcaccatgtatcacccccaccacctacc-3'; Su(H)-RI-R,
5'-ggaattcacgaggcagtacgaagcatgttc-3'; Su(H)DBM-F,
5'-caacGAActcGAAtcacagacagtgagcacaGAGTCCctgc-3'; Su(H)DBM-R,
5'-gcagGGACTCtgtgctcactgtctgtgaTTCgagTTCgttg-3'. Two primer pairs,
Su(H)-RI-F/Su(H)DBM-R and Su(H)DBM-F/Su(H)-RI-R, were used in two independent
PCRs. These two PCR products were used as a template for a third PCR using
Su(H)-RI-F/Su(H)-RI-R primer pairs. Amplified DNA fragments were subcloned
into the EcoRI site of pRN3 vector
(Lemaire et al., 1995
).
Removal of the intracellular domain of Delta ligands has been shown to result
in a dominant-negative form (Chitnis et
al., 1995
; Sun and
Artavanis-Tsakonas, 1996
). Ci-dnDelta2 (dnDel2) was
generated by PCR using the following primer set on the cDNA clone cieg005o22:
05o22-RI-F, 5'-ggaattcaccatgagcatcaagcttatattacttc-3';
05o22(1170)-RI-R, 5'-ggaattcaccgctgacgtaagttgctgc-3'. Amplified
DNA was subcloned into the EcoRI site of pRN3. mRNA was synthesised
using the mMessage mMachine kit (Ambion). The construct used to make
Ci-tALK4/5/7 mRNA has been previously described
(Hudson and Yasuo, 2005
).
Delta2-Mo was purchased from Gene Tools (AGCTTGATGCTCATCGTTGTGTTTC),
Control-Mo was the standard fluorescent control morpholino supplied by Gene
Tools and Nodal-Mo has been described previously
(Hudson and Yasuo, 2005
).
Blastomere labelling
Blastomeres were labelled with CM-DiI (Molecular Probes) dissolved in colza
oil at a concentration of 10 mg/ml. Embryos were treated with SB431542 from
the 16-cell or DAPT from the 44-cell stage. When SB431542-treated embryos
reached the 64-cell stage, an oil droplet containing CM-DiI was injected into
B7.3 blastomeres on one side of the embryo under a Leica S8 APO
stereomicroscope. Labelling of B8.6 blastomeres of DAPT-treated embryos was
carried out when they reached to the 76-110 stages under a Zeiss upright
miscroscope with a 25x objective. Following labelling, embryos were
cultured in respective pharmacological inhibitors until the early tailbud
stage, when they were fixed in 4% paraformaldehyde in 0.5 M NaCl/0.1 M MOPS
for 20 minutes at room temperature. Fixed embryos were washed with PBS and
then mounted in VECTASHIELD with DAPI (Vector Laboratories). Bright field and
fluorescence images were captured with a Nikon D70 camera on an Olympus BX51
and processed using Photoshop (Adobe). Confocal images of the embryos were
acquired with a Leica SP2 confocal microscope and processed using ImageJ (NIH)
and Photoshop.
Embryo culture and manipulation
Blastomere names are those described by Conklin
(Conklin, 1905
) and lineages
are described by Nishida (Nishida,
1987
). Embryo culture, cytochalasin and SB431542 treatment and
micro-injection are described previously
(Hudson et al., 2003
;
Hudson and Yasuo, 2005
).
Unless stated otherwise, embryos were placed in SB431542 from the 16-cell
stage until the time of fixation, except that cleaving embryos fixed at the
early tailbud were washed at early gastrula stage and cultured in artificial
sea water until fixation. DAPT was purchased from Calbiochem and used at a
concentration of 100 µM. Embryos were placed in DAPT at the 44-cell stage,
which is just prior to the onset of Ci-Delta2 expression, until the
time of fixation. Injections were carried out at the following concentrations:
Control-Mo (1 mmol/l), Nodal-Mo (0.4 mmol/l), Delta2-Mo (0.125 mmol/l),
Su(H)DBM mRNA (1-1.5 µg/µl), dnDel2 mRNA (0.5 µg/µl),
tALK4/5/7 mRNA (0.5 µg/µl) and GFP mRNA (0.5 µg/µl). In some
cytochalasin B-treated embryos, the primary notochord was also perturbed
following morpholino injection. However, Ci-Noto1 expression in the
primary notochord in cleaving embryos was not affected by Nodal or Delta
inhibition (see Fig. 1 for
SB431542 treatment; 24/25 positive, 1/25 weak expression with Nodal-Mo; and
61/65 positive, 3/65 reduced expression with DAPT treatment). Therefore, only
embryos showing Ci-Noto1 expression in the primary notochord were
included in the analysis of cleavage-arrest experiments. For all data shown,
data was pooled from at least two independent experiments.
| RESULTS |
|---|
|
|
|---|
Nodal signalling and the b5.3 blastomere are required for secondary notochord fate
Despite the lack of a general requirement for Nodal for mesoderm and
endoderm fates, we found that SB431542 treatment selectively abolished
expression of Ci-Bra in the secondary notochord precursor, B8.6, when
analysed at the early gastrula stage (Fig.
