|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online July 27, 2006
doi: 10.1242/10.1242/dev.02469



,*Cardiovascular Research Center, Massachusetts General Hospital and the Department of Medicine, Harvard Medical School, 149 13th Street, Charlestown, MA 02129, USA.
* Authors for correspondence (e-mail: jmably{at}partners.org; mark.fishman{at}novartis.com)
Accepted 1 June 2006
| SUMMARY |
|---|
|
|
|---|
Key words: santa, valentine, Myocardial growth, Cerebral cavernous malformations, CCM
| INTRODUCTION |
|---|
|
|
|---|
We have identified three mutations that block concentric growth without
affecting overall cell number or the organization of anterior-posterior
growth. We recently cloned one of these, heart of glass
(heg), which turned out to be a novel gene, expressed in the
endocardium. Here we focus on the other two genes, santa
(san) and valentine (vtn). By positional cloning,
we identify san as the zebrafish homolog of human CCM1 (KRIT1)
(Laberge-le Couteulx et al.,
1999
; Sahoo et al.,
1999
) and vtn, the zebrafish homolog of human CCM2
(Denier et al., 2004
).
Mutations in these genes in humans have been implicated in the autosomal
dominant disease, cerebral cavernous malformations (CCM).
Evidence from potential interacting protein motifs, and from cross-sensitization of phenotype though morpholino injection, suggests that san, vtn and heg may interact. This suggests that concentric growth of the ventricle is an essential element of cardiac patterning, controlled at least in part by signals from the endocardium, and involving a pathway comprised of san, vtn and heg.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The zebrafish cardiac myosin light chain-2 (cmlc2) promoter-DsRed
(red fluorescent protein) line has been described previously
(Mably et al., 2003
).
Transgenic cmlc2:DsRed2-nuc zebrafish were bred with san
heterozygotes. The progeny were raised and incrossed to identify san
heterozygotes expressing red fluorescent protein (RFP). The embryos from these
clutches were scored for the san phenotype. Wild-type siblings and
mutant embryos were raised at 28.5°C until 48 or 72 hours post
fertilization (hpf), at which time the embryos were flat-mounted and
RFP-positive myocardial cells were counted
(Mably et al., 2003
;
Shu et al., 2003
).
Morpholino-injected transgenic cmlc2:DsRed2-nuc embryos were analyzed
in a similar manner. The same flat-mount technique was used to determine
endocardial cell number in morpholino-injected transgenic
(fli1:nEGFP)y7 embryos
(Roman et al., 2002
). The
nuclear localization of each fluorescent protein facilitates easier
determination of cell number.
Positional cloning
Embryos were separated into mutant and wild-type pools based on phenotypic
analysis. Genomic DNA was isolated from individual embryos by incubation in
DNA isolation buffer overnight at 50°C (DNA isolation buffer: 10 mmol/l
Tris-HCl, pH 8.3; 50 mmol/l KCl; 0.3% Tween-20; 0.3% Nonidet P40; 0.5 mg/ml
proteinase K). Proteinase K was inactivated before PCR setup by heating
samples to 98°C for 10 minutes. PCR reactions were performed using diluted
genomic DNA as described (Knapik et al.,
1996
). Bulked segregant analysis
(Michelmore et al., 1991
) and
identification of the critical genetic interval was performed essentially as
described previously (Mably et al.,
2003
). To identify the san gene, bacterial artificial
chromosome (BAC) clones 92i12 and 184d07 (see Fig. S3 in the supplementary
material) were sequenced by shotgun cloning of partial AluI and
Sau3AI digested fragments subcloned into pBluescript. Sequence
analysis was performed on an ABI3700 to generate approximately fivefold
coverage. The sequence was assembled using the Phred/Phrap/Consed programs
(Ewing and Green, 1998
;
Ewing et al., 1998
;
Gordon et al., 1998
). The
vtn gene was identified through morpholino analysis of genes
identified as candidates by position through synteny with the Takifugu
rubripes (fugu) genome, followed by sequencing of cDNA and genomic DNA
from mutant and wild-type embryos.
