|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 July 2006
doi: 10.1242/dev.02471
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Institute of Molecular Pathology, Dr Bohr-Gasse 7, A-1030 Vienna,
Austria.
2 Department of Genetics, Harvard Medical School, 77 Avenue Louis Pasteur,
Boston, MA 02115, USA.
Author for correspondence (e-mail:
hartmann{at}imp.univie.ac.at)
Accepted 2 June 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Wnt, Synovial joint, Chondrocyte maturation, Ihh, Mouse
| INTRODUCTION |
|---|
|
|
|---|
The molecular mechanisms underlying joint formation are not yet well
understood. Various signaling molecules, such as Gdf5, Gdf6 and Noggin have
been implicated in joint formation (Brunet
et al., 1998
; Settle et al.,
2003
; Storm and Kingsley,
1996
). However, none of those factors is sufficient to induce
joint formation (Capdevila and Johnson,
1998
; Merino et al.,
1999
; Pathi et al.,
1999
; Pizette and Niswander,
2000
; Storm and Kingsley,
1999
; Tsumaki et al.,
2002
). By contrast, disruption of integrin signaling and ectopic
activation of Wnt9a signaling leads to the induction of molecular markers
characteristic for the joint-interzone and the formation of joint-like regions
(Garciadiego-Cazares et al.,
2004
; Guo et al.,
2004
; Hartmann and Tabin,
2001
). Based on this, it has been proposed, that Wnt9a signaling
is involved in joint induction.
Factors secreted by cells adjacent to the joint, such as Pthrp, Fgf18 and
others, are important regulators for the maturation of chondrocytes, from
proliferative, to postmitotic prehypertrophic, to hypertrophic chondrocytes,
which mature further and eventually undergo apoptosis. Accurate control of
chondrocyte proliferation and maturation is crucial for determining the future
size of the skeletal element. A key regulator for these processes is the
signaling molecule Ihh, which is produced by prehypertrophic/early
hypertrophic chondrocytes and plays essential roles in skeletogenesis
coordinating cartilage growth and osteoblastogenesis: Ihh signaling controls
the expression of another secreted molecule, Pthrp, that negatively regulates
chondrocyte maturation. Furthermore, Ihh has additional Pthrp-independent
roles; it stimulates chondrocyte proliferation and osteoblast differentiation
(Kronenberg, 2003
).
Ihh expression is under transcriptional control by Runx2 and
Runx3 (Yoshida et al.,
2004
), and it expression levels are regulated in an antagonistic
manner by Fgf and Bmp signaling (Minina et
al., 2002
). Modulation in the expression of secreted factors
controlling the central regulator Ihh affect growth and differentiation of the
skeletal elements, resulting primarily in a shortening of the skeletal
elements.
In order to address whether Wnt9a is necessary for joint induction, we have targeted the Wnt9a locus and generated two alleles, a conditional allele and a lacZ knock-in allele. Wnt9a loss-of-function mutants die at birth. They display partial joint fusions of carpal and tarsal elements and chondroid metaplasia in synovial and fibrous joints. The phenotypes associated with synovial joints are augmented in Wnt9a;Wnt4 double mutants. Our data demonstrate that Wnts are essential to maintain joint integrity, but that they are probably not required for inducing joint formation. In addition, we found that Wnt9a mutants have shortened appendicular long bones. The shortening is due to a temporary downregulation of Ihh expression in Wnt9a mutants at embryonic days E12.5-13.5. Furthermore, we show by genetic interaction and by in vivo chromatin immunoprecipitation that the regulation of Ihh expression and chondrocyte maturation by Wnt9a is mediated through ß-catenin.
| MATERIALS AND METHODS |
|---|
|
|
|---|
or lacZ) were identical on mixed,
random bred (Swiss-Webster), F1 (129/Sv; C57Bl6/J) and inbred (129/Sv)
backgrounds.
Mouse strains
Wnt4 heterozygous mice were purchased from Jackson laboratory.
Genotyping of Wnt4 and ß-catenin alleles (lacZ and floxed) was
performed by PCR as previously described
(Huelsken et al., 2000
;
Huelsken et al., 2001
;
Stark et al., 1994
). Limbs
lacking ß-catenin activity in the mesenchyme were generated as described
by Hill et al. (Hill et al.,
2005
).
Skeletal analysis
Newborn pups (P0) and embryos were skinned, eviscerated and fixed in 95%
ethanol. Alizarin Red/Alcian Blue or Alcian Blue staining of the skeletons
were performed as described previously
(McLeod, 1980
).
ß-Galactosidase staining, histology, in situ hybridization and BrdU incorporation
For ß-galactosidase staining, embryos E9.5-E13.5 were fixed for 15-30
minutes and skinned newborns were fixed for 1 hour in 0.1 M phosphate buffer
containing 0.2% glutaraldehyde, 2 mM Mg2Cl, 5 mM EGTA on ice,
washed three times in 0.1 M phosphate buffer containing 0.01% deoxycholate.
0.02% NP-40 and 2 mM Mg2Cl at room temperature, and stained
overnight at 37°C in staining solution [1 mg/ml X-gal, 4% diethyl
formamide, 5 mM K3(Fe(CN)6), 5 mM
K4(Fe(CN)6)].
For histology and section in situ hybridization, tissue was treated as
previously described (Hill et al.,
2005
). For analysis of BrdU incorporation, 50 µg BrdU/g body
weight was injected intra-peritoneally into pregnant mice 2 hours before
sacrifice. BrdU incorporation was detected on sections by immunohistochemistry
(Zymed Laboratories). For each analysis and developmental stage, at least
three independent samples were analyzed.
RT-PCR analysis
For RT-PCR and real-time PCR analysis, 1 µg total RNA was used to
produce first-strand cDNA. Real-time PCR was performed by using SYBR green 1
nucleic acid gel stain (Molecular Probes) and TAKARA Taq. Values were
calculated using the comparative C(t) method and normalized to mouse
Hprt1 expression. Primer sets were tested by dilution series and
products were analyzed by gel electrophoresis and melting curves. All primer
sequences are available by request.
