|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 July 2006
doi: 10.1242/dev.02449
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Interfakultäres Institut für Zellbiologie, Abteilung Genetik der Tiere, Fakultät für Biologie, Universität Tübingen, Auf der Morgenstelle 28, D-72076 Tübingen, Germany.
Author for correspondence (e-mail:
rolf.reuter{at}uni-tuebingen.de)
Accepted 19 May 2006
| SUMMARY |
|---|
|
|
|---|
Key words: PDZ-GEF, Dizzy (Gef26), Rap1, Integrin, Cell adhesion, Cell motility, Macrophage, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
Migrating cells undergo a continuous cycle of integrated cellular events
that are initiated by migration-promoting cues. Such cues lead to a
polarization of the cell and to the formation of protrusions in the direction
of migration. The protrusions adhere to the substrate via transmembrane
receptors linked to the cytoskeleton. The sites of adhesion then provide
traction during the contraction of the cell, leading to the forward movement
of the cell body. At the rear of the cell, adhesion sites become disassembled,
allowing the cell to detach and to efficiently migrate toward guidance cues
(Friedl and Wolf, 2003
;
Lauffenburger and Horwitz,
1996
; Ridley et al.,
2003
). Thus, cell adhesion and its regulation are of crucial
importance for migrating cells.
Many different factors regulate cell adhesion during cell migration,
including cell surface receptors that mediate adhesion. A major family of
these receptors are the integrins, heterodimers composed of one
and
one ß subunit, which link the migratory substrate to the cytoskeleton
(Bökel and Brown, 2002
;
Hynes, 1992
).
Integrin-mediated adhesion can be regulated by modulation of their affinity to
ligands or by changing their local concentration at the membrane. This
regulation occurs either at the outside of the cell by ligands or from the
inside by cytoplasmic signals (Kinbara et
al., 2003
; Liddington and
Ginsberg, 2002
; van der Flier
and Sonnenberg, 2001
). Important mediators of the latter signals
toward the integrins are small GTPases. For instance, Rap1 is involved in the
regulation of integrin-mediated cell adhesion in several cases
(Caron et al., 2000
;
Katagiri et al., 2000
;
Reedquist et al., 2000
). In
Drosophila the molecule is required for many aspects of
morphogenesis, including invagination of embryonic mesoderm, migration of
mesoderm precursors and positioning of adherens junctions
(Asha et al., 1999
;
Boettner et al., 2003
;
Knox and Brown, 2002
).
However, Rap1 has not yet been linked to the activity of integrins in
Drosophila.
The functional state of small GTPases such as Rap1, the active GTP-bound
versus the inactive GDP-bound state is determined by two classes of proteins:
G-nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs)
(Ridley, 2001
). While GAPs are
responsible for the inactivation of small GTPases, GEFs are the activating
components and stimulate specific small GTPases.
We have performed an EP misexpression screen
(Rørth, 1996
) in order
to identify genes involved in the regulation and in the execution of cell
migration of embryonic macrophages in Drosophila. Here we report the
gene dizzy (Gef26 - FlyBase) encoding the
Drosophila PDZ-GEF to be required for proper cell shape and cell
migration of macrophages in the Drosophila embryo. Furthermore, we
show that Dizzy has the capacity to induce cell shape changes in migrating
macrophages depending on the function of Rap1 and ßPS integrins. Our data
suggest that the Drosophila PDZ-GEF Dizzy is a GEF for Rap1,
regulates integrin-dependent adhesion via Rap1, and stabilizes cellular
protrusions during the migration of embryonic macrophages in
Drosophila.
| MATERIALS AND METHODS |
|---|
|
|
|---|
2-3 Ki (Robertson et al.,
1988
1/CyO,actGFP;srph-gal4
UAS-gfpS65T, UAS-gfpS65T;srph-gal4
UAS-gfpS65T and
dizzyEP/UAS-gfpS65T;srph-gal4
UAS-gfpS65T/+, for time-lapse recordings.
EP screen
Fifteen to 30 virgins of the stock srph>cd2 were crossed with
three to seven males of one genotype of the EP collection (Szeged). Embryos
were collected and immunostained for CD2 following the methods described in
Hummel et al. (Hummel et al.,
1997
), were mounted in methyl salicylate and analyzed for
macrophage migration, cell form and cell number.
Generation of dizzy alleles
The P-element insertion of dizzyEP was
mobilized by crossing-in
2-3, and the F2 generation
was scored for semi-lethality in trans to Df(2L)BSC5. In total, 11
lines were established with strong eye and wing phenotypes of adult escapers;
seven were used for this study: dizzy
1 and
dizzy
5 remove 174 and 1187 bp upstream of the
former insertion site, dizzy
7 and
dizzy
8 2253 bp and 2632 bp around the site, and
dizzy
3, dizzy
10 and
dizzy
12 2328, 2380 and 2969 bp downstream only. One
revertant (dizzyP-RV4), obtained upon mobilization of the
P-element of dizzyP, has lost the insertion
completely and is fully viable.