RNA isolation and real-time PCR analysis
RNA was isolated using trizol (Invitrogen) or RNeasy columns (Qiagen) as
instructed by the manufacturer. For determination of the mRNA transcript
variants induced by the splice site blocking morpholinos, the QIAGEN OneStep
RT-PCR (reverse transcriptase polymerase chain reaction) kit was used with
primers designed from exons on either side of the morpholino target. The PCR
primers used to detect the splice variants induced by the various morpholinos
are summarized as follows.
san exon 1 donor: san_exon01_F1, 5'-AAAGAGGAGCTGCATGATGG-3'; san_exon02_R1, 5'-ATATGGGCTTGGTGGTTTCA-3'
san exon 14 donor: san_exon12_F1, 5'-TAGCCTCCTCCTGCAGATCA-3'; san_exon16_R1, 5'-CTTCATCAGCAGCTTCACGA-3'
vtn exon 2 donor: vtn_exon01_F1, 5'-TGAAGAGCATTTGTACGTAGAG-3'; vtn_exon04_R1, 5'-TCTCTGATGTAGGACACAGC-3'
Analysis of mRNA levels in the san wild type and -/- (mutant) embryos was performed using the Qiagen QuantiTect® SYBR® Green RT-PCR kit, as described by the manufacturer (Qiagen). The primers used for this analysis were designed to exon 13 (5'-GAGCAAAGCACATCACTGGA-3') and exon 14 (5'-ATCACCTTGTGTGTGCTGGA-3').
DNA cloning and RNA rescue
For RT-PCR analysis, RNA was isolated (RNeasy columns, Qiagen) from pools
of wild-type and mutant embryos. cDNA was amplified using RACE (SMART RACE
cDNA amplification kit, Clontech). Fragments were then subcloned into
PCRII-TOPO (Invitrogen). The 5' end of the san cDNA was
amplified by 5' RACE with a primer designed from the full-length cDNA
predicted by Genscan (Burge and Karlin,
1998
) (5'-TTCAGCAGGTTGGGGTTACAGTTGC-3'). A 3'
RACE product was generated using a primer
(5'-TCTCAGTCAAACAGCTGGACAGCGAC-3') designed to amplify an
overlying fragment of the san cDNA. Both cDNA fragments were digested
with SphI (a unique restriction site within the overlapping region)
and EcoRI then ligated into EcoRI-digested pCS2 vector
(Turner and Weintraub, 1994
)
to create the full-length san cDNA construct. Clones with the correct
orientation were identified by sequencing (GenBank Accession Number
DQ677877).
The full-length vtn cDNA was amplified using primers designed to
the 5' and 3'UTR sequences within the Genscan predicted cDNA
(5'UTR_F1, AATACAGCGAAAATGAAGAGCA; 3'UTR_R1,
CAGCATCCAAACTTTCAGCA). The PCR product was subcloned into pCRII-TOPO
(Invitrogen). The vtn cDNA was excised from pCRII-TOPO by digestion
with EcoRI, and then subcloned into EcoRI-digested pCS2
(Turner and Weintraub, 1994
).
Clones with the correct orientation were identified by sequencing (GenBank
Accession Number DQ677878).
Injection RNA was generated from the full-length pCS2 san and vtn constructs using the Ambion mMESSAGE mMACHINE kit (digested with NotI followed by transcription with SP6 polymerase).
Whole-mount in-situ hybridization and antibody staining
For whole-mount in-situ hybridization and immunohistochemistry, embryos
were fixed in 4% paraformaldehyde in phosphate-buffered saline, and then
stored in 100% methanol at -20°C. Digoxigenin-labeled antisense RNA probes
were generated by in-vitro transcription (Roche), and in-situ hybridization
was carried out as previously described
(Jowett and Lettice, 1994
;
Mably et al., 2003
). The
san probe used was derived from a partial EST in pSPORT1, fb36f07
(GenBank accession: AI415912, digested with EcoRI followed by
transcription with SP6 polymerase). The vtn probe was derived from
the full-length pCS2 construct described previously (digested with
BamHI followed by transcription with T7 polymerase). Embryos were
allowed to develop in BM purple (Roche) at 28°C, then stopped by several
rinses in 1XPBT and stored at 4°C.
Antibody staining with the S46 and MF20 antibodies (Developmental Studies
Hybridoma Bank, University of Iowa) was performed as previously described
(Mably et al., 2003
;
Yelon et al., 1999
).
Morpholino analysis
The antisense morpholino oligonucleotide designed over the san
exon 1 donor site [5'-GCTTTATTTCACCTCAC(intron-exon)CTCATAGG-3',
GeneTools, LLC] was dissolved at a concentration of 200 µmol/l in 1x
Danieau's buffer [5 mmol/l Hepes pH 7.6, 58 mmol/l NaCl, 0.7 mmol/l KCl, 0.6
mmol/l Ca(NO3)2, 0.4 mmol/l MgSO4]. One nanoliter of
this solution or 1x Danieau's buffer was injected into each 1-4 cell
embryo before allowing the embryos to develop at 28.5°C. The analysis with
the san exon 14 donor site morpholino [5'-TTGAAGTCTCAC
(intron-exon)TTTTGTCTCCATG-3', GeneTools, LLC] and vtn exon 2
donor site morpholino
[5'-GAAGCTGAGTAATAC(intron-exon)CTTAACTTCC-3', GeneTools, LLC]
were performed in the same manner.
| RESULTS |
|---|
|
|
|---|
By contrast to the wild type, in which the myocardial wall is 2-3 cells
thick (Fig. 1A), san
and vtn both had only a single layer, in both chambers of the heart
(Fig. 1C,E). Cells within the
myocardium of both chambers of the heart were differentiated as cardiac cells,
indicated by labeling with molecular markers for the atrium (S46 antibody) and
ventricle (ventricular myosin heavy chain, vMHC;
Fig. 1B,D,F)
(Yelon et al., 1999
). Both the
endocardial and myocardial layers of the heart were present and individual
myocardial cells were thinner than wild type
(Fig. 1C',E').