Retroviral work and cultivation of chondrocytes
The RCAS-AP, RCAS-Wnt5a, RCAS-Wnt9a, RCAS-Wnt3a and RCAS-caß-cat
viruses has been previously described
(Hartmann and Tabin, 2000
;
Hartmann and Tabin, 2001
;
Kengaku et al., 1998
).
Chondrocytes isolated from the caudal part of day 18 chick sternae
(Koyama et al., 1999
) were
cultured for 1 day, collected and plated at a density of
5x105 cells/well in a six-well plate. The following day
chondrocytes were infected using 5 µl viral supernatant per well (titers:
6-8x108 pfu/ml) and cultured for 3-4 days in DMEM:F12
(Invitrogen). Experiments were carried out in triplicate.
Western blot analysis
For Western blot analysis, protein was extracted from cultured chicken
sternal chondrocytes infected with different RCAS viruses. Extracts of 50
µg per lane were loaded. Luminal detection was performed using an antibody
against chicken ß-catenin (1:800, Sigma C7027), followed by incubation
with a HRP-conjugated secondary antibody (1:2500; Promega).
Limb explant cultures
Forelimbs were skinned and removed from E12.5 and E13.5 embryos. One limb
of a forelimb pair was cultured in the presence of 25 µM SU5402
(Calbiochem)/0.2% DMS0, while the other one was cultured in 0.2% DMSO in
DMEM:F12 (Invitrogen) supplemented with 10% FCS and L-Glutamine. Limbs were
cultured for 24 hours in 24-well dishes floating on top of Nuclepore
Track-Etch Membranes (Whatman) in a humidified tissue culture incubator at
37°C and 5% CO2.
Immunohistochemical staining
For immunohistochemical staining of cultured caudal chondrocytes, cells
were fixed for 15 minutes at room temperature with 4% paraformaldehyde in PBS,
washed twice with PBS. Endogenous peroxidase activity was inactivated by
incubating the cells for 30 minutes in 1% H2O2 in PBS.
Cells were subsequently washed three times with PBS; blocked for 30 minutes
with PBS, 10% FCS and 0.1% Triton-X100; and incubated with the primary
antibodies against collagen type II (II-II6B3 supernatant, 1:30) and collagen
type III (3B2 supernatant 1:30) from the Developmental Hybridoma Bank (Iowa).
The signal was detected using a biotinylated anti-mouse secondary antibody
(dilution 1 in 250; Vector Laboratories) in combination with the ABC kit
(Vector labs) and DAB (Sigma) as a substrate. ß-Catenin
immunohistochemical staining on paraffin sections was performed using the
anti-ß-catenin (BD Transduction Laboratories, 1 in 250) after
heat-induced citrate buffer antigene retrieval. Signal detection was performed
as described above.
Chromatin immunoprecipitation (ChIP)
For in vivo cartilage lysates, humeri were dissected from 13.5 dpc limbs
(FVBN mice: litters with 10-13 embryos). Humeri of one litter were dissociated
in 500 µl of 0.3% collagenase IV/0.1% Trypsin/2% FCS/DMEM for 15 minutes at
37°C and by additional usage of a bouncer. After a PBS wash, cells were
crosslinked with 1% formaldehyde for 10 minutes, followed by quenching with
125 mM glycine. Whole-cell extracts were prepared for ChIP as described
(Martens et al., 2005
).
Approximately 200 µg of fragmented chromatin was used in
immunoprecipitation with 4 µg ß-catenin (St. Cruz, sc-1496), 4 µg
Lef1 (St. Cruz, sc-8592) and 4 µg H3-K4 methylation (Upstate Biotechnology)
antibodies. Purified DNA from immunoprecipitates, as well as of the input
material was analyzed by real-time PCR using the Roche Sybr green quantitation
method on a MJ research Lightcycler (n=3). Results were normalized
and presented as percentage of input DNA. For amplification of the three
potential TCF/LEF1 sites, the following primer pairs were used: site 1
forward, 5' TCCGGCTGCGACGTGGGTTGC 3'; site 1 reverse, 5'
CGGCCGGCGGACTGAAGG 3'; site 2 forward, 5' ACTCCCCTGCCATCCCAGCACTCC
3'; site 2 reverse, 5' GACGGGCACTGCCTGGGAATCACT 3'; site 3
forward, 5' TGAATCCCGAGCAAGGCGTAG 3'; site 3 reverse, 5'
TGGGATGGCAGGGGAGTAGTA 3'.
| RESULTS |
|---|
|
|
|---|
) allele were obtained by germline
deletion of the floxed exon 2 (Fig.
1B). A truncated transcript, resulting from aberrant splicing of
exon 1 to exon 3, could be amplified by RT-PCR from RNA of
Wnt9a
/
mutant embryos
(Fig. 1C). Sequencing revealed
a frame-shift and a premature Stop. Any protein made from this transcript
would therefore consist of 65 amino acids, containing the first 32 amino acids
of the Wnt9a protein. In the lacZ allele, the open reading frame of
Wnt9a was disrupted and thus no functional protein can be translated
from this allele. We consider both alleles as being null alleles and therefore
we will refer to them as -allele, unless otherwise noted. No pups homozygous
for either of the mutant alleles were recovered at weaning from heterozygous
intercrosses of Wnt9a+/
or
Wnt9a+/lacZ mice. Homozygous mutant pups died within 12
hours of birth, for so far unknown reasons. Histological analyses of their
major organs, heart, lung, liver, intestinal tract, kidney and brain, did not
reveal any obvious abnormalities. They are slightly smaller than their
littermates and can be readily identified by the absence of milk in their
stomach (Fig. 1D).