Qi He and colleagues introduced the gene name dizzy. dizzy is
identical to Gef26 and dPDZ-GEF
(Lee et al., 2002
;
Wang et al., 2006
).
Generation of dizzy RNAi transgenics
For the tissue-specific downregulation of dizzy function, we
generated a transgene allowing the expression of dizzy
double-stranded RNA under Gal4 control. A fragment of the dizzy EST
AT08279 was amplified by PCR, using the 5'-primer
GCAGTTAAAAAGATGCTATCGCTG and the 3'-primer TGTTCAAGTTGCGGGTACCGCGT. This
fragment contains a portion of exon 3, the exon 4 and a part of exon 5.
Following the strategy of Nagel et al.
(Nagel et al., 2002
), a 485 bp
long piece of the fragment (positions 4328 to 4812 of cDNA DQ423241) was first
cloned in pHIBS and subsequently cloned in normal and in reverse orientation,
separated by the Hairless intron, in pUAST
(Brand and Perrimon, 1993
).
This construct was introduced in the Drosophila germline by
P-element-mediated transformation and gave several transgenic lines
(UAS-ds.dizzy). Two of these were chosen, which led to lethality when
ubiquitously expressed under control of da-gal4.
Crosses to assess the role of integrin ßPS mys
To examine the role of integrins in cell shape changes induced by
dizzyEP or by Rap1V12, we crossed
mysXG43/FM7ftz::lacZ;+;srph>cd2
females with w/Y;dizzyEP;+ or with
w/Y;UAS-rap1V12;UAS-rap1V12/TM6B
males. Immunostaining with anti-CD2 antibodies visualized the morphology of
the macrophages. With progeny carrying FM7ftz::lacZ, all
embryos gave the cell shape phenotype, but that phenotype was only visible in
about 50% of embryos lacking FM7ftz::lacZ.
Immunohistochemistry and in-situ hybridization
Embryos for histochemistry were fixed and immunostained according to
standard procedures. Primary antibodies: mouse
-CD2 (Serotec), rabbit
-ßGal (Cappel), mouse
-ßGal (Promega), rabbit
-pFakTyr397 (Biosource), mouse
-ßPS
(Brower et al., 1984
) (DSHB).
Secondary antibodies: labeled with Alexa 488, Alexa 555 (Molecular Probes) or
biotin (Jackson Labs). The signal of the biotinylated antibodies was enhanced
using Vectastain `Elite' and detected either with DAB or with the TSA
technique (PerkinElmer). Embryos stained with fluorescent dyes were
counterstained with DAPI, mounted in Vectashield and documented with a Leica
SP2 confocal system on an inverted Leica DM IRBE microscope. DAB-labeled
embryos were mounted in araldite and analyzed on a Zeiss Axioplan 2 equipped
with a Progress 3012 camera (Jenoptik).
In-situ hybridization was performed essentially as described in Tautz and
Pfeifle (Tautz and Pfeifle,
1989
). DIG-labeled dizzy RNA probes were generated from
EST RH54455, for Pez (CG9493) from EST RE59091 and for Cpr
(CG11567) from EST LD46590.
Live-imaging and measurements
Dechorionated embryos were mounted in a drop of water-saturated 3S Voltalef
oil on a slide, properly oriented and covered with a coverslip based on two
lateral coverslips. For time-lapse recordings, we performed
xyt-sections using the Leica confocal microscope. Images were
processed using IPLab (Scanalytics) and then evaluated using a
software tool developed with Macromedia Director. The positions of
individual cells were recorded in 4D image stacks by mouse click. Then travel
distance and cell speed were calculated and the recorded tracks were
visualized. Time-lapse movies were exported from IPLab, and processed
in QuickTime Player. The lengths of the cellular protrusions were
measured on digital photomicrographs in IPLab and exported to
Excel for numerical analysis.
Preparation and analysis of genomic DNA
Genomic DNA was isolated from dizzyEP,
dizzyP or homozygous dizzy
n adults,
amplified by PCR and sequenced essentially following the protocol of J. Rehm
(http://www.fruitfly.org/about/methods/inverse.pcr.html).
For the molecular characterization of the dizzy
n
alleles, locus-specific primers were designed, and PCR products were
sequenced.