By 48 hpf, wild-type zebrafish embryos develop valvular precursors,
endocardial cushions, at the atrioventricular junction
(Hu et al., 2000
). Endocardial
cushions were absent in san and vtn mutant embryos, as
determined by neuregulin staining (Milan
et al., 2006
), and the myocardial and endocardial layers, which
were very thin, were closely juxtaposed
(Fig. 1; see Fig. S1 in the
supplementary material). Electron microscopic (EM) analysis of the structure
of cardiomyocytes within the ventricles of san and vtn
hearts revealed the presence of sarcomeres, consistent with the ability of the
hearts to contract (see Fig. S2 in the supplementary material). The absence of
endocardial cushions and the variations in cellular morphology detected by EM
could both be secondary effects of the severe cardiac dilation.
Myocardial and endocardial cell number is normal
The massive enlargement of the san and vtn hearts could
be suggestive of an increase in cell number. To determine cell number, we
specifically labeled cardiomyocytes in vivo, using transgenic zebrafish with a
red fluorescent protein (DsRed2-nuc) expressed under the control of the
cardiac myosin light chain-2 (cmlc2) promoter
(Mably et al., 2003
;
Rottbauer et al., 2002
). This
assay indicated that the number of myocardial cells was indistinguishable
between wild-type and san mutant embryos and between mock-injected
and vtn morphant embryos at 2 days post fertilization (dpf)
(Table 1). Similarly, we
determined the number of endocardial cells in mock-injected and san
and vtn morphant embryos at 2 dpf
(Table 1). Morpholinos were
injected into the progeny of transgenic (fli1:nEGFP)y7
crossed with transgenic cmlc2:DsRed2-nuc zebrafish. The number of
eGFP-expressing cells in the hearts of progeny expressing both the myocardial
RFP and endothelial/endocardial eGFP were determined. As noted for the
myocardial cell counts, endocardial cell number did not vary from that
determined for wild type. Hence, the dilated heart is not caused by an
increase in the number of cardiac cells but rather in the manner they are
assembled. The myocardial cells stretch in a single layer along the
circumference of the cardiac chambers, rather than intercalating to form a
thick myocardial wall, resulting in the observed chamber dilation.
|
|
(Zawistowski et al., 2002
F substitution results in a motif that can still
interact with a PTB domain but is not subject to regulation by phosphorylation
state (Calderwood et al.,
2003
Sequencing of the m775 (Stainier et
al., 1996
) san cDNA predicts a splicing defect with a
consequent in-frame deletion of exon 14. This results from a splice acceptor
mutation within the intron at the start of exon 14
(agAG
aaAG; Fig.
2A). The affect on the level of full-length san message
was confirmed by real-time PCR amplification of m775 mRNA, showing
significantly decreased levels of RNA transcripts containing exon 14
(Fig. 2B). In addition we
sequenced another san allele, ty219c
(Chen et al., 1996
). This
mutation is a C to A transversion within codon 694 of exon 15 (TAC
TAA)
that predicts a tyrosine change to a stop codon (Y
stop;
Fig. 2A). Both mutations would
be predicted to cause loss of a C-terminal portion of the Santa
protein, possibly disrupting function of the FERM domain.
|
TAA). This would cause a tyrosine change to a stop codon
(Y
stop, Fig. 2C). This
results in the formation of a truncated protein with an incomplete PTB
domain.
|
We also designed a morpholino to block splicing of the donor site at the end of exon 1 in an attempt to create a truncated protein (through the excision of 5' exon sequence and disruption of the reading frame). However, this morpholino caused deletion of 75 base pairs (bp), predicting in-frame loss of 25 amino acids, due to the recruitment of a splice donor site within exon 1 (data not shown). Interestingly, loss of these 25 amino acids was sufficient to produce a complete phenocopy, implicating the N-terminus of the protein as essential for normal function. Injection of mRNA derived from the predicted full-length san cDNA was unable to rescue the mutant phenotype. At high levels, expression of san mRNA in wild-type embryos impaired early development, probably due to misexpression of San in all cells.