2A). Inhibition of Nodal signalling by injection of Nodal-Mo also
caused a severe downregulation of Ci-Bra expression in B8.6.
Furthermore, no expression of the notochord marker Ci-Noto1 was
detected in the secondary notochord lineages at tailbud stages. In order to
identify the lineages expressing Ci-Noto1 at late stages, embryos
were treated with cytochalasin-B from the 110-cell stage to arrest cytokinesis
and thus maintain the relative position of each cell from the 110-cell
stage.
In order to test whether the Nodal signal responsible for secondary
notochord induction derives from the b6.5 blastomere, we ablated the mother
cell of this blastomere, b5.3. Ablation of b5.3 was previously shown to have a
stronger effect on lateral neural plate marker gene expression than ablation
of b6.5 itself (Hudson and Yasuo,
2005
). We found that ablation of b5.3 resulted in a severe
reduction in Ci-Bra expression in the secondary notochord on the
ablated side (Fig. 2B). In
these experiments, 29% of embryos still showed some level of Ci-Bra
expression in B8.6 on the ablated side. This may be due to the recovery of
Ci-Nodal expression in other bline cells on the ablated side, which
we observed in 26% of cases when analysed at the 76-cell stage
(n=87). This is consistent with a recent study showing that removal
of embryonic parts can result in alterations in cell contacts, subsequently
resulting in ectopic induction of gene expression
(Tassy et al., 2006
). We
conclude that Ci-Nodal signalling from b-line cells plays a major role during
the specification of secondary notochord fate.
The secondary notochord precursor forms following the division of B7.3,
which gives rise to one notochord (B8.6) and one mesenchyme (B8.5) precursor.
Of these two cells, the notochord precursor becomes positioned closest to
where the Nodal expressing b6.5 blastomere was situated (black dots in
Fig. 3B). To address whether
this cell fate specification operates as a binary switch, with Nodal promoting
notochord fate and repressing mesenchyme fate in B8.6, we tested whether the
secondary notochord precursor adopts mesenchyme fate following Nodal
inhibition by analysing expression of Ci-Twist-like 1. Ci-Twist-like
1 encodes a bHLH transcription factor that is expressed in the A7.6
`trunk lateral cell' mesenchyme precursor and the B8.5 and B7.7 mesenchyme
precursors and is required for them to adopt mesenchyme fate
(Imai et al., 2003
;
Tokuoka et al., 2004
). B8.6
did not express Ci-Twist-like 1 following Nodal inhibition,
indicating that there had not been a notochordmesenchyme fate switch
(Fig. 2C). Furthermore,
expression of Ci-Twist-like 1 was downregulated in both the A7.6
trunk lateral cell precursors and the B8.5 mesenchyme precursors, but not in
B7.7 (Fig. 2C). This result was
confirmed by analysing Ci-AKR1a, a late marker of mesenchyme fate at
the early tailbud stage in SB431542-treated embryos incubated in cytochalasin
B from the 110-cell stage (95% strong expression in B7.7; 32% strong
expression and 16% weak expression in B8.5; 0% expression in A7.6; 0%
expression in B8.6; n=38). These results imply that Nodal signalling
is required for the correct specification of certain mesenchyme lineages as
well as for notochord fate in B8.6. DiI labelling of B7.3 confirms that this
blastomere generates mesenchyme and secondary notochord fate during normal
development (5/6) (see Fig. S1 in the supplementary material)
(Nishida, 1987
). In
SB431542-treated embryos B7.3 remains mitotically active and its derivatives
can be observed at the early tailbud stage as a single cluster of cells in the
interior of the embryo (7/7) (see Fig. S1 in the supplementary material). We
do not know what cell type these blastomeres adopt following Nodal inhibition
as neither endoderm nor muscle markers appeared to be expressed ectopically in
B8.5 or B8.6 when Nodal signalling was inhibited
(Fig. 1)
(Hudson and Yasuo, 2005
).
|
Secondary notochord precursor specification becomes independent of Nodal signalling by the 64-cell stage
In order to test when Nodal signalling was acting during secondary
notochord specification, we placed embryos in the ALK4/5/7 inhibitor,
SB431542, at different developmental time points. We found that
Ci-Bra expression in the secondary notochord precursor was severely
downregulated when embryos were placed in SB431542 at the 16- or late 32-cell
stages, but became independent of Nodal signalling by the 64-cell stage
(Fig. 3A). Although we do not
know how long the inhibitor takes to penetrate the embryo and act, this timing
fits well with the observation that the secondary notochord precursors (B6.2)
are in direct contact with the Nodal-expressing cells during the 32-cell stage
(Fig. 3B). Taken together with
the observation that both notochord and mesenchyme fates are lost from the
B7.3 lineage, this suggests that Nodal signalling is required during the 32-
to 64-cell stages for specification of the mother cell of the notochord and
mesenchyme precursors, which then cleaves to generate two different cell types
by other, Nodal-independent, mechanisms.