|
Chondroid metaplasia of fibrous and synovial joint cells in Wnt9a mutants
Wnt9a-/- newborns display no obvious defects with
respect to fusions of major joints. However, ectopic cartilaginous material
was detected by Alcian Blue staining in the interfrontal and sagittal suture
regions, separating frontal and parietal bones, respectively
(Fig. 2C, parts
d,e',f'; data not shown) and in the elbow joint
(Fig. 3). Sutures are fibrous
joints between the flat bones of the cranial vault, which serve as major sites
for bone expansion during postnatal skull growth
(Opperman, 2000
). Van Kossa
staining showed that the mineralized regions were further apart in mutant than
wild-type skulls (Fig. 2C, part
e). In situ hybridization of coronal skull sections revealed that the
chondrocyte markers Col2a1 and Sox9 were ectopically
expressed in cells within the frontal and sagittal sutures
(Fig. 2C, parts
e',f'; data not shown). In addition, their normal expression
domains at the base were expanded dorsally
(Fig. 2C, parts
f,f').
|
Wnt9a misexpression in chondrocytes leads to dedifferentiation associated with stabilization of ß-catenin
Loss of Wnt9a signaling in HRJ and midline suture cells led to
their ectopic differentiation into chondrocytes. Based on this, we
hypothesized that Wnt9a signaling in synovial and fibrous joint cells is
required to suppress their chondrogenic potential. To test this hypothesis
further, we asked whether ectopic Wnt9a signaling in chondrocytes
would lead to alterations of the cells. We used primary chicken sternal
chondrocytes and infected them with replication competent avian retroviruses
(RCAS) expressing either Wnt9a, the canonical ligand Wnt3a, the non-canonical
ligand Wnt5a, a constitutively active form of ß-catenin (caß-cat) or
alkaline phosphatase (AP) as control. In AP and Wnt5a-infected cultures, the
chondrocytes retained their typical cuboidal shape and stained positive for
collagen type II (Col2; Fig.
3B). By contrast, cells infected with either Wnt9a, Wnt3a or
caß-cat viruses had a fibroblastic appearance and ceased to produce Col2
(Fig. 3B, and data not shown).
These cells stained positively for collagen type III (Col3) instead, which was
not produced by the control cells (Fig.
3B). Western blots from whole-cell extracts revealed that the
ß-catenin levels were increased in chondrocytes infected with Wnt9a or
Wnt3a virus compared with AP or Wnt5a-infected cell extracts
(Fig. 3C).
|
Wnt4 and Wnt9a act cooperatively in maintaining joint integrity
Surprisingly, only a few synovial joints were affected in Wnt9a
mutants, despite the fact that Wnt9a is expressed in all joints (see
Fig. S1 in the supplementary material). At least two other Wnt genes,
Wnt4 and Wnt16, are expressed in joints
(Guo et al., 2004
;
Hartmann and Tabin, 2000
;
Hartmann and Tabin, 2001
).
Wnt4 mutants do not have any joint abnormalities
(Stark et al., 1994
). However,
mice double mutant for Wnt9a and Wnt4
(Wnt9a-/-;Wnt4-/-) developed synovial
chondroid metaplasia in two additional major joints, the ankle and knee joint
(n=4; Fig. 4A, parts
d,e). In addition, fusions of tarsal and carpal elements were observed in the
foot (calcaneus and cuboid, and navicular and intermediate cuneiform)
(Fig. 4A, parts f,g) and wrist
(carpal elements 2, c and 3) (n=4/4;
Fig. 4B, part e). In one
specimen, we observed the presence of an ectopic cartilage piece in a ligament
(see asterisk in Fig. 4A, part
g).
In order to address whether joint formation or maintenance were affected by the loss of Wnt9a and Wnt4, we analyzed the expression of various markers Col2a1, Col3, Gdf5, Gli3 and Wnt4 in E13.5 and E15.5 wrists, focusing primarily at the carpal elements 2, c and 3. Those can be distinguished as separate elements in wild-type and mutant wrists at E13.5, showing identical marker expression (Fig. 4B, parts b,f; data not shown). However, at E15.5 the elements were fused and joint marker expression was lost (Fig. 4B, parts g,h). These observations strongly suggest that the joints are originally formed and that the fusion of skeletal elements occurs secondarily, owing to the absence of Wnt9a and Wnt4 activity.
Altered chondrocyte maturation in Wnt9a mutants
The reduction of the mineralization/ossification centers in skeletal
elements formed by endochondral ossification
(Fig. 2A,B) suggested a
possible delay of chondrocyte maturation in Wnt9a mutants. In order
to determine the nature and onset, we performed histological and molecular
marker analyses on the developing long bones at different embryonic stages.
Whole-mount and section in situ analyses at E11.5 using the early chondrogenic
markers Sox9 and Col2a1 revealed no difference in the
overall size of the long bone anlagen between Wnt9a mutants and
littermate controls (data not shown). Proliferation rate (BrdU) and apoptosis
(TUNEL) were also not altered (data not shown). Furthermore, the chondrocyte
differentiation marker Ihh was expressed in Wnt9a mutant
humeri in a domain of similar size and at levels equal to those detected in
wild-type or heterozygous littermates (Fig.
5A; data not shown). At E12.5, however, Ihh expression
levels were slightly downregulated in mutants
(Fig. 5B) and this
downregulation was even more pronounced at E13.5
(Fig. 5C). Downregulation of
Ihh was independently confirmed by real-time PCR analysis on cDNA
generated from E12.5 and E13.5 wild-type and mutant humeri (see Fig. S2A in
the supplementary material).
|
By contrast, the expression domain of the gene encoding parathyroid hormone receptor 1 (Ppr; Pthr1 - Mouse Genome Informatics), which overlaps with Ihh, was reduced only in extent not in magnitude at E13.5 and E14.5, reflecting a delay in chondrocyte maturation (Fig. 5E; data not shown). The collagen 10a1 (Col10a1) expression domain, which marks hypertrophic chondrocytes, was slightly expanded in Wnt9a mutant humeri at E12.5 (Fig. 5F), while it was either reduced or not detectable at E13.5 (Fig. 5G; data not shown). At E14.5 the Col10a1 domain in mutants resembled that of E13.5 wild-type humeri (Fig. 5H). This marker analysis showed that Wnt9a signaling is crucial for chondrocyte maturation around E12.5-E13.5.