vtn
A morpholino was designed to the donor site at the end of exon 2 of the
vtn gene. Injection of this morpholino at the 1-cell stage results in
a complete phenocopy of the vtn mutation (>95% phenocopy with
n>1000, data not shown). Analysis by RT-PCR using primers within
exons flanking exon 2 and sequence analysis of the products revealed
transcripts predicting both a partial and complete loss of exon 2 sequence
(data not shown). Injection of predicted vtn mRNA into progeny of
vtn heterozygote matings rescued embryos completely
(Table 2).
|
Similarly, strong expression of vtn mRNA at 28 hpf was detected in the brain ventricular zone (Fig. 4A-D) with weaker expression in the vein (Fig. 4E,G). vtn mRNA was also obvious in the posterior intermediate cell mass at this stage (Fig. 4A,E,F). By 48 hpf, expression of vtn was weaker, but was detectable in the vein (Fig. 4H-J). At both 28 and 48 hpf, a low level of vtn mRNA was detectable in a region near the dorsal aorta (Fig. 4G,J).
Co-morpholino evidence of interaction of san, vtn and heg
The similarity of phenotype between san, vtn and heg,
along with the predicted interactive ability of protein motifs (PTB domain of
vtn and NPxY motif of san/NPxF motif of heg)
suggested that these proteins might be part of a pathway that controls
concentric growth of the heart. To examine this, we lowered amounts of each
protein by morpholino injection to a level at which fewer than 10% of embryos
demonstrated a complete phenocopy. Combinations of morpholinos were then
injected at these doses to determine if the effects of these morpholinos are
additive. Injection of san and vtn together at these doses
resulted in a dramatic increase in the percentage of embryos exhibiting
complete phenocopy (Fig. 5; see
Table S1 in the supplementary material). When injected together with either
the san or vtn morpholino at low doses, the heg
combinations also produce a significant increase in phenocopy level
(Fig. 5). These results suggest
that san, vtn and heg interact.
|
|
| DISCUSSION |
|---|
|
|
|---|
Through the characterization of two zebrafish mutants, san and
vtn, we introduce here a new genetic pathway, one essential for
myocardial growth and thickening of the ventricular wall in vertebrates. In
the hearts of these mutants, both atrial and ventricular chambers are
correctly specified and hearts possess myofibrils and are able to contract.
Although the number of cells in the heart muscle wall is normal, there is no
concentric growth. Rather, the cells proliferate along the circumference of
the heart, leading to the formation of a hugely dilated heart consisting of a
single layer of myocardium. The targeted deletion of the homolog of
san in mice also results in an enlargement of the cardiac chambers,
particularly the atrium (Whitehead et al.,
2004
). However, the hearts loop normally and develop endocardial
cushions (Whitehead et al.,
2004
). The absence of looping and the loss of endocardial cushion
formation in the zebrafish mutant may represent secondary affects on the
morphology of the heart resulting from the severe cardiac dilation observed or
possible variations in timing requirements between species for these genes
during development.
CCM1 (San) interacts with integrin cytoplasmic domain associated protein-1
(ICAP-1), a modulator of integrin signaling
(Zawistowski et al., 2002
;
Zhang et al., 2001
). Like Vtn
(CCM2), this protein contains a PTB domain. This PTB domain is essential for
the interaction of ICAP-1 with the NPxY motif within the cytoplasmic tail of
ß1 integrin (Chang et al.,
1997
; Zhang and Hemler,
1999
) and with the NPxY domain of CCM1 (amino acids NPAY, see
Fig. 2A). These interactions
with CCM1 and/or ß1 integrin have been proposed to modulate cell-cell and
cell-extracellular matrix communication, essential for a variety of processes,
including cell migration and maintenance of cellular morphology.
Consistent with the morpholino data indicating that san, vtn and
heg interact to control myocardial thickening in the zebrafish heart
during development, recent work has demonstrated a physical interaction
between CCM1 (San) and CCM2 (Vtn) by immunoprecipitation and FRET analysis
(Zawistowski et al., 2005
).
Unlike the interaction between ICAP1 and CCM1, binding to CCM2 was not
completely eliminated by mutagenesis of the N-terminal NPAY motif in
CCM1, although this motif was shown to be involved in CCM2-binding
(Zawistowski et al., 2005
).
These results suggest that CCM2 can bind to additional motifs in CCM1.
However, mutagenesis of the other two NPxF/Y motifs in CCM1 (indicated in
Fig. 2A) revealed that they
were not strong sites of CCM2 interaction
(Zawistowski et al., 2005
). In
addition, the murine CCM2 homolog (OSM, for osmosensing scaffold for MEKK3)
serves as a scaffold protein for MEKK3-mediated p38 MAPK phosphorylation
during osmotic shock, interacting directly with Rac1, MEKK3 and MKK3
(Uhlik et al., 2003
). This
complex also includes CCM1 (San), as demonstrated by co-immunoprecipitation
(Zawistowski et al.,
2005
).