Cloning of dizzy full-length cDNA
Total RNA was isolated from w embryos of Drosophila,
selected for poly-A+ RNA and reverse-transcribed to cDNA. Then, the
5' and 3' ends of dizzy cDNA were amplified using the
RACE systems of Invitrogen and were subcloned in TOPO TA. Two independent
clones were obtained, which had an identical 5' end. The central parts
of the dizzy cDNA were amplified with gene-specific primers and then
subcloned (accession number of full-length cDNA: DQ423241).
| RESULTS |
|---|
|
|
|---|
In order to obtain loss-of-function alleles of dizzy, we mobilized
the P-element of dizzyEP and obtained a series of
small deletions in the dizzy locus. Seven representative deletions
were used for further analysis. dizzy
1 and
dizzy
5 removed genomic DNA upstream of the former
insertion site, including the transcription start site
(Fig. 1A).
dizzy
7 and dizzy
8
deleted the entire exon 0, the transcription start site, most of the putative
dizzy enhancer regions and almost the complete first intron
(Fig. 1A).
dizzy
12 left the transcription start site intact,
but removed the original translation start site and about 1.3 kb of the ORF.
Therefore, it could code for a truncated Dizzy protein that lacks the cNMP,
N-terminal RasGEF and PDZ domain (Fig.
1B). dizzy
3 and
dizzy
10 are associated with smaller deletions,
affecting translation start and cNMP domain only. Concerning the adult
phenotype, all alleles behave like amorphic alleles, as homozygous escapers
show the same phenotypes as animals carrying one of these dizzy
alleles in trans to the deficiency Df(2L)BSC5: eyes are rough and
reduced in size, wing blades are bent downward, and the male genitalia are
distorted, probably contributing to the male sterility
(Lee et al., 2002
;
Wang et al., 2006
). Consistent
with this genetic argument for the amorphic nature of the alleles is our
finding that alleles with deleted transcription start sites lacked endogenous
dizzy RNA expression in the embryo and therefore appeared to be null
alleles (Fig. 1D). The normal
expression of dizzy in the embryo was ubiquitous and of a comparably
low level (Fig. 1C).
|
n
alleles, hemizygous for dizzy
n, or
trans-heterozygous for dizzy
n and
dizzyP. In all cases the migration of macrophages in the
embryo was similarly disturbed, specifically the migration along the ventral
nerve cord (VNC). Macrophages from the anterior and from the posterior part of
the embryo migrated along the midline of the VNC toward each other. Then at
stages 13 and 14, wild-type macrophages surrounded the entire midline of the
VNC (Fig. 2B). By contrast,
macrophages of dizzy mutant embryos failed to migrate properly and
did not succeed in completely surrounding the midline of the VNC at this time
(arrowheads in Fig. 2A,K). In
some embryos, the resulting ventral gap persisted until even later stages,
whereas in others the defect disappeared
(Fig. 2E). In addition,
macrophages were found in an aberrant, dorsal position beneath the amnioserosa
in mutant embryos after germ band retraction
(Fig. 2I,K). This indicates
that these macrophages did not properly adhere to the posterior end of the
germ band and failed to enter the posterior germ band before and during its
retraction. Later, during the phase of `central spreading' at stage 14,
macrophages in wild-type embryos migrated laterally and ended up rather evenly
distributed throughout the interstitial space at stage 15
(Fig. 2F,H). By contrast,
dizzy mutant macrophages did not achieve that even distribution, and
the posterior-ventral part of the embryo contained less macrophages than the
equivalent area of a wild-type embryo (Fig.
2E-H). Thus, dizzy mutant macrophages appeared to be
slower and did not reach their destinations in time. Other aspects of the
migration, such as the migration along the dorsal epidermis, were not
noticeably affected in dizzy
n mutants. dizzy is required not only for proper macrophage migration, but also for the cells to adopt their normal size and shape. In dizzy mutants, macrophages formed smaller protrusions than those in wild-type embryos (Fig. 2C,D,G,H). The average lengths of the protrusions per cell were about 5 µm at stage 14 at lateral positions in fixed preparations of wild-type compared with less than half this size in dizzy mutants (Fig. 3). Hence, the analysis of the dizzy mutant phenotype demonstrates that dizzy is required for proper cell migration and proper cell form of macrophages during Drosophila embryogenesis and indicates a function of dizzy in cell adhesion.
The phenotype observed for macrophages in dizzy mutants could be due to a function of dizzy in the macrophages themselves or might be indirect, due to a requirement of dizzy in other tissues. We therefore specifically reduced dizzy function in the macrophages by expressing a dsRNA-fragment of dizzy. This expression led to the same phenotype as seen in the dizzy mutants: macrophage migration was severely delayed, macrophages failed to reach the posterior end of the germ band in time (Fig. 2M), and the cellular protrusions were smaller than in wild type (Fig. 3). We therefore conclude that the activity of dizzy is required within the macrophages for proper cell shape and motility.