Temporal downregulation of Ihh signaling in Wnt9a mutant long bones
Because Ihh expression was temporarily downregulated, we analyzed
whether Ihh signaling and Ihh regulated processes were also affected. Analysis
of the Ihh target genes patched 1 (Ptch1), which functions also as a
receptor for Ihh, and Pthrp
(St-Jacques et al., 1999
;
Vortkamp et al., 1996
), showed
a reduced expression in Wnt9a-/- humeri at E13.5
(Fig. 5I,J). Ihh signaling also
regulates chondrocyte proliferation in a Pthrp-independent fashion
(Karp et al., 2000
).
Consistent with the reduction in Ihh levels BrdU incorporation
revealed a 7% reduction of the chondrocyte proliferation rate within the
flattened zone at E13.5 (P<0.05; data not shown). No significant
difference in proliferation rate could be detected in mutant compared with
wild-type humeri at E14.5 (data not shown).
|
1 day in chondrocyte and osteoblast maturation. Although
Ihh levels are back to normal at around E14.5, the maturation delay
cannot be compensated and thereby remains noticeable even at birth, reflected
in the shortening of proximal skeletal elements.
Fgf signaling has also been shown to negatively regulate Ihh
(Chen et al., 2001
;
Li et al., 1999
;
Minina et al., 2002
;
Naski et al., 1998
).
Therefore, we addressed whether Fgf signaling is involved in the temporary
downregulation of Ihh in Wnt9a mutants by assaying for altered
Fgf expression of 19 Fgf genes (Fgf1-13, Fgf15, 17, 18 and Fgf20-22)
using real-time PCR at E12.5 and E13.5. With the exception of Fgf4,
which was downregulated, none of the Fgf genes analyzed showed any significant
increase or decrease in relative expression levels at E12.5 (see Fig. S3A in
the supplementary material; data not shown). Interestingly at E13.5 the
relative expression levels of five Fgf genes (Fgf1, Fgf6, Fgf15,
Fgf20 and Fgf21) were increased (see Fig. S3B in the
supplementary material). This increase could potentially contribute to
downregulation of Ihh at E13.5. To further investigate this
possibility, we analyzed the expression of Ihh and Col10a1
in humeri of embryos with constitutive active Fgfr3 signaling in chondrocytes
(Fgfr3ach G380R) (Naski et al.,
1998
). However, no downregulation of Ihh expression was
observed in humeri of Fgfr3ach mice at E12.5 (n=5) or E13.5
(n=10) (see Fig. S3C,D in the supplementary material). By contrast,
we observed on average a slight expansion of the expression domains of
Ihh (by
8%) and Col10 (by approx. 6%) at E13.5 compared
with wild-type littermates (see Fig. S3D in the supplementary material). This
suggests that activation of Fgfr3 signaling might promote chondrocyte
maturation around E13.5.
As the upregulated Fgfs might not necessarily signal through Fgfr3, we
performed limb explant cultures using E12.5 and E13.5 forelimbs from
Wnt9a mutant, heterozygous and wild-type littermates to test whether
inhibiting Fgf signaling in Wnt9a mutants would rescue Ihh
expression levels. Limbs of corresponding limb pairs were cultured in the
presence of DMSO or SU5402, a kinase inhibitor specific to Fgfrs
(Mohammadi et al., 1997
).
Treatment with SU5402 resulted in a strong reduction in the domain size and
expression levels of Ihh in wild-type and heterozygous E12.5 cultured
humeri (n=5; see Fig. S3E in the supplementary material), while in
E13.5 limbs only a size reduction was visible (see Fig. S4F in the
supplementary material). In Wnt9a-/- E12.5 and E13.5
humeri, Ihh expression was even further downregulated (n=3;
see Fig. S3E,F in the supplementary material). No Col10a1 expression
was detected at E12.5 in control and inhibitor-treated limbs (data not shown),
while the Col10a1 expression domain was not significantly affected at
E13.5 (see Fig. S3G in the supplementary material). Treatment with SU5402 did
not notably increase the size reduction of the Col10a1 domain already
present in Wnt9a-/- humeri, but as in the wild-type and
heterozygous humeri, Col10a1 expression was slightly decreased (see
Fig. S3G in the supplementary material). Based on our analysis, we would
conclude that Fgf signaling at early developmental stages is a positive
regulator of chondrocyte maturation. Most importantly, our data suggest that
Fgfs do not contribute to the observed downregulation of Ihh in
Wnt9a mutants.
Wnt9a signals through ß-catenin regulating chondrocyte maturation
Gain-of-function experiments suggested that Wnt9a signals through the
canonical ß-catenin pathway (Day et
al., 2005
; Guo et al.,
2004
) (this work). To assess this further, we looked at genetic
interaction between Wnt9a and ß-catenin with regard to
chondrocyte maturation at E12.5-E15.5 in embryos double heterozygous for
Wnt9a and ß-catenin. At E12.5, but not at E13.5, Ihh
expression levels were reduced in double-heterozygous embryos compared with
wild-type or Wnt9a+/- littermates
(Fig. 6A, and data not shown).
Expression levels and domain size of Ihh were further reduced in
Wnt9a-/-;ß-cat+/- in comparison
with Wnt9a-/- single mutants at E12.5
(Fig. 6A). Ptch1
expression in chondrocytes and periosteal cells at E13.5 was only slightly
reduced in the double heterozygous humeri
(Fig. 6A). In
Wnt9a-/-;ß-cat+/- humeri, a
further reduction in Ptch1 expression in comparison with
Wnt9a single mutants was primarily noticeable in the periosteum,
where Ptch1 was less strongly expressed (arrowheads in
Fig. 6A). The Col10a1
expression domain was also reduced in size in the double heterozygous at E13.5
and even further reduced in
Wnt9a-/-;ß-cat+/- mutant humeri
(Fig. 6A). At E15.5, the
expression domains of Ihh and Col10a1 were closer together
in Wnt9a+/-;ß-cat+/- mutant
humeri compared with wild type (Fig.