The results of our co-morpholino experiments also implicate Heg as another
member of this complex interactome. The heg gene has been shown to be
an endocardial signal required for the concentric thickening of the
myocardium. Loss of function of this gene in zebrafish generates a phenotype
indistinguishable from san and vtn
(Mably et al., 2003
). We have
demonstrated that knockdown of combinations of the three zebrafish genes show
synergistic effects, strengthening the contention that the genes disrupted in
human CCM function through a common molecular pathway.
The phenotype of the san and vtn mutant embryonic heart,
like heg, most closely resembles that of the heart in cloche
(clo) mutant zebrafish, which lack endocardium and other endothelium
(Liao et al., 1997
;
Parker and Stainier, 1999
;
Stainier et al., 1996
). Based
on the expression pattern of the san and vtn genes, it is
difficult to conclude which of the two cell types in the hearts is primarily
affected, although the expression of san and vtn in the
vasculature and heg in the endocardium
(Mably et al., 2003
), together
with the similarity to the clo phenotype, suggest a role for
endocardial cells in growth of the adjacent myocardium. The dilated cardiac
chambers of the san and vtn mutants exhibit a severe
thinning and dilation that is also reminiscent of the dilated capillary walls
observed in PDGF-B-deficient mice, which exhibit impaired recruitment of
pericytes because of the loss of PDGF-B signaling
(Lindahl et al., 1997
). It is
postulated that one of the roles of the pericytes is to contribute to the
mechanical stability of the capillary wall, and in their absence
microaneurysms develop. Analogous to these lesions, the enlarged cardiac
chambers of the san and vtn mutants reflects an inability of
the endocardial cell layer to instruct the adjacent layer of myocardial muscle
to thicken.
During the initial stages of embryonic development, the endocardium may
help maintain the structural integrity of the heart by serving as a framework
for the surrounding myocardium. Furthermore, although the number of
endocardial cells in the two mutants is similar to wild type, a small
population of cells may be recruited to the endocardium from other sites, such
as the intermediate cell mass (ICM), where vtn is expressed, and
these cells may migrate through the vasculature to contribute to the
maturation of the endocardium. Indeed, the endocardium has been proposed to be
the site of hematopoiesis before onset of definitive hematopoiesis in the
kidney at 4-5 dpf seeded by cells from the blood islands within the ICM
(Al-Adhami and Kunz, 1977
). The
expression of both san and vtn in the vein may represent
this migrating population of cells that are essential to maturation of the
endocardium and, indirectly, the adjacent myocardium through the supply of
growth signals.
The human homologs of the zebrafish san (CCM1) and vtn
(CCM2) genes are disrupted in cerebral cavernous malformations, a disorder
characterized by the formation of enlarged and thin-walled vascular
malformations in the CNS (Gil-Nagel et
al., 1995
; Zabramski et al.,
1999
). The mechanism by which disruptions in these genes produce
these characteristic venous lesions is undefined. However, a similar process
to that proposed to explain the zebrafish defects might lay at the basis of
these vascular anomalies as well as the defect in the mouse CCM1
(san) knockout, which reveals an essential role for this gene in
vascular development (Whitehead et al.,
2004
).
This work reveals the molecular basis for a mechanism of cardiac growth distinct from those that control cell proliferation. This process determines the direction of growth and is essential for the thickening of the ventricular wall. Formation of the myocardium is contingent on the presence of an intact endocardium and requires reciprocal signaling between the two cell types, facilitated through a genetic module consisting of san, vtn and heg.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/16/3139/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: The Novartis Institutes for Biomedical Research,
Cambridge, MA 02139, USA
Present address: Case Western Reserve University, 11119 Bellflower Road,
150 PBL, Cleveland, OH 44106-7235, USA ![]()
Present address: Department of Molecular, Cell and Developmental Biology,
University of California Los Angeles, Life Sciences Building, Rm 5109, 621
Charles E. Young Drive South, Los Angeles, CA 90095, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Al-Adhami, M. A. and Kunz, Y. W. (1977).
Ontogenesis of haematopoietic sites in brachydanio rerio (hamilton-buchanan)
(teleostei). Dev. Growth Differ.
19,171
-179.[CrossRef]
Bretscher, A., Edwards, K. and Fehon, R. G.
(2002). ERM proteins and merlin: integrators at the cell cortex.
Nat. Rev. Mol. Cell Biol.
3, 586-599.[CrossRef][Medline]
Burge, C. B. and Karlin, S. (1998). Finding the
genes in genomic DNA. Curr. Opin. Struct. Biol.