Nodal signalling is required in both B- and A-line cells for correct specification of the secondary notochord
If Nodal signals are required directly to specify the mother cell (B7.3) of
the notochord and mesenchyme precursors, selective inhibition of the reception
of Nodal signalling in the B-line should be sufficient to block the formation
of the secondary notochord precursor. For this purpose we injected, into the
right hand B4.1 blastomere of the eight-cell stage embryo, a truncated form of
the Ciona Nodal receptor (Ci-tALK4/5/7), which has been
previously shown to inhibit Nodal signals in Ciona
(Hudson and Yasuo, 2005
). The
B4.1 blastomere is the founder lineage of the secondary notochord lineages. As
a control, we injected Ci-tALK4/5/7 into the right hand side A4.1 of
the eight-cell stage embryo, which is the founder of the primary notochord
lineages, the specification of which should not be affected by this treatment
because the primary notochord is specified independently of Nodal.
GFP mRNA was injected as a control to show that the injection process
itself did not perturb gene expression. Ci-Bra expression was then
analysed at the early gastrula stage. We found that injection of
Ci-tALK4/5/7 into B4.1 did indeed lead to a decrease in
Ci-Bra expression on the injected side
(Fig. 4). However, to our
surprise, injection into A4.1, although having no effect on the primary
notochord lineages, led to a severe downregulation of Ci-Bra
expression in the secondary notochord precursor on the injected side
(Fig. 4).
|
Ci-Delta2 expression is induced in the A-lineages by Ci-Nodal
We have previously shown that Ci-Delta2 is a transcriptional
target of Nodal signalling at the early gastrula stage
(Hudson and Yasuo, 2005
). In
this study, we characterised the initiation of Ci-Delta2 expression,
which could be detected at the 64-cell stage, in A7.6, b7.10, b7.9, and also
weakly in some cases in A7.8 (Fig.
5A). Expression was variable in these different lineages from
embryo to embryo, but the most robust expression was observed in the A7.6
trunk lateral cell precursor (Fig.
5A,B, graphs). The A7.6 blastomere is positioned adjacent to the
B7.3 mother cell of the notochord and mesenchyme precursors, on the side on
which the secondary notochord precursor will be specified
(Fig. 5A). We found that
expression of Ci-Delta2 at the 64-cell stage was also dependent upon
Nodal signalling. Treatment with SB431542 or injection of Nodal-Mo resulted in
repression of Ci-Delta2 expression in all lineages
(Fig. 5A). Furthermore,
selective inhibition of the reception of Nodal signalling in A4.1, or ablation
of b5.3, the source of Nodal signals, was sufficient to abolish
Ci-Delta2 expression in A7.6 (and A7.8) on the treated side
(Fig. 5B,C). Thus, the same
treatments that block secondary notochord formation also inhibit
Ci-Delta2 expression in A-line cells. Taken together, these data
indicate that Ci-Delta2 in A7.6 is an excellent candidate to relay Nodal
signals during the specification of the secondary notochord.
|
-secretase.
The released Notch intracellular domain (NICD) then associates with a
transcription factor, Suppressor of Hairless [Su(H)], converting it from a
transcriptional repressor into an activator. Ci-Delta2 encodes a more
divergent form of Delta than that encoded by the ubiquitously expressed
Ci-Delta (Imai et al.,
2004
In order to investigate the role of Ci-Delta2 during secondary notochord
formation, we inhibited Notch-Delta at various levels of the signalling
pathway. In order to inhibit the Delta2 ligand, we used an antisense
morpholino oligonucleotide against Ci-Delta2 (Del2-Mo) or a version
of Ci-Delta2 lacking the intracellular domain (dnDel2). The removal of the
intracellular domain of Delta ligands has previously been shown to convert
them into dominant-negative forms (Chitnis
et al., 1995
; Sun and
Artavanis-Tsakonas, 1996
). As the DSL domain of Ci-Delta2 is not
well conserved, we wanted to ascertain whether Ci-Delta2 was acting through
the canonical Notch-Delta signalling pathway during secondary notochord
induction. Therefore, we also made use of a pharmacological reagent, DAPT,
which inhibits
-secretase. Application of DAPT has previously been
shown to inhibit Notch-Delta signalling in zebrafish embryos
(Geling et al., 2002
).
Finally, we constructed a DNA-binding mutant of Ciona Suppressor of
Hairless [Ci-Su(H)DBM]. This mutant form of Su(H) still binds
to NICD, but not to its target DNA sequences, thus interfering with the
ability of NICD to interact with endogenous Su(H) proteins
(Wettstein et al., 1997
).