6B), demonstrating a delay in chondrocyte maturation. This delay
in chondrocyte maturation and mineralization was also noticeable in skeletal
preparations of E15.5 embryos, where the mineralized region in the long bones,
particularly scapula and humerus, was reduced in size in
Wnt9a+/-;ß-cat+/- to a similar
extent as in Wnt9a-/- embryos
(Fig. 6D). Consistent with the
observation that Wnt9a signaling led to stabilization of ß-catenin,
nuclear ß-catenin levels were reduced in prehypertrophic chondrocytes and
in articular chondrocytes in Wnt9a-/- skeletal elements
(Fig. 6C). Thus, Wnt9a is
probably regulating chondrocyte maturation and Ihh expression through
the canonical Wnt/ß-catenin pathway.
|
| DISCUSSION |
|---|
|
|
|---|
|
Wnt9a regulates Ihh expression through the canonical ß-catenin pathway
The levels of ß-catenin are reduced in prehypertrophic chondrocytes in
Wnt9a mutants, while Wnt9a overexpression leads to an
increase of ß-catenin in vitro. This, together with the fact that
ß-catenin and Lef1 associate with the Ihh promoter in vivo,
suggests that Wnt9a-dependent regulation of Ihh is probably mediated
via the canonical/ß-catenin pathway. This is further supported by the
observations that Ihh expression levels in humeri of
Wnt9a;ß-catenin double heterozygous animals were slightly
reduced and that Ihh expression varies from downregulation to
temporary loss or delayed expression in skeletal elements of mice lacking
ß-catenin activity depending on the Cre-deleter line (T.P.H. and C.H.,
unpublished) (Akiyama et al.,
2004
; Hu et al.,
2005
). Ihh expression in the humerus and femur is also
transcriptionally dependent on Runx2, and in more distal bones it
requires the activity of Runx2 and Runx3
(Inada et al., 1999
;
Kim et al., 1999
;
Yoshida et al., 2004
).
Runx2 has been recently suggested to be direct target for canonical
Wnt/ß-catenin signaling in osteoblasts
(Gaur et al., 2005
); however,
chondrogenic Runx2 expression levels were not significantly changed
at the onset of Ihh downregulation at E12.5 in Wnt9a mutants
(data not shown). The slight decrease in Runx2 levels at later stages
is probably due to the downregulation of Ihh, as Runx2
expression is dependent on Ihh signaling
(Hu et al., 2005
;
Long et al., 2004
).
Furthermore, Runx2 expression was also not significantly altered in
ß-catenin mutant limbs (Day et al.,
2005
; Hill et al.,
2005
; Hu et al.,
2005
). Interestingly, Runx2 activity in chondrocytes is modulated
by interaction with co-repressors such as HDAC4 and co-activators such as
groucho 5 (Vega et al., 2004
;
Wang et al., 2004
). Groucho 5
(Grg5; Aes - Mouse Genome Informatics) acts as a derepressor
in ß-catenin/TCF signaling, unlike groucho 1-4, which act as
co-repressors (Brantjes et al.,
2001
). Intriguingly, Grg5-/- mice display a
postnatal, temporary reduction in Ihh expression, which is further
dependent on Runx2 levels (Wang
et al., 2004
; Wang et al.,
2002
). Thus, it is conceivable that the ß-catenin/Lef1
complex and Runx2 could cooperatively regulate Ihh. Our data,
together with published observations, suggest that Wnt signaling regulates the
level of Ihh expression temporally during embryonic and postnatal
development, thereby controlling chondrocyte maturation and the growth of
skeletal elements.
A Wnt canon controlling skeletogenesis
The fact that the effect of Wnt9a regulation is only temporary can
be explained by the presence of other Wnt genes, which could potentially
compensate at later stages for the loss of Wnt9a activity.
Interestingly, when we analyzed the expression levels of various Wnt genes
(Wnt4, Wnt5a, Wnt5b and Wnt6) by semi-quantitative and
real-time RT-PCR, we found that Wnt4 expression was elevated at E12.5
and E13.5 in Wnt9a mutant compared with wild-type humeri (see Fig.
S5C in the supplementary material; data not shown). Concomitantly, chondrocyte
maturation was further delayed in Wnt9a/Wnt4 double mutant humeri
(see Fig. S5A in the supplementary material); however, this did not result in
further reduction of Ihh expression levels. Wnt4 has been
suggested to be a positive regulator of chondrocyte maturation
(Hartmann and Tabin, 2000
).
Although Wnt4 mutant mice have no reported skeletal phenotype
(Stark et al., 1994
), we did
observe a slight delay in chondrocyte maturation in the appendicular skeleton
of single mutants (see Fig. S5B in the supplementary material). Our
loss-of-function analysis, together with previous gain-of-function data
(Guo et al., 2004
;
Hartmann and Tabin, 2000
),
suggests that both Wnt9a and Wnt4 are positive regulators of
chondrocyte maturation.
Therefore, we propose the following model for Wnts and chondrogenesis:
Wnt9a signals from the perichondrium or joints and regulates
Ihh levels, probably via the canonical pathway, thereby regulating
the pace of chondrocyte proliferation and maturation. In addition, Wnt9a
signaling seems to negatively control Wnt4, which is expressed in
prehypertrophic chondrocytes from E12.5 onwards (see Fig. S5D in the
supplementary material). Wnt4 signaling regulates chondrocyte maturation at
the transition from prehypertrophic to hypertrophic chondrocytes, but does not
alter Ihh levels. Similarly, Wnt5a, which is expressed in the
perichondrium and prehypertrophic chondrocytes, controls chondrocyte
proliferation and maturation independently of Ihh
(Yang et al., 2003
). Part of
the Wnt5a loss-of-function phenotype might be due to attenuation of
ß-catenin-mediated activities (Topol
et al., 2003
). Surprisingly, the phenotypes of the Wnt5a
loss- and gain-of-function mice are very similar
(Yang et al., 2003
).