8, 346-354.[CrossRef][Medline]
Calderwood, D. A., Fujioka, Y., de Pereda, J. M.,
Garcia-Alvarez, B., Nakamoto, T., Margolis, B., McGlade, C. J., Liddington, R.
C. and Ginsberg, M. H. (2003). Integrin beta cytoplasmic
domain interactions with phosphotyrosine-binding domains: a structural
prototype for diversity in integrin signaling. Proc. Natl. Acad.
Sci. USA 100,2272
-2277.
Chang, D. D., Wong, C., Smith, H. and Liu, J.
(1997). ICAP-1, a novel beta1 integrin cytoplasmic
domain-associated protein, binds to a conserved and functionally important
NPXY sequence motif of beta1 integrin. J. Cell Biol.
138,1149
-1157.
Chen, J. N., Haffter, P., Odenthal, J., Vogelsang, E., Brand,
M., van Eeden, F. J., Furutani-Seiki, M., Granato, M., Hammerschmidt, M.,
Heisenberg, C. P. et al. (1996). Mutations affecting the
cardiovascular system and other internal organs in zebrafish.
Development 123,293
-302.[Abstract]
Copenhaver, W. (1939). Some observations on the
growth and function of heteroplastic heart grafts. J. Exp.
Zool. 82,239
-271.[CrossRef]
Denier, C., Goutagny, S., Labauge, P., Krivosic, V., Arnoult,
M., Cousin, A., Benabid, A. L., Comoy, J., Frerebeau, P., Gilbert, B. et
al. (2004). Mutations within the MGC4607 gene cause cerebral
cavernous malformations. Am. J. Hum. Genet.
74,326
-337.[CrossRef][Medline]
Draper, B. W., Morcos, P. A. and Kimmel, C. B.
(2001). Inhibition of zebrafish fgf8 pre-mRNA splicing with
morpholino oligos: a quantifiable method for gene knockdown.
Genesis 30,154
-156.[CrossRef][Medline]
Driever, W., Solnica-Krezel, L., Schier, A. F., Neuhauss, S. C.,
Malicki, J., Stemple, D. L., Stainier, D. Y., Zwartkruis, F., Abdelilah, S.,
Rangini, Z. et al. (1996). A genetic screen for mutations
affecting embryogenesis in zebrafish. Development
123, 37-46.[Abstract]
Ekker, S. C. (2000). Morphants: a new
systematic vertebrate functional genomics approach.
Yeast 17,302
-306.[CrossRef][Medline]
Ewing, B. and Green, P. (1998). Base-calling of
automated sequencer traces using phred. II. Error probabilities.
Genome Res. 8,186
-194.
Ewing, B., Hillier, L., Wendl, M. C. and Green, P.
(1998). Base-calling of automated sequencer traces using phred.
I. Accuracy assessment. Genome Res.
8, 175-185.
Gessner, I. H. (1966). Spectrum of congenital
cardiac anomalies produced in chick embryos by mechanical interference with
cardiogenesis. Circ. Res.
18,625
-633.
Gil-Nagel, A., Wilcox, K. J., Stewart, J. M., Anderson, V. E.,
Leppik, I. E. and Rich, S. S. (1995). Familial cerebral
cavernous angioma: clinical analysis of a family and phenotypic
classification. Epilepsy Res.
21, 27-36.[CrossRef][Medline]
Gordon, D., Abajian, C. and Green, P. (1998).
Consed: a graphical tool for sequence finishing. Genome
Res. 8,195
-202.
Gould, S. J. (1966). Allometry and size in
ontogeny and phylogeny. Biol. Rev. Camb. Philos. Soc.
41,587
-640.[Medline]
Hu, N., Sedmera, D., Yost, H. J. and Clark, E. B.
(2000). Structure and function of the developing zebrafish heart.
Anat. Rec. 260,148
-157.[CrossRef][Medline]
Jowett, T. and Lettice, L. (1994). Whole-mount
in situ hybridizations on zebrafish embryos using a mixture of digoxigenin-
and fluorescein-labelled probes. Trends Genet.
10, 73-74.[CrossRef][Medline]
Knapik, E. W., Goodman, A., Atkinson, O. S., Roberts, C. T.,
Shiozawa, M., Sim, C. U., Weksler-Zangen, S., Trolliet, M. R., Futrell, C.,
Innes, B. A. et al. (1996). A reference cross DNA panel for
zebrafish (Danio rerio) anchored with simple sequence length polymorphisms.
Development 123,451
-460.[Abstract]
Laberge-le Couteulx, S., Jung, H. H., Labauge, P., Houtteville,
J. P., Lescoat, C., Cecillon, M., Marechal, E., Joutel, A., Bach, J. F. and
Tournier-Lasserve, E. (1999). Truncating mutations in CCM1,
encoding KRIT1, cause hereditary cavernous angiomas. Nat.