Following inhibition at the level of Delta2 ligand or
-secretase,
Ci-Hes-b expression was lost, including that in the secondary
notochord precursor (Fig. 6B).
Moreover, Ci-Bra expression in the secondary notochord precursors was
lost when Delta/Notch/Su(H) signalling was inhibited by any of the four
reagents, and Ci-Noto1 expression in the secondary notochord was
abolished at later stages (Fig.
7A). Furthermore, ablation of A6.3, the precursor of A7.6, which
expresses Ci-Delta2 and is in direct contact with the secondary
notochord precursor, resulted in an inhibition of Ci-Bra expression
in the secondary notochord precursor on the ablated side
(Fig. 7B). Taken together,
these results suggest that Ci-Delta2 activity, derived from the A7.6-lineage
and acting via the canonical Delta/Notch/Su(H) signalling pathway, is required
for the specification of secondary notochord precursor. DiI labelling of B8.6
shows that, during normal embryogenesis, this blastomere gives rise to four
secondary notochord cells (4/5) (see Fig. S1 in the supplementary material)
(Nishida, 1987
). However, in
DAPT-treated embryos, B8.6 gives rise to many more smaller cells that remain
inside the embryo by the early tailbud stage (4/4) (see Fig. S1 in the
supplementary material). This suggests that the cell cycle control of B8.6 may
be coupled with its fate specification. During secondary notochord fate
specification, Ci-Delta2 signalling does not appear to be operating as a
simple binary cell-fate switch because in the Delta2/Notch-inhibited embryos
the secondary notochord precursor did not adopt mesenchyme fate, as assessed
by Ci-Twist-like 1 expression
(Fig. 7C). Similarly, in early
tailbud stage embryos treated with DAPT from the 44-cell stage and with
cytochalasin from the 110-cell stage, Ci-AKR1a expression was rarely
observed in B8.6 (3/30 embryos showed expression, on one side, in a blastomere
that was in a position consistent to be B8.6). B8.6 also does not appear to be
adopting endoderm or muscle fate following DAPT treatment (data not shown).
Thus, it is not clear what fate these cells adopt following inhibition of
Delta/Notch signals.
|
| DISCUSSION |
|---|
|
|
|---|
In addition to the role of Nodal in secondary notochord induction, we have
observed that Nodal is also required for expression of Ci-Twist-like
1, a causal regulator of mesenchyme fate
(Imai et al., 2003
;
Tokuoka at al, 2004
), in the
A7.6 and B8.5 lineages. Nodal signals emanating from the b6.5 blastomere may
contribute to the proposed signal derived from animal cells during the 16-32
cell stages, which was shown to be required for trunk lateral cell (A7.6) fate
in Halocynthia (Kawaminani and
Nishida, 1997
). Taken together with our previous observations that
Nodal signalling is required for patterning across the mediolateral axis of
the neural plate and for specification of the secondary muscle formation from
the A6.4 lineage, as well as recent evidence for the role of Nodal during
patterning the dorsal epidermis, it is transpiring that Nodal plays a broad
patterning role during ascidian development, across all the embryonic germ
layers (this study) (Hudson and Yasuo,
2005
; Pasini et al.,
2006
).
|
|
For primary notochord development, FGF/MEK/ERK1/2 activity is required
during the 32-64 cell stages for the A-line notochord precursors to adopt
notochord fate and to repress neural fate (H.Y. and C.H., unpublished)
(Hudson et al., 2003
;
Imai et al., 2002a
;
Kim and Nishida, 2001
;
Minokawa et al., 2001
). In the
secondary notochord lineages, FGF signalling appears to play a dual role.
First, it is required to suppress muscle fate in the mother cell of the
notochord and mesenchyme precursors at the 64-cell stage
(Darras and Nishida, 2001
;
Imai et al., 2002a
;
Kim and Nishida, 1999
;
Kim et al., 2000
;
Kim and Nishida, 2001
).
Second, the FGF/MEK/ERK1/2 pathway activates Ci-Nodal expression in
the b6.5 blastomere at the 32-cell stage
(Hudson and Yasuo, 2005
).
Ci-Nodal is then required, both directly and via Ci-Delta2 gene
activation, for the specification of the secondary notochord precursor (this
study). Delta2 most probably activates the Notch signalling pathway and
Ci-Bra expression directly in B8.6. Evidence supporting this includes
the observation that Ci-Hes-b is activated in the B8.6 blastomere in
a Delta2/Notch-dependent manner and that Su(H) activity is required within the
B-line lineages for expression of Ci-Bra in B8.6 (this study). In
addition, Su(H)-binding sites, to which Ci-Su(H) has been shown to bind in
vitro, are present in the upstream regulatory sequences of Ci-Bra
(Corbo et al., 1997
;
Corbo et al., 1998
).