Dizzy is sufficient to change the cell form of macrophages
Next we wondered how crucial dizzy activity is for cell shape and
cell migration, and we specifically overexpressed dizzy in
macrophages (Fig. 4). For this
purpose we used the EP-allele dizzyEP and directed the
expression by srph-gal4 (termed dizzyh.EP
hereafter). The overexpression seen in dizzyh.EP was
confined to the dizzy transcription unit: genes neighboring
dizzy, such as Pez or Cpr, were not influenced by
the dizzyEP allele. Macrophages in
dizzyh.EP embryos commenced their migration normally
(Fig. 4A,B) but then formed
very long protrusions, in the range of 20 µm per cell
(Fig. 3,
Fig. 4C,D). In addition, the
protrusions of different macrophages contacted each other, resulting in the
formation of a network that spanned the nervous system in a dorsoventral
direction (Fig. 4C,E) or that
was seen below the epidermis at lateral positions
(Fig. 4G,I). In wild-type
embryos, the macrophages migrating along the midline or beneath the dorsal
edge of the epidermis had smaller protrusions and formed fewer or no contacts
with each other (Fig.
4H,J).
|
Dizzy assists in stabilization of cellular protrusions during the migrational cycle of macrophages
Using time-lapse video microscopy, we intended to assess the origin of the
large protrusions of dizzyh.EP embryos. Live macrophages
are much bigger than expected from their appearance in fixed material
(Fig. 5)
(Paladi and Tepass, 2004
;
Stramer et al., 2005
). They
have large, very dynamic lamellopodia, which extend in the direction of
migration, multiple small filopodia and a short tail, depending on their state
in the migrational cycle. These structures are not well preserved during the
fixation procedure used for immunohistochemistry. Live macrophages
overexpressing dizzy showed protrusions with principally the same
size and the same dynamics as wild-type cells, but beyond that they also had
the long cellular extensions seen in fixed preparations
(Fig. 5; see Movies 1 and 3 in
the supplementary material). Time series indicated that these extensions were
not formed as independent entities, but originated either from retracted
lamellopodia or more frequently from the tail of migrating cells
(Fig. 5). This latter aspect
contributes to the formation of the net-like appearance of the macrophages: in
a group of cells, often only one cell at a time moved along and, upon
dizzy overexpression, stayed in contact with the other, remaining
cells of the group by its extended tail. Also at later stages, the long
extensions were maintained in parallel to lamellopodia and did not disturb the
normal local mobility of the cells (see Movie 3 in the supplementary
material). We therefore suggest that dizzy contributes to the
stabilization of cellular protrusions.
|
|
|
Next we wanted to know whether Dizzy acts in vivo like a GEF for Rap1. To test this we simultaneously expressed Dizzy and Rap1N17 in migrating macrophages. Rap1N17 is thought to act as a dominant-negative form of Rap1 by sequestering the limited amount of activating GEF. If Dizzy acts as a GEF for Rap1, the simultaneous expression should rescue the rap1N17 phenotype. Indeed, while Rap1N17 on its own strongly disrupted the migration of macrophages, the simultaneous expression of Dizzy and Rap1N17 substantially rescued the phenotype of Rap1N17. Only a minimal gap was seen in the distribution of the macrophages around the VNC at stage 14, and the cells formed protrusions larger than normal (Fig. 7B,D).
Taken together, these data reveal a novel function of Rap1 in macrophages during migration. They show that active Rap1 is able to provoke cell shape changes in macrophages in a similar way to Dizzy. We have also demonstrated that Dizzy activity requires Rap1 function and have provided evidence that Dizzy is either itself a GEF for Rap1 or activates one.
Dizzy activity requires integrin function
Dizzy activity leads to cell shape changes in migrating macrophages, and we
assume that these changes reflect modulations of adhesive properties of
macrophages. Therefore, we tested whether ßPS integrins are required for
the cell shapes induced by Dizzy activity. mys mutants solely lacking
the zygotic ßPS gene function did not have a phenotype in macrophage
shape or migration during embryogenesis
(Fig. 8D). The mys
requirement became noticeable only in germline clones also lacking the
maternal contribution (data not shown). Nevertheless, dizzy
overexpression did not lead to large protrusions and the net-like appearance
of macrophages in zygotic mys mutant embryos
(Fig. 8A,B). The cells had the
appearance of wild-type macrophages regarding size and protrusions
(Fig. 3,
Fig. 7B). This shows that Dizzy
requires the full function of ßPS and indicates that integrins act
downstream of Dizzy.