Therefore, it will be interesting to test whether those phenotypes depend in
part on ß-catenin.
In addition, our work shows that Wnt signaling is required to maintain
joint integrity by actively suppressing chondrocyte differentiation.
Interestingly, Ihh mutant mice also display joint defects
(St-Jacques et al., 1999
) and
recent work has shown that the canonical Wnt pathway is affected in
Ihh mutants (Hu et al.,
2005
). Pathological alterations of the joint with spontaneous
formation of cartilaginous nodules are known in humans as synovial
chondromatosis. The etiology of this disease is largely unknown. However,
deregulation of hedgehog signaling has recently been implicated in disease
predisposition (Hopyan et al.,
2005
). It originates from chondroid metaplasia of connective
tissue of the synovial membrane, causing pain, joint dysfunction and
ultimately joint destruction. Thus, it will be important to examine whether
the canonical Wnt/ß-catenin pathway is altered in affected
individuals.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Akiyama, H., Lyons, J. P., Mori-Akiyama, Y., Yang, X., Zhang,
R., Zhang, Z., Deng, J. M., Taketo, M. M., Nakamura, T., Behringer, R. R. et
al. (2004). Interactions between Sox9 and beta-catenin
control chondrocyte differentiation. Genes Dev.
18,1072
-1087.
Archer, C. W., Dowthwaite, G. P. and Francis-West, P. (2003). Development of synovial joints. Birth Defects Res. C Embryo Today 69,144 -155.[CrossRef][Medline]
Brantjes, H., Roose, J., van De Wetering, M. and Clevers, H.
(2001). All Tcf HMG box transcription factors interact with
Groucho-related co-repressors. Nucleic Acids Res.
29,1410
-1419.
Brunet, L. J., McMahon, J. A., McMahon, A. P. and Harland, R.
M. (1998). Noggin, cartilage morphogenesis, and joint
formation in the mammalian skeleton. Science
280,1455
-1457.
Capdevila, J. and Johnson, R. L. (1998). Endogenous and ectopic expression of noggin suggests a conserved mechanism for regulation of BMP function during limb and somite patterning. Dev. Biol. 197,205 -217.[CrossRef][Medline]
Chen, L., Li, C., Qiao, W., Xu, X. and Deng, C.
(2001). A Ser(365)
Cys mutation of fibroblast growth factor
receptor 3 in mouse downregulates Ihh/PTHrP signals and causes severe
achondroplasia. Hum. Mol. Genet.
10,457
-465.
Day, T. F., Guo, X., Garrett-Beal, L. and Yang, Y. (2005). Wnt/beta-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Dev. Cell 8, 739-750.[CrossRef][Medline]
Debeer, P., Huysmans, C., Van de Ven, W. J., Fryns, J. P. and Devriendt, K. (2005). Carpal and tarsal synostoses and transverse reduction defects of the toes in two brothers heterozygous for a double de novo NOGGIN mutation. Am. J. Med. Genet. A 134,318 -320.[Medline]
Francis-West, P. H., Richardson, M. K., Bell, E., Chen, P., Luyten, F., Adelfattah, A., Barlow, A. J., Brickell, P. M., Wolpert, L. and Archer, C. W. (1996). The effect of overexpression of BMPs and GDF-5 on the development of chick limb skeletal elements. Ann. N. Y. Acad. Sci. 785,254 -255.[Medline]
Francis-West, P. H., Parish, J., Lee, K. and Archer, C. W. (1999). BMP/GDF-signalling interactions during synovial joint development. Cell Tissue Res. 296,111 -119.[CrossRef][Medline]
Garciadiego-Cazares, D., Rosales, C., Katoh, M. and
Chimal-Monroy, J. (2004). Coordination of chondrocyte
differentiation and joint formation by alpha5beta1 integrin in the developing
appendicular skeleton. Development
131,4735
-4742.
Gaur, T., Lengner, C. J., Hovhannisyan, H., Bhat, R. A., Bodine,
P. V., Komm, B. S., Javed, A., van Wijnen, A. J., Stein, J. L., Stein, G. S.
et al. (2005). Canonical WNT signaling promotes osteogenesis
by directly stimulating RUNX2 gene expression. J. Biol.
Chem. 280,33132
-33140.
Gong, Y., Krakow, D., Marcelino, J., Wilkin, D., Chitayat, D., Babul-Hirji, R., Hudgins, L., Cremers, C. W., Cremers, F. P., Brunner, H. G. et al. (1999). Heterozygous mutations in the gene encoding noggin affect human joint morphogenesis. Nat. Genet. 21,302 -304.[CrossRef][Medline]
Guo, X., Day, T. F., Jiang, X., Garrett-Beal, L., Topol, L. and
Yang, Y. (2004). Wnt/beta-catenin signaling is sufficient and
necessary for synovial joint formation. Genes Dev.
18,2404
-2417.
Hartmann, C. and Tabin, C. J. (2000). Dual roles of Wnt signaling during chondrogenesis in the chicken limb. Development 127,3141 -3159.[Abstract]
Hartmann, C. and Tabin, C. J. (2001). Wnt-14 plays a pivotal role in inducing synovial joint formation in the developing appendicular skeleton. Cell 104,341 -351.[CrossRef][Medline]
Hendrickson, B. A., Conner, D. A., Ladd, D. J., Kendall, D.,
Casanova, J. E., Corthesy, B., Max, E. E., Neutra, M. R., Seidman, C. E. and
Seidman, J. G. (1995). Altered hepatic transport of
immunoglobulin A in mice lacking the J chain. J. Exp.
Med. 182,1905
-1911.
Hill, T. P., Spaeter, D., Taketo, M. M., Birchmeier, W. and Hartmann, C. (2005). Canonical Wnt/beta-catenin signaling prevents osteoblasts from differentiating into chondrocytes. Dev. Cell 8,727 -738.[CrossRef][Medline]
Hopyan, S., Nadesan, P., Yu, C., Wunder, J. and Alman, B. A. (2005). Dysregulation of hedgehog signalling predisposes to synovial chondromatosis. J. Pathol. 206,143 -150.[CrossRef][Medline]
Hu, H., Hilton, M. J., Tu, X., Yu, K., Ornitz, D. M. and Long,
F. (2005). Sequential roles of Hedgehog and Wnt signaling in
osteoblast development. Development
132, 49-60.