Notch-Delta signalling has previously been implicated in both primary and
secondary notochord formation in Ciona embryos. Mutation or deletion
of the Su(H)-binding sites in a Ci-Bra minimal promoter was shown to
abolish reporter gene activity in all notochord cells
(Corbo et al., 1997
;
Corbo et al., 1998
). However,
using a DNA-binding mutant of Su(H), which should attenuate Notch activation
of endogenous Su(H), as well as inhibiting the pathway at the level of the
Delta2 ligand or Notch receptor processing, we observed a downregulation of
endogenous Ci-Bra expression only in the secondary notochord lineage.
This is consistent with the observation that widespread activation of Notch
signalling, by injection of a constitutively active Notch receptor, leads to
ectopic Ci-Bra activation in B-line cells much more readily than in
A-line cells (Imai et al.,
2002b
). It is possible that the mutations and deletions in the
Su(H) binding sites in the Ci-Bra minimal promoter also resulted in
the disruption of additional binding sites. Another possibility is that Su(H)
acts independently of Notch in the primary notochord. Indeed, Su(H) is able to
act as a transcriptional activator independently of Notch during maintenance
of its own expression in Drosophila adult socket cells (part of the
mechanosensory bristles), although the initial activation of this expression
depends on Notch signalling (Barolo et al.,
2000
). In light of our findings, the Ci-Bra regulatory
sequences require further investigation to understand precisely the role of
Su(H) during transcriptional control of Ci-Bra expression in the
primary notochord lineages.
|
It has been reported in Halocynthia, that BMP2/4 signalling from
the anterior endoderm precursors, together with FGF-signalling, is required
for induction of both primary and secondary notochord
(Darras and Nishida, 2001
). By
contrast, BMP2/4 signalling does not appear to play a major role in
Ciona notochord specification. Injection of Xenopus Chordin
mRNA does not result in any obvious defects in notochord formation and the
Ciona orthologue of BMP2/4 is not expressed in the anterior
endoderm precursors (H.Y., unpublished)
(Imai et al., 2004
). It thus
appears that there are real differences in the mechanisms used to specify
secondary notochord in Halocynthia and Ciona embryos, two
distantly related ascidian species (Cameron
et al., 2000
; Swalla et al.,
2000
; Wada, 1998
),
despite extensive similarities in their developmental mode and cleavage
patterns.
|
Muscle cells also arise from different embryonic origins, the primary
lineage from the B-line and the secondary lineages from the b- and A-lines and
these different lineages are also specified by distinct mechanisms. The
primary lineage is specified cell-autonomously by the inheritance of
cytoplasmic determinants, including the zinc-finger transcription factor
Macho-1, whereas the secondary muscle is specified by inductive cellular
interactions (Deno et al.,
1984
; Meedel et al.,
1987
; Meedel et al.,
2002
; Nishida,
1990
; Nishida and Sawada,
2001
; Satou et al.,
2002
). We have recently shown that Nodal signalling is required
for the specification of muscle fate in one of the secondary muscle lineages
(Hudson and Yasuo, 2005
). In
addition, the mesenchyme fates, even within the Bline, also appear to be
dependent on different strategies. We have shown in this study that B8.5 and
A7.6 depend upon Nodal signals in order to express Ci-Twist-like 1,
whereas B7.7 does not.
Fate specification by different molecular strategies is not restricted to
the mesoderm germ layer. It is also observed in the central nervous system
(CNS) in which FGF signalling is required for neural fate in a-line cells but
not in A-line cells (Bertrand et al.,
2003
; Minokawa et al.,
2001
). Finally, in Halocynthia, it has been shown that
anterior endoderm specification occurs cell autonomously, whereas posterior
endoderm specification requires FGF and BMP signalling
(Kim and Nishida, 2001
;
Kondoh et al., 2003
).
Although it is clear that distinct mechanisms can generate similar tissue
types in the different lineages of ascidian embryos, cell-type specific
transcription factors have been identified that promote tissue-type fate
specification irrespective of the lineage. Examples in the mesoderm lineages
include Brachyury for notochord formation
(Takahashi et al., 1999
;
Yasuo and Satoh, 1998
),
Ci-Twist-like 1 for mesenchyme
(Imai et al., 2003
), and
Ci-Tbx6 family members for muscle
(Yagi et al., 2005
). It thus
appears that different cell fate specification strategies converge at the
transcriptional level to activate genes encoding these cell-type specific
transcription factors.