Our results above suggest that Dizzy acts via Rap1 to induce the changes of cell shape in macrophages. One therefore would expect that Rap1 stands between Dizzy and the integrins in the genetic hierarchy and that the changes in cell morphology caused by dominant-active Rap1V12 also depend on integrin function. Indeed, in zygotic mys mutants Rap1V12 overexpression does not suffice in enlarging the protrusions (Fig. 3) or changing the cell shape of macrophages (Fig. 8F) as it does in mys+ embryos (Fig. 3, Fig. 8E). Thus, we conclude that in migrating macrophages Dizzy acts upstream of Rap1, and Rap1 in turn regulates cell adhesion and cell shape via a pathway that requires the function of ßPS integrins.
|
| DISCUSSION |
|---|
|
|
|---|
The PDZ-GEF Dizzy is essential for proper migration and cell shape of macrophages
We characterized the dizzy locus and found that lack of
dizzy function results in a relatively subtle phenotype in the
embryo: the macrophages had cellular protrusions about half the size of normal
cells in fixed preparations and did not reach their destination in the central
region of the embryo in time (Figs
2,
3). Surprisingly, the
difference in the size of the protrusions was not obvious in live
dizzy macrophages. We assume that the difference in fixed
preparations is caused by a reduced stability of protrusions in dizzy
mutants that leads to a diminished preservation during fixation. Also the
measurement of the speed of individual dizzy macrophages showed no
significant reduction in their average speed during stages 12 and 13. However,
due to the stochastic behavior of individual cells during migration it is
difficult to assess in live embryos whether the cells commence their migration
too late or whether they stop prematurely.
The observed phenotypes in macrophage shape and migration are due to the
lack of dizzy function, as they are seen in embryos homozygous or
hemizygous for dizzyP or
dizzy
n alleles, i.e. they are
independent of the genetic background. Moreover, the revertant
dizzyP-RV4, which had lost the P-element
insertion, no longer showed the phenotypes. Furthermore, the dsRNA-induced
reduction of dizzy function specifically in the macrophages led to
the same phenotypes. Here the extent is more variable than in mutants,
presumably due to the intrinsic inhomogeneity of the UAS-Gal4 system. In any
case, we have no indication that inappropriate apoptosis contributes to the
phenotypes. The number of macrophages is normal in the mutants throughout
embryogenesis. A rescue by the expression of the pancaspase inhibitor p35 is
not observed (data not shown).
|
Dizzy acts via Rap1
Experiments in mammalian cell culture demonstrated that PDZ-GEFs
specifically activate the small GTPases Rap1 and Rap2
(de Rooij et al., 1999
;
Gao et al., 2001
;
Kuiperij et al., 2003
;
Liao et al., 2001
;
Rebhun et al., 2000
). Also
recent reports from Caenorhabditis and Drosophila place
PDZ-GEFs upstream of Rap1 (Lee et al.,
2002
; Pellis-van Berkel et
al., 2005
; Wang et al.,
2006
). Our data suggest that the PDZ-GEF Dizzy is a GEF for the
small GTPase Rap1 in Drosophila macrophages: the level of Dizzy
expression is crucial (Figs 2,
3 and
4), the cell shape changes
induced by high levels of Dizzy in macrophages are Rap1-dependent
(Fig. 6), and high levels of
Dizzy rescue the phenotype of dominant-negative Rap1N17
(Fig. 7). We assume that in
migrating macrophages most, if not all, of the activity of Dizzy goes through
Rap1 for two reasons: (1) the appearance of macrophages of Dizzy
overexpressing embryos and of embryos overexpressing dominant-active
Rap1V12 were very similar (Figs
3,
4,
6); (2) overexpression of Dizzy
was effective only in rap1+ embryos
(Fig. 6). The lack-of-function
phenotypes of dizzy and rap1 were quantitatively different:
rap1 mutants had a far weaker macrophage migration defect than
dizzy mutant embryos because of the compensation by maternal
contribution. However, dominant-negative Rap1N17 caused a strong
migrational phenotype (Fig. 7),
supporting our notion that Dizzy and Rap1 act in the same pathway.
|
There are two possible roles for integrins in the Dizzy/Rap1-dependent
stabilization of cellular protrusions: (1) integrins are the relevant targets
of the pathway, and a modulation of their activity is responsible for the cell
shape changes; (2) the prime target is another cellular component, and
integrins are merely required to allow the stabilization. We favor the former
hypothesis, as several lines of evidence from cell culture experiments suggest
that Rap1 acts in such a fashion and regulates integrin activity via an
`inside-out' signaling pathway (Bos et al.,
2003
; Sebzda et al.,
2002
; Tohyama et al.,
2003
). Components of that pathway might be Rap1 effectors that
provide the link between Rap1 and integrins. Two such effectors, RAPL and
RIAM, have been described in vertebrates
(Katagiri et al., 2003
;
Lafuente et al., 2004
), but
the function of the corresponding Drosophila orthologs are not yet
known.
How do Dizzy/Rap1 act on integrins in migrating macrophages?