Huelsken, J., Vogel, R., Brinkmann, V., Erdmann, B., Birchmeier,
C. and Birchmeier, W. (2000). Requirement for beta-catenin in
anterior-posterior axis formation in mice. J. Cell
Biol. 148,567
-578.
Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G. and Birchmeier, W. (2001). beta-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell 105,533 -545.[CrossRef][Medline]
Inada, M., Yasui, T., Nomura, S., Miyake, S., Deguchi, K., Himeno, M., Sato, M., Yamagiwa, H., Kimura, T., Yasui, N. et al. (1999). Maturational disturbance of chondrocytes in Cbfa1-deficient mice. Dev. Dyn. 214,279 -290.[CrossRef][Medline]
Karp, S. J., Schipani, E., St-Jacques, B., Hunzelman, J., Kronenberg, H. and McMahon, A. P. (2000). Indian hedgehog coordinates endochondral bone growth and morphogenesis via parathyroid hormone related-protein-dependent and -independent pathways. Development 127,543 -548.[Abstract]
Kengaku, M., Capdevila, J., Rodriguez-Esteban, C., De La Pena,
J., Johnson, R. L., Belmonte, J. C. and Tabin, C. J. (1998).
Distinct WNT pathways regulating AER formation and dorsoventral polarity in
the chick limb bud. Science
280,1274
-1277.
Kim, I. S., Otto, F., Zabel, B. and Mundlos, S. (1999). Regulation of chondrocyte differentiation by Cbfa1. Mech. Dev. 80,159 -170.[CrossRef][Medline]
Koyama, E., Golden, E. B., Kirsch, T., Adams, S. L., Chandraratna, R. A., Michaille, J. J. and Pacifici, M. (1999). Retinoid signaling is required for chondrocyte maturation and endochondral bone formation during limb skeletogenesis. Dev. Biol. 208,375 -391.[CrossRef][Medline]
Kronenberg, H. M. (2003). Developmental regulation of the growth plate. Nature 423,332 -336.[CrossRef][Medline]
Li, C., Chen, L., Iwata, T., Kitagawa, M., Fu, X. Y. and Deng, C. X. (1999). A Lys644Glu substitution in fibroblast growth factor receptor 3 (FGFR3) causes dwarfism in mice by activation of STATs and ink4 cell cycle inhibitors. Hum. Mol. Genet. 8, 35-44.[Medline]
Long, F., Chung, U. I., Ohba, S., McMahon, J., Kronenberg, H. M.
and McMahon, A. P. (2004). Ihh signaling is directly required
for the osteoblast lineage in the endochondral skeleton.
Development 131,1309
-1318.
Martens, J. H., O'Sullivan, R. J., Braunschweig, U., Opravil, S., Radolf, M., Steinlein, P. and Jenuwein, T. (2005). The profile of repeat-associated histone lysine methylation states in the mouse epigenome. EMBO J. 24,800 -812.[CrossRef][Medline]
McLeod, M. J. (1980). Differential staining of cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S. Teratology 22,299 -301.[CrossRef][Medline]
Merino, R., Macias, D., Ganan, Y., Economides, A. N., Wang, X., Wu, Q., Stahl, N., Sampath, K. T., Varona, P. and Hurle, J. M. (1999). Expression and function of Gdf-5 during digit skeletogenesis in the embryonic chick leg bud. Dev. Biol. 206,33 -45.[CrossRef][Medline]
Minina, E., Kreschel, C., Naski, M. C., Ornitz, D. M. and Vortkamp, A. (2002). Interaction of FGF, Ihh/Pthlh, and BMP signaling integrates chondrocyte proliferation and hypertrophic differentiation. Dev. Cell 3, 439-449.[CrossRef][Medline]
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh,
B. K., Hubbard, S. R. and Schlessinger, J. (1997). Structures
of the tyrosine kinase domain of fibroblast growth factor receptor in complex
with inhibitors. Science
276,955
-960.
Nalin, A. M., Greenlee, T. K., Jr and Sandell, L. J. (1995). Collagen gene expression during development of avian synovial joints: transient expression of types II and XI collagen genes in the joint capsule. Dev. Dyn. 203,352 -362.[Medline]
Naski, M. C., Colvin, J. S., Coffin, J. D. and Ornitz, D. M. (1998). Repression of hedgehog signaling and BMP4 expression in growth plate cartilage by fibroblast growth factor receptor 3. Development 125,4977 -4988.[Abstract]
Nishimura, K., Solchaga, L. A., Caplan, A. I., Yoo, J. U., Goldberg, V. M. and Johnstone, B. (1999). Chondroprogenitor cells of synovial tissue. Arthritis Rheum. 42,2631 -2637.[CrossRef][Medline]
Ohbayashi, N., Shibayama, M., Kurotaki, Y., Imanishi, M.,
Fujimori, T., Itoh, N. and Takada, S. (2002). FGF18 is
required for normal cell proliferation and differentiation during osteogenesis
and chondrogenesis. Genes Dev.
16,870
-879.
Opperman, L. A. (2000). Cranial sutures as intramembranous bone growth sites. Dev. Dyn. 219,472 -485.[CrossRef][Medline]
Ornitz, D. M. and Marie, P. J. (2002). FGF
signaling pathways in endochondral and intramembranous bone development and
human genetic disease. Genes Dev.
16,1446
-1465.