If the upstream mechanisms governing the expression of effector genes that drive cell-type fate specification are indeed under relatively little constraint, it would not be surprising if we observe with increasing frequency that a variety of cell-autonomous and cell signalling strategies are used in different species and even within individual embryos to generate cells of seemingly identical tissue type.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/15/2855/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Barolo, S., Walker, R. G., Polyanovsky, A. D., Freschi, G., Keil, T. and Posakony, J. W. (2000). A notch-independent activity of suppressor of hairless is required for normal mechanoreceptor physiology. Cell 103,957 -969.[CrossRef][Medline]
Baron, M. (2003). An overview of the Notch signalling pathway. Semin. Cell Dev. Biol. 14,113 -119.[CrossRef][Medline]
Bertrand, V., Hudson, C., Caillol, D., Popovici, C. and Lemaire, P. (2003). Neural tissue in ascidian embryos is induced by FGF9/16/20, acting via a combination of maternal GATA and Ets transcription factors. Cell 115,615 -627.[CrossRef][Medline]
Cameron, C. B., Garey, J. R. and Swalla, B. J.
(2000). Evolution of the chordate body plan: new insights from
phylogenetic analyses of deuterostome phyla. Proc. Natl. Acad. Sci.
USA 97,4469
-4474.
Chitnis, A., Henrique, D., Lewis, J., Ish-Horowicz, D. and Kintner, C. (1995). Primary neurogenesis in Xenopus embryos regulated by a homologue of the Drosophila neurogenic gene Delta. Nature 375,761 -766.[CrossRef][Medline]
Conklin, E. G. (1905). The organisation and cell lineage of the ascidian egg. J. Acad. Nat. Sci. Philadelphia 13,1 -119.
Corbo, J. C., Levine, M. and Zeller, R. W. (1997). Characterization of a notochord-specific enhancer from the Brachyury promoter region of the ascidian, Ciona intestinalis. Development 124,589 -602.[Abstract]
Corbo, J. C., Fujiwara, S., Levine, M. and Di Gregorio, A. (1998). Suppressor of hairless activates brachyury expression in the Ciona embryo. Dev. Biol. 203,358 -368.[CrossRef][Medline]
Darras, S. and Nishida, H. (2001). The BMP signaling pathway is required together with the FGF pathway for notochord induction in the ascidian embryo. Development 128,2629 -2638.[Medline]
Deno, T., Nishida, H. and Satoh, N. (1984). Autonomous muscle cell differentiation in partial ascidian embryos according to the newly verified cell lineages. Dev. Biol. 104,322 -328.[CrossRef][Medline]
Geling, A., Steiner, H., Willem, M., Bally-Cuif, L. and Haass, C. (2002). A gamma-secretase inhibitor blocks Notch signaling in vivo and causes a severe neurogenic phenotype in zebrafish. EMBO Rep. 3,688 -694.[CrossRef][Medline]
Hansson, E. M., Lendahl, U. and Chapman, G. (2004). Notch signaling in development and disease. Semin. Cancer Biol. 14,320 -328.[CrossRef][Medline]
Hino, K., Satou, Y., Yagi, K. and Satoh, N. (2003). A genomewide survey of developmentally relevant genes in Ciona intestinalis. VI. Genes for Wnt, TGFbeta, Hedgehog and JAK/STAT signaling pathways. Dev. Genes Evol. 213,264 -272.[CrossRef][Medline]
Hotta, K., Takahashi, H., Asakura, T., Saitoh, B., Takatori, N., Satou, Y. and Satoh, N. (2000). Characterization of Brachyury-downstream notochord genes in the Ciona intestinalis embryo. Dev. Biol. 224,69 -80.[CrossRef][Medline]
Hudson, C. and Yasuo, H. (2005). Patterning
across the ascidian neural plate by lateral Nodal signalling sources.
Development 132,1199
-1210.
Hudson, C., Darras, S., Caillol, D., Yasuo, H. and Lemaire,
P. (2003). A conserved role for the MEK signalling pathway in
neural tissue specification and posteriorisation in the invertebrate chordate,
the ascidian Ciona intestinalis. Development
130,147
-159.
Imai, K. S., Satoh, N. and Satou, Y. (2002a).
Early embryonic expression of FGF4/6/9 gene and its role in the induction of
mesenchyme and notochord in Ciona savignyi embryos.
Development 129,1729
-1738.
Imai, K. S., Satoh, N. and Satou, Y. (2002b). An essential role of a FoxD gene in notochord induction in Ciona embryos. Development 129,3441 -3453.[Medline]
Imai, K. S., Satoh, N. and Satou, Y. (2002c).
Multiple functions of a Zic-like gene in the differentiation of notochord,
central nervous system and muscle in Ciona savignyi embryos.
Development 129,2723
-2732.
Imai, K. S., Satoh, N. and Satou, Y. (2003). A
Twist-like bHLH gene is a downstream factor of an endogenous FGF and
determines mesenchymal fate in the ascidian embryos.
Development 130,4461
-4472.
Imai, K. S., Hino, K., Yagi, K., Satoh, N. and Satou, Y.
(2004). Gene expression profiles of transcription factors and
signaling molecules in the ascidian embryo: towards a comprehensive
understanding of gene networks. Development
131,4047
-4058.