Above we proposed that Dizzy exerts a positive influence via Rap1 on the
activity of integrins in Drosophila macrophages. This influence could
be an immediate activation of integrins, but the nature of that activation is
unclear. The level of expression or the spatial distribution of ßPS
integrin is not obviously changed in macrophages overexpressing Dizzy or
Rap1V12 compared with wild-type cells. We observed neither
clustering nor elevated protein expression of integrins. Likewise, the level
of phosphorylated focal adhesion kinase was unchanged (pFakTyr397,
data not shown). The phosphorylation of Fak is dependent on integrin-mediated
adhesion and therefore often used as a marker for integrin activity (for a
review, see Mitra et al.,
2005
). Alternatively, the positive influence of Dizzy/Rap1 on
integrin activity might be due to a repression of de-adhesion of integrins.
This could be achieved by interaction with the small GTPase RhoA, which in
monocytes is required for the retraction of the cell tail and appears to act
by delimiting the adhesion to integrin ligands and by keeping the local levels
of integrins low (Worthylake et al.,
2001
). However, initial experiments do not indicate a clear
genetic interaction between RhoA and Dizzy in Drosophila during the
migration of macrophages.
Whether as immediate activation or as repression of de-adhesion, the signaling via Dizzy/Rap1 to integrins appears to be permissive rather than instructive in nature for the guided motility of Drosophila macrophages. We have no indication that the directionality of the migration is changed upon overexpression of Dizzy. The additional protrusions are not an indication of perturbed polarity, nor do they represent multiple leading edges. Also, macrophages in dizzy loss-of-function mutants appear to have normal polarity and migrate along the normal paths. They do not reach the central part of the embryo in time, but behave otherwise normally. Therefore, we conclude that the Dizzy/Rap1 pathway does not contribute to its directional action, but makes the migratory machinery of the cell efficient.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/15/2915/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Asha, H., de Ruiter, N. D., Wang, M. G. and Hariharan, I. K. (1999). The Rap1 GTPase functions as a regulator of morphogenesis in vivo. EMBO J. 18,605 -615.[CrossRef][Medline]
Boettner, B., Harjes, P., Ishimaru, S., Heke, M., Fan, H. Q.,
Qin, Y., Van Aelst, L. and Gaul, U. (2003). The AF-6 homolog
Canoe acts as a Rap1 effector during dorsal closure of the Drosophila
embryo. Genetics 165,159
-169.
Bökel, C. and Brown, N. H. (2002). Integrins in development: moving on, responding to, and sticking to the extracellular matrix. Dev. Cell 3, 311-321.[CrossRef][Medline]
Bos, J. L., de Bruyn, K., Enserink, J., Kuiperij, B., Rangarajan, S., Rehmann, H., Riedl, J., de Rooij, J., van Mansfeld, F. and Zwartkruis, F. (2003). The role of Rap1 in integrin-mediated cell adhesion. Biochem. Soc. Trans. 31, 83-86.[Medline]
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Brower, D. L., Wilcox, M., Piovant, M., Smith, R. J. and Reger,
L. A. (1984). Related cell-surface antigens expressed with
positional specificity in Drosophila imaginal discs. Proc.
Natl. Acad. Sci. USA 81,7485
-7489.
Brückner, K., Kockel, L., Duchek, P., Luque, C. M., Rorth, P. and Perrimon, N. (2004). The PDGF/VEGF receptor controls blood cell survival in Drosophila. Dev. Cell 7, 73-84.[CrossRef][Medline]
Bunch, T. A., Salatino, R., Engelsgjerd, M. C., Mukai, L., West, R. F. and Brower, D. L. (1992). Characterization of mutant alleles of myospheroid, the gene encoding the beta subunit of the Drosophila PS integrins. Genetics 132,519 -528.[Abstract]
Caron, E., Self, A. J. and Hall, A. (2000). The
GTPase Rap1 controls functional activation of macrophage integrin
Mß2 by LPS and other inflammatory mediators. Curr.
Biol. 10,974
-978.[CrossRef][Medline]
Cho, N. K., Keyes, L., Johnson, E., Heller, J., Ryner, L., Karim, F. and Krasnow, M. A. (2002). Developmental control of blood cell migration by the Drosophila VEGF pathway. Cell 108,865 -876.[CrossRef][Medline]
de Rooij, J., Boenink, N. M., van Triest, M., Cool, R. H.,
Wittinghofer, A. and Bos, J. L. (1999). PDZ-GEF1, a guanine
nucleotide exchange factor specific for Rap1 and Rap2. J. Biol.
Chem. 274,38125
-38130.
Dunin-Borkowski, O. M., Brown, N. H. and Bate, M. (1995). Anterior-posterior subdivision and the diversification of the mesoderm in Drosophila. Development 121,4183 -4193.
Friedl, P. and Wolf, K. (2003). Tumour-cell invasion and migration: diversity and escape mechanisms. Nat. Rev. Cancer 3,362 -374.[CrossRef][Medline]
Gao, X., Satoh, T., Liao, Y., Song, C., Hu, C. D., Kariya Ki, K.
and Kataoka, T. (2001). Identification and characterization
of RA-GEF-2, a Rap guanine nucleotide exchange factor that serves as a
downstream target of M-Ras. J. Biol. Chem.