Pathi, S., Rutenberg, J. B., Johnson, R. L. and Vortkamp, A. (1999). Interaction of Ihh and BMP/Noggin signaling during cartilage differentiation. Dev. Biol. 209,239 -253.[CrossRef][Medline]
Pizette, S. and Niswander, L. (2000). BMPs are required at two steps of limb chondrogenesis: formation of prechondrogenic condensations and their differentiation into chondrocytes. Dev. Biol. 219,237 -249.[CrossRef][Medline]
Ralphs, J. R. and Benjamin, M. (1994). The joint capsule: structure, composition, ageing and disease. J. Anat. 184,503 -509.[Medline]
Rountree, R. B., Schoor, M., Chen, H., Marks, M. E., Harley, V., Mishina, Y. and Kingsley, D. M. (2004). BMP receptor signaling is required for postnatal maintenance of articular cartilage. PLoS Biol. 2,e355 .[CrossRef][Medline]
Settle, S. H., Jr, Rountree, R. B., Sinha, A., Thacker, A., Higgins, K. and Kingsley, D. M. (2003). Multiple joint and skeletal patterning defects caused by single and double mutations in the mouse Gdf6 and Gdf5 genes. Dev. Biol. 254,116 -130.[CrossRef][Medline]
St-Jacques, B., Hammerschmidt, M. and McMahon, A. P.
(1999). Indian hedgehog signaling regulates proliferation and
differentiation of chondrocytes and is essential for bone formation.
Genes Dev. 13,2072
-2086.
Stark, K., Vainio, S., Vassileva, G. and McMahon, A. P. (1994). Epithelial transformation of metanephric mesenchyme in the developing kidney regulated by Wnt-4. Nature 372,679 -683.[CrossRef][Medline]
Storm, E. E. and Kingsley, D. M. (1996). Joint patterning defects caused by single and double mutations in members of the bone morphogenetic protein (BMP) family. Development 122,3969 -3979.[Abstract]
Storm, E. E. and Kingsley, D. M. (1999). GDF5 coordinates bone and joint formation during digit development. Dev. Biol. 209,11 -27.[CrossRef][Medline]
Storm, E. E., Huynh, T. V., Copeland, N. G., Jenkins, N. A., Kingsley, D. M. and Lee, S. J. (1994). Limb alterations in brachypodism mice due to mutations in a new member of the TGF beta-superfamily. Nature 368,639 -643.[CrossRef][Medline]
Sun, X., Lewandoski, M., Meyers, E. N., Liu, Y. H., Maxson, R. E., Jr and Martin, G. R. (2000). Conditional inactivation of Fgf4 reveals complexity of signalling during limb bud development. Nat. Genet. 25,83 -86.[CrossRef][Medline]
Topol, L., Jiang, X., Choi, H., Garrett-Beal, L., Carolan, P. J.
and Yang, Y. (2003). Wnt-5a inhibits the canonical Wnt
pathway by promoting GSK-3-independent beta-catenin degradation. J.
Cell Biol. 162,899
-908.
Tsumaki, N., Nakase, T., Miyaji, T., Kakiuchi, M., Kimura, T., Ochi, T. and Yoshikawa, H. (2002). Bone morphogenetic protein signals are required for cartilage formation and differently regulate joint development during skeletogenesis. J. Bone Miner. Res. 17,898 -906.[CrossRef][Medline]
Vega, R. B., Matsuda, K., Oh, J., Barbosa, A. C., Yang, X., Meadows, E., McAnally, J., Pomajzl, C., Shelton, J. M., Richardson, J. A. et al. (2004). Histone deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Cell 119,555 -566.[CrossRef][Medline]
Vortkamp, A., Lee, K., Lanske, B., Segre, G. V., Kronenberg, H. M. and Tabin, C. J. (1996). Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science 273,613 -622.[Abstract]
Wang, W. F., Wang, Y. G., Reginato, A. M., Plotkina, S., Gridley, T. and Olsen, B. R. (2002). Growth defect in Grg5 null mice is associated with reduced Ihh signaling in growth plates. Dev. Dyn. 224,79 -89.[CrossRef][Medline]
Wang, W., Wang, Y. G., Reginato, A. M., Glotzer, D. J., Fukai, N., Plotkina, S., Karsenty, G. and Olsen, B. R. (2004). Groucho homologue Grg5 interacts with the transcription factor Runx2-Cbfa1 and modulates its activity during postnatal growth in mice. Dev. Biol. 270,364 -381.[CrossRef][Medline]
Yang, Y., Topol, L., Lee, H. and Wu, J. (2003).
Wnt5a and Wnt5b exhibit distinct activities in coordinating chondrocyte
proliferation and differentiation. Development
130,1003
-1015.
Yoshida, C. A., Yamamoto, H., Fujita, T., Furuichi, T., Ito, K.,
Inoue, K., Yamana, K., Zanma, A., Takada, K., Ito, Y. et al.
(2004). Runx2 and Runx3 are essential for chondrocyte maturation,
and Runx2 regulates limb growth through induction of Indian hedgehog.
Genes Dev. 18,952
-963.
This article has been cited by other articles:
![]() |
H. Zhou, W. Mak, R. Kalak, J. Street, C. Fong-Yee, Y. Zheng, C. R. Dunstan, and M. J. Seibel Glucocorticoid-dependent Wnt signaling by mature osteoblasts is a key regulator of cranial skeletal development in mice Development, February 1, 2009; 136(3): 427 - 436. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pacifici, F. R.T. Nelson, and P. K. Hansma On the Horizon From the ORS J. Am. Acad. Ortho. Surg., October 1, 2008; 16(10): 616 - 618. [Full Text] [PDF] |
||||
![]() |
M. Nagayama, M. Iwamoto, A. Hargett, N. Kamiya, Y. Tamamura, B. Young, T. Morrison, H. Takeuchi, M. Pacifici, M. Enomoto-Iwamoto, et al. Wnt/{beta}-catenin Signaling Regulates Cranial Base Development and Growth Journal of Dental Research, March 1, 2008; 87(3): 244 - 249. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Spagnoli, L. O'Rear, R. L. Chandler, F. Granero-Molto, D. P. Mortlock, A. E. Gorska, J. A. Weis, L. Longobardi, A. Chytil, K. Shimer, et al. TGF-{beta} signaling is essential for joint morphogenesis J. Cell Biol., July 30, 2007; 177(6): 1105 - 1117. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||