Inman, G. J., Nicolas, F. J., Callahan, J. F., Harling, J. D.,
Gaster, L. M., Reith, A. D., Laping, N. J. and Hill, C. S.
(2002). SB-431542 is a potent and specific inhibitor of
transforming growth factor-beta superfamily type I activin receptor-like
kinase (ALK) receptors ALK4, ALK5, and ALK7. Mol.
Pharmacol. 62,65
-74.
Kawaminani, S. and Nishida, H. (1997). Induction of trunk lateral cells, the blood precursors, during ascidian embryogenesis. Dev. Biol. 181, 14-20.[CrossRef][Medline]
Kim, G. J. and Nishida, H. (1999). Suppression of muscle fate by cellular interaction is required for mesenchyme formation during ascidian embryogenesis. Dev. Biol. 214, 9-22.[CrossRef][Medline]
Kim, G. J. and Nishida, H. (2001). Role of the FGF and MEK signaling pathway in the ascidian embryo. Dev. Growth Differ. 43,521 -533.[CrossRef][Medline]
Kim, G. J., Yamada, A. and Nishida, H. (2000). An FGF signal from endoderm and localized factors in the posterior-vegetal egg cytoplasm pattern the mesodermal tissues in the ascidian embryo. Development 127,2853 -2862.[Abstract]
Kondoh, K., Kobayashi, K. and Nishida, H.
(2003). Suppression of macho-1-directed muscle fate by FGF and
BMP is required for formation of posterior endoderm in ascidian embryos.
Development 130,3205
-3216.
Lai, E. C. (2004). Notch signaling: control of
cell communication and cell fate. Development
131,965
-973.
Lemaire, P. and Marcellini, S. (2003). Early animal embryogenesis: why so much variability? Biologist 50,136 -140.
Lemaire, P., Garrett, N. and Gurdon, J. B. (1995). Expression cloning of Siamois, a Xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete secondary axis. Cell 81,85 -94.[CrossRef][Medline]
Letunic, I., Copley, R. R., Schmidt, S., Ciccarelli, F. D.,
Doerks, T., Schultz, J., Ponting, C. P. and Bork, P. (2004).
SMART 4.0: towards genomic data integration. Nucleic Acids
Res. 32,D142
-D144.
Meedel, T. H., Crowther, R. J. and Whittaker, J. R.
(1987). Determinative properties of muscle lineages in ascidian
embryos. Development
100,245
-260.
Meedel, T. H., Lee, J. J. and Whittaker, J. R. (2002). Muscle development and lineage-specific expression of CiMDF, the MyoD-family gene of Ciona intestinalis. Dev. Biol. 241,238 -246.[CrossRef][Medline]
Minokawa, T., Yagi, K., Makabe, K. W. and Nishida, H.
(2001). Binary specification of nerve cord and notochord cell
fates in ascidian embryos. Development
128,2007
-2017.
Morokuma, J., Ueno, M., Kawanishi, H., Saiga, H. and Nishida, H. (2002). HrNodal, the ascidian nodal-related gene, is expressed in the left side of the epidermis, and lies upstream of HrPitx. Dev. Genes Evol. 212,439 -446.[CrossRef][Medline]
Nakatani, Y. and Nishida, H. (1994). Induction of notochord during ascidian embryogenesis. Dev. Biol. 166,289 -299.[CrossRef][Medline]
Nishida, H. (1987). Cell lineage analysis in ascidian embryos by intracellular injection of a tracer enzyme. III. Up to the tissue restricted stage. Dev. Biol. 121,526 -541.[CrossRef][Medline]
Nishida, H. (1990). Determinative mechanisms in
secondary muscle lineages of ascidian embryos: development of muscle-specific
features in isolated muscle progenitor cells.
Development 108,559
-568.
Nishida, H. (2002). Patterning the marginal zone of early ascidian embryos: localized maternal mRNA and inductive interactions. BioEssays 24,613 -624.[CrossRef][Medline]
Nishida, H. (2003). Spatio-temporal pattern of MAP kinase activation in embryos of the ascidian Halocynthia roretzi. Dev. Growth Differ. 45,27 -37.[CrossRef][Medline]
Nishida, H. (2005). Specification of embryonic axis and mosaic development in ascidians. Dev. Dyn. 233,1177 -1193.[CrossRef][Medline]
Nishida, H. and Sawada, K. (2001). macho-1 encodes a localized mRNA in ascidian eggs that specifies muscle fate during embryogenesis. Nature 409,724 -729.[CrossRef][Medline]
Pasini, A., Amiel, A., Rothbächer, U., Roure, A., Lemaire, P. and Darras, S. (2006). Formation of the ascidian epidermal sensory neurons: insights into the origin of the chordate peripheral nervous system. Plos Biol. (in press).