276,42219
-42225.
Hay, B. A., Wolff, T. and Rubin, G. M. (1994). Expression of baculovirus P35 prevents cell death in Drosophila. Development 120,2121 -2129.[Abstract]
Hinz, U., Giebel, B. and Campos-Ortega, J. A. (1994). The basic helix-loop-helix domain of Drosophila lethal of scute protein is sufficient for proneural function and activates neurogenic genes. Cell 76, 77-87.[CrossRef][Medline]
Hummel, T., Schimmelpfeng, K. and Klämbt, C. (1997). Fast and efficient egg collection and antibody staining from large numbers of Drosophila strains. Dev. Genes Evol. 207,131 -135.[CrossRef]
Hynes, R. O. (1992). Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69, 11-25.[CrossRef][Medline]
Katagiri, K., Hattori, M., Minato, N., Irie, S., Takatsu, K. and
Kinashi, T. (2000). Rap1 is a potent activation signal for
leukocyte function-associated antigen 1 distinct from protein kinase C and
phosphatidylinositol-3-OH kinase. Mol. Cell. Biol.
20,1956
-1969.
Katagiri, K., Maeda, A., Shimonaka, M. and Kinashi, T. (2003). RAPL, a Rap1-binding molecule that mediates Rap1-induced adhesion through spatial regulation of LFA-1. Nat. Immunol. 4,741 -748.[CrossRef][Medline]
Kinbara, K., Goldfinger, L. E., Hansen, M., Chou, F. L. and Ginsberg, M. H. (2003). Ras GTPases: integrins' friends or foes? Nat. Rev. Mol. Cell Biol. 4, 767-776.[Medline]
Knox, A. L. and Brown, N. H. (2002). Rap1
GTPase regulation of adherens junction positioning and cell adhesion.
Science 295,1285
-1288.
Kuiperij, H. B., de Rooij, J., Rehmann, H., van Triest, M., Wittinghofer, A., Bos, J. L. and Zwartkruis, F. J. (2003). Characterisation of PDZ-GEFs, a family of guanine nucleotide exchange factors specific for Rap1 and Rap2. Biochim. Biophys. Acta 1593,141 -149.[Medline]
Lafuente, E. M., van Puijenbroek, A. A., Krause, M., Carman, C. V., Freeman, G. J., Berezovskaya, A., Constantine, E., Springer, T. A., Gertler, F. B. and Boussiotis, V. A. (2004). RIAM, an Ena/VASP and Profilin ligand, interacts with Rap1-GTP and mediates Rap1-induced adhesion. Dev. Cell 7, 585-595.[CrossRef][Medline]
Lauffenburger, D. A. and Horwitz, A. F. (1996). Cell migration: a physically integrated molecular process. Cell 84,359 -369.[CrossRef][Medline]
Lee, J. H., Cho, K. S., Lee, J., Kim, D., Lee, S. B., Yoo, J.,
Cha, G. H. and Chung, J. (2002). Drosophila PDZ-GEF,
a guanine nucleotide exchange factor for Rap1 GTPase, reveals a novel upstream
regulatory mechanism in the mitogenactivated protein kinase signaling pathway.
Mol. Cell. Biol. 22,7658
-7666.
Liao, Y., Satoh, T., Gao, X., Jin, T. G., Hu, C. D. and Kataoka,
T. (2001). RA-GEF-1, a guanine nucleotide exchange factor for
Rap1, is activated by translocation induced by association with
Rap1*GTP and enhances Rap1-dependent B-Raf activation.
J. Biol. Chem. 276,28478
-28483.
Liddington, R. C. and Ginsberg, M. H. (2002).
Integrin activation takes shape. J. Cell Biol.
158,833
-839.
Luo, L. Q., Liao, Y. J., Jan, L. Y. and Jan, Y. N.
(1994). Distinct morphogenetic functions of similar small
GTPases: Drosophila Drac1 is involved in axonal outgrowth and
myoblast fusion. Genes Dev.
8,1787
-1802.
Mitra, S. K., Hanson, D. A. and Schlaepfer, D. D. (2005). Focal adhesion kinase: in command and control of cell motility. Nat. Rev. Mol. Cell Biol. 5, 56-68.
Nagel, A. C., Maier, D. and Preiss, A. (2002). Green fluorescent protein as a convenient and versatile marker for studies on functional genomics in Drosophila. Dev. Genes Evol. 212, 93-98.[CrossRef][Medline]
Paladi, M. and Tepass, U. (2004). Function of
Rho GTPases in embryonic blood cell migration in Drosophila. J.
Cell Sci. 117,6313
-6326.