Genet. 23,189
-193.[CrossRef][Medline]
Liao, W., Bisgrove, B. W., Sawyer, H., Hug, B., Bell, B.,
Peters, K., Grunwald, D. J. and Stainier, D. Y. (1997). The
zebrafish gene cloche acts upstream of a flk-1 homologue to regulate
endothelial cell differentiation. Development
124,381
-389.[Abstract]
Lindahl, P., Johansson, B. R., Leveen, P. and Betsholtz, C.
(1997). Pericyte loss and microaneurysm formation in
PDGF-B-deficient mice. Science
277,242
-245.
Mably, J. D., Mohideen, M.-A. P. K. Burns, C. G., Chen, J.-N.
and Fishman, M. C. (2003). heart of glass regulates
the concentric growth of the heart in zebrafish. Curr.
Biol. 13,2138
-2147.[CrossRef][Medline]
Michelmore, R. W., Paran, I. and Kesseli, R. V.
(1991). Identification of markers linked to disease-resistance
genes by bulked segregant analysis: a rapid method to detect markers in
specific genomic regions by using segregating populations. Proc.
Natl. Acad. Sci. USA 88,9828
-9832.
Milan, D. J., Giokas, A. C., Serluca, F. C., Peterson, R. T. and
Macrae, C. A. (2006). Notch1b and neuregulin are required for
specification of central cardiac conduction tissue.
Development 133,1125
-1132.
Mosavi, L. K., Cammett, T. J., Desrosiers, D. C. and Peng, Z.
Y. (2004). The ankyrin repeat as molecular architecture for
protein recognition. Protein Sci.
13,1435
-1448.[CrossRef][Medline]
Parker, L. and Stainier, D. Y. (1999).
Cell-autonomous and non-autonomous requirements for the zebrafish gene cloche
in hematopoiesis. Development
126,2643
-2651.[Abstract]
Roman, B. L., Pham, V. N., Lawson, N. D., Kulik, M., Childs, S.,
Lekven, A. C., Garrity, D. M., Moon, R. T., Fishman, M. C., Lechleider, R. J.
et al. (2002). Disruption of acvrl1 increases endothelial
cell number in zebrafish cranial vessels. Development
129,3009
-3019.
Rottbauer, W., Baker, K., Wo, Z. G., Mohideen, M. A., Cantiello,
H. F. and Fishman, M. C. (2001). Growth and function of the
embryonic heart depend upon the cardiac-specific L-type calcium channel alpha1
subunit. Dev. Cell 1,265
-275.[CrossRef][Medline]
Rottbauer, W., Saurin, A. J., Lickert, H., Shen, X., Burns, C.
G., Wo, Z. G., Kemler, R., Kingston, R., Wu, C. and Fishman, M.
(2002). Reptin and pontin antagonistically regulate heart growth
in zebrafish embryos. Cell
111,661
-672.[CrossRef][Medline]
Sahoo, T., Johnson, E. W., Thomas, J. W., Kuehl, P. M., Jones,
T. L., Dokken, C. G., Touchman, J. W., Gallione, C. J., Lee-Lin, S. Q.,
Kosofsky, B. et al. (1999). Mutations in the gene encoding
KRIT1, a Krev-1/rap1a binding protein, cause cerebral cavernous malformations
(CCM1). Hum. Mol. Genet.
8,2325
-2333.
Shu, X., Cheng, K., Patel, N., Chen, F., Joseph, E., Tsai, H. J.
and Chen, J. N. (2003). Na,K-ATPase is essential for
embryonic heart development in the zebrafish.
Development 130,6165
-6173.
Stainier, D. Y. and Fishman, M. C. (1992).
Patterning the zebrafish heart tube: acquisition of anteroposterior polarity.
Dev. Biol. 153,91
-101.[CrossRef][Medline]
Stainier, D. Y., Fouquet, B., Chen, J. N., Warren, K. S.,
Weinstein, B. M., Meiler, S. E., Mohideen, M. A., Neuhauss, S. C.,
Solnica-Krezel, L., Schier, A. F. et al. (1996). Mutations
affecting the formation and function of the cardiovascular system in the
zebrafish embryo. Development
123,285
-292.[Abstract]
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal
cells to a neural fate. Genes Dev.
8,1434
-1447.
Uhlik, M. T., Abell, A. N., Johnson, N. L., Sun, W., Cuevas, B.
D., Lobel-Rice, K. E., Horne, E. A., Dell'Acqua, M. L. and Johnson, G. L.
(2003). Rac-MEKK3-MKK3 scaffolding for p38 MAPK activation during
hyperosmotic shock. Nat. Cell Biol.
5,1104
-1110.[CrossRef][Medline]
Whitehead, K. J., Plummer, N. W., Adams, J. A., Marchuk, D. A.
and Li, D. Y. (2004). Ccm1 is required for arterial
morphogenesis: implications for the etiology of human cavernous malformations.