Ristoratore, F., Spagnuolo, A., Aniello, F., Branno, M., Fabbrini, F. and Di Lauro, R. (1999). Expression and functional analysis of Cititf1, an ascidian NK-2 class gene, suggest its role in endoderm development. Development 126,5149 -5159.[Abstract]
Satou, Y., Yagi, K., Imai, K. S., Yamada, L., Nishida, H. and Satoh, N. (2002). macho-1-Related genes in Ciona embryos. Dev. Genes Evol. 212,87 -92.[CrossRef][Medline]
Schultz, J., Milpetz, F., Bork, P. and Ponting, C. P.
(1998). SMART, a simple modular architecture research tool:
identification of signaling domains. Proc. Natl. Acad. Sci.
USA 95,5857
-5864.
Stemple, D. L. (2005). Structure and function
of the notochord: an essential organ for chordate development.
Development 132,2503
-2512.
Sun, X. and Artavanis-Tsakonas, S. (1996). The intracellular deletions of Delta and Serrate define dominant negative forms of the Drosophila Notch ligands. Development 122,2465 -2474.[Abstract]
Swalla, B. J., Cameron, C. B., Corley, L. S. and Garey, J. R. (2000). Urochordates are monophyletic within the deuterostomes. Syst. Biol. 49, 52-64.[CrossRef][Medline]
Takahashi, H., Hotta, K., Erives, A., Di Gregorio, A., Zeller,
R. W., Levine, M. and Satoh, N. (1999). Brachyury downstream
notochord differentiation in the ascidian embryo. Genes
Dev. 13,1519
-1523.
Tassy, O., Daian, F., Hudson, C., Bertrand, V. and Lemaire, P. (2006). A quantitative approach to the study of cell shapes and interactions during early chordate embryogenesis. Curr. Biol. 16,345 -358.[CrossRef][Medline]
Tokuoka, M., Imai, K. S., Satou, Y. and Satoh, N. (2004). Three distinct lineages of mesenchymal cells in Ciona intestinalis embryos demonstrated by specific gene expression. Dev. Biol. 274,211 -224.[CrossRef][Medline]
Wada, H. (1998). Evolutionary history of free-swimming and sessile lifestyles in urochordates as deduced from 18S rDNA molecular phylogeny. Mol. Biol. Evol. 15,1189 -1194.[Abstract]
Wada, S. and Saiga, H. (2002). HrzicN, a new Zic family gene of ascidians, plays essential roles in the neural tube and notochord development. Development 129,5597 -5608.[Medline]
Wada, S., Katsuyama, Y., Yasugi, S. and Saiga, H. (1995). Spatially and temporally regulated expression of the LIM class homeobox gene Hrlim suggests multiple distinct functions in development of the ascidian, Halocynthia roretzi. Mech. Dev. 51,115 -126.[CrossRef][Medline]
Weng, W. and Stemple, D. L. (2003). Nodal signaling and vertebrate germ layer formation. Birth Defects Res. C Embryo Today 69,325 -332.[CrossRef][Medline]
Wettstein, D. A., Turner, D. L. and Kintner, C. (1997). The Xenopus homolog of Drosophila Suppressor of Hairless mediates Notch signaling during primary neurogenesis. Development 124,693 -702.[Abstract]
Yagi, K., Satou, Y. and Satoh, N. (2004). A
zinc finger transcription factor, ZicL, is a direct activator of Brachyury in
the notochord specification of Ciona intestinalis.
Development 131,1279
-1288.
Yagi, K., Takatori, N., Satou, Y. and Satoh, N. (2005). Ci-Tbx6b and Ci-Tbx6c are key mediators of the maternal effect gene Ci-macho1 in muscle cell differentiation in Ciona intestinalis embryos. Dev. Biol. 282,535 -549.[CrossRef][Medline]
Yasuo, H. and Satoh, N. (1998). Conservation of the developmental role of Brachyury in notochord formation in a urochordate, the ascidian Halocynthia roretzi. Dev. Biol. 200,158 -170.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
T. Stach, J. Winter, J.-M. Bouquet, D. Chourrout, and R. Schnabel Embryology of a planktonic tunicate reveals traces of sessility PNAS, May 20, 2008; 105(20): 7229 - 7234. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Shi and M. Levine Ephrin signaling establishes asymmetric cell fates in an endomesoderm lineage of the Ciona embryo Development, March 1, 2008; 135(5): 931 - 940. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Rothbacher, V. Bertrand, C. Lamy, and P. Lemaire A combinatorial code of maternal GATA, Ets and {beta}-catenin-TCF transcription factors specifies and patterns the early ascidian ectoderm Development, November 15, 2007; 134(22): 4023 - 4032. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Picco, C. Hudson, and H. Yasuo Ephrin-Eph signalling drives the asymmetric division of notochord/neural precursors in Ciona embryos Development, April 15, 2007; 134(8): 1491 - 1497. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||