Pellis-van Berkel, W., Verheijen, M. H. G., Cuppen, E., Asahina,
M., de Rooij, J., Jansen, G., Plasterk, R. H. A., Bos, J. L. and Zwartkruis,
F. J. T. (2005). Requirement of the Caenorhabditis elegans
RapGEF pxf-1 and rap-1 for epithelial integrity. Mol. Biol.
Cell 16,106
-116.
Rebhun, J. F., Castro, A. F. and Quilliam, L. A.
(2000). Identification of guanine nucleotide exchange factors
(GEFs) for the Rap1 GTPase. Regulation of MR-GEF by M-Ras-GTP interaction.
J. Biol. Chem. 275,34901
-34908.
Reedquist, K. A., Ross, E., Koop, E. A., Wolthuis, R. M.,
Zwartkruis, F. J., van Kooyk, Y., Salmon, M., Buckley, C. D. and Bos, J.
L. (2000). The small GTPase, Rap1, mediates CD31-induced
integrin adhesion. J. Cell Biol.
148,1151
-1158.
Ridley, A. J. (2001). Rho family proteins: coordinating cell responses. Trends Cell Biol. 11,471 -477.[CrossRef][Medline]
Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A.,
Ginsberg, M. H., Borisy, G., Parsons, J. T. and Horwitz, A. R.
(2003). Cell migration: integrating signals from front to back.
Science 302,1704
-1709.
Robertson, H. M., Preston, C. R., Phillis, R. W., Johnson-Schlitz, D. M., Benz, W. K. and Engels, W. R. (1988). A stable genomic source of P element transposase in Drosophila melanogaster. Genetics 118,461 -470.
Rørth, P. (1996). A modular
misexpression screen in Drosophila detecting tissue-specific
phenotypes. Proc. Natl. Acad. Sci. USA
93,12418
-12422.
Sebzda, E., Bracke, M., Tugal, T., Hogg, N. and Cantrell, D. A. (2002). Rap1A positively regulates T cells via integrin activation rather than inhibiting lymphocyte signaling. Nat. Immunol. 3,251 -258.[CrossRef][Medline]
Stramer, B., Wood, W., Galko, M. J., Redd, M. J., Jacinto, A.,
Parkhurst, S. M. and Martin, P. (2005). Live imaging of wound
inflammation in Drosophila embryos reveals key roles for small
GTPases during in vivo cell migration. J. Cell Biol.
168,567
-573.
Strutt, D. I., Weber, U. and Mlodzik, M. (1997). The role of RhoA in tissue polarity and Frizzled signaling. Nature 387,292 -295.[CrossRef][Medline]
Tautz, D. and Pfeifle, C. (1989). A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 98, 81-85.
Tepass, U., Fessler, L. I., Aziz, A. and Hartenstein, V. (1994). Embryonic origin of hemocytes and their relationship to cell death in Drosophila. Development 120,1829 -1837.
Tohyama, Y., Katagiri, K., Pardi, R., Lu, C., Springer, T. A.
and Kinashi, T. (2003). The critical cytoplasmic regions of
the alphaL/beta2 integrin in Rap1-induced adhesion and migration.
Mol. Biol. Cell 14,2570
-2582.
van der Flier, A. and Sonnenberg, A. (2001). Function and interactions of integrins. Cell Tissue Res. 305,285 -298.[CrossRef][Medline]
Verkhusha, V. V., Tsukita, S. and Oda, H. (1999). Actin dynamics in lamellipodia of migrating border cells in the Drosophila ovary revealed by a GFP-actin fusion protein. FEBS Lett. 445,395 -401.[CrossRef][Medline]
Wang, H., Singh, S. R., Zheng, Z., Oh, S. W., Chen, X., Edwards, K. and Hou, S. X. (2006). Rap-GEF signaling controls stem cell anchoring to their niche through regulating DE-cadherin-mediated cell adhesion in the Drosophila testis. Dev. Cell 10,117 -126.[CrossRef][Medline]
Worthylake, R. A., Lemoine, S., Watson, J. M. and Burridge,
K. (2001). RhoA is required for monocyte tail retraction
during transendothelial migration. J. Cell Biol.
154,147
-160.
This article has been cited by other articles:
![]() |
K. Jani and F. Schock Zasp is required for the assembly of functional integrin adhesion sites J. Cell Biol., December 31, 2007; 179(7): 1583 - 1597. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, J. Yan, P. De, H.-C. Chang, A. Yamauchi, K. W. Christopherson II, N. C. Paranavitana, X. Peng, C. Kim, V. Munugulavadla, et al. Rap1a Null Mice Have Altered Myeloid Cell Functions Suggesting Distinct Roles for the Closely Related Rap1a and 1b Proteins J. Immunol., December 15, 2007; 179(12): 8322 - 8331. [Abstract] [Full Text] [PDF] |
||||