Development 131,1437
-1448.
Yelon, D., Horne, S. A. and Stainier, D. Y.
(1999). Restricted expression of cardiac myosin genes reveals
regulated aspects of heart tube assembly in zebrafish. Dev.
Biol. 214,23
-37.[CrossRef][Medline]
Zabramski, J. M., Henn, J. S. and Coons, S.
(1999). Pathology of cerebral vascular malformations.
Neurosurg. Clin. N. Am.
10,395
-410.[Medline]
Zawistowski, J. S., Serebriiskii, I. G., Lee, M. F., Golemis, E.
A. and Marchuk, D. A. (2002). KRIT1 association with the
integrin-binding protein ICAP-1: a new direction in the elucidation of
cerebral cavernous malformations (CCM1) pathogenesis. Hum. Mol.
Genet. 11,389
-396.
Zawistowski, J. S., Stalheim, L., Uhlik, M. T., Abell, A. N.,
Ancrile, B. B., Johnson, G. L. and Marchuk, D. A. (2005).
CCM1 and CCM2 protein interactions in cell signaling: implications for
cerebral cavernous malformations pathogenesis. Hum Mol
Genet. 14,2521
-2531.
Zhang, J., Clatterbuck, R. E., Rigamonti, D., Chang, D. D. and
Dietz, H. C. (2001). Interaction between krit1 and icap1alpha
infers perturbation of integrin beta1-mediated angiogenesis in the
pathogenesis of cerebral cavernous malformation. Hum. Mol.
Genet. 10,2953
-2960.
Zhang, X. A. and Hemler, M. E. (1999).
Interaction of the integrin beta1 cytoplasmic domain with ICAP-1 protein.
J. Biol. Chem. 274,11
-19.
This article has been cited by other articles:
![]() |
D. Mariappan, R. Niemann, M. Gajewski, J. Winkler, S. Chen, S. Choorapoikayil, M. Bitzer, H. Schulz, J. Hescheler, and A. Sachinidis Somitovasculin, a Novel Endothelial-Specific Transcript Involved in the Vasculature Development Arterioscler Thromb Vasc Biol, November 1, 2009; 29(11): 1823 - 1829. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Milan, A. M. Kim, J. R. Winterfield, I. L. Jones, A. Pfeufer, S. Sanna, D. E. Arking, A. H. Amsterdam, K. M. Sabeh, J. D. Mably, et al. Drug-Sensitized Zebrafish Screen Identifies Multiple Genes, Including GINS3, as Regulators of Myocardial Repolarization Circulation, August 18, 2009; 120(7): 553 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, G. Tanriover, H. Yano, R. Friedlander, A. Louvi, and M. Gunel Apoptotic Functions of PDCD10/CCM3, the Gene Mutated in Cerebral Cavernous Malformation 3 Stroke, April 1, 2009; 40(4): 1474 - 1481. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Akers, E. Johnson, G. K. Steinberg, J. M. Zabramski, and D. A. Marchuk Biallelic somatic and germline mutations in cerebral cavernous malformations (CCMs): evidence for a two-hit mechanism of CCM pathogenesis Hum. Mol. Genet., March 1, 2009; 18(5): 919 - 930. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Boulday, A. Blecon, N. Petit, F. Chareyre, L. A. Garcia, M. Niwa-Kawakita, M. Giovannini, and E. Tournier-Lasserve Tissue-specific conditional CCM2 knockout mice establish the essential role of endothelial CCM2 in angiogenesis: implications for human cerebral cavernous malformations Dis. Model. Mech., March 1, 2009; 2(3-4): 168 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Dahme, H. A. Katus, and W. Rottbauer Fishing for the genetic basis of cardiovascular disease Dis. Model. Mech., January 1, 2009; 2(1-2): 18 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Gore, M. G. Lampugnani, L. Dye, E. Dejana, and B. M. Weinstein Combinatorial interaction between CCM pathway genes precipitates hemorrhagic stroke Dis. Model. Mech., November 1, 2008; 1(4-5): 275 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Hogan, J. Bussmann, H. Wolburg, and S. Schulte-Merker ccm1 cell autonomously regulates endothelial cellular morphogenesis and vascular tubulogenesis in zebrafish Hum. Mol. Genet., August 15, 2008; 17(16): 2424 - 2432. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Buchner, F. Su, J. S. Yamaoka, M. Kamei, J. A. Shavit, L. K. Barthel, B. McGee, J. D. Amigo, S. Kim, A. W. Hanosh, et al. From the Cover: pak2a mutations cause cerebral hemorrhage in redhead zebrafish PNAS, August 28, 2007; 104(35): 13996 - 14001. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||