DEV02490 Supplementary Material

Files in this Data Supplement:

• Supplemental Table - Adobe PDF

• Supplemental Figure 1 -

  Fig. S1. RT-PCR of rme-2 and mex-5. Primers corresponding to exon 1 and 2 were used for both rme-2 and mex-5 (rme-2 forward primer, 5′ tactaatcaaaacacagctca 3′; rme-2 reverse primer, 5′ tccactccgacacttattgtctt 3′; mex-5 forward primer, 5′acgatcaacaatgcagtacta 3′; mex-5 reverse primer, 5′ gctccataacacgatgatatc 3′). Reactions were carried out using Qiagen onestep RT-PCR kit. Each gene was amplified for 23 cycles along with hexokinase as loading control. The intensity ratio (red) was calculated after normalization to the hexokinase control within each lane. The wild-type ratio was set at 1.0 and each mutant ratio is relative to wild type.

• Supplemental Figure 2 -

  Fig. S2. LIN-3 staining in wild-type and lin-15 mutant background. Both wild-type and lin-15 gonads show clear LIN-3 localization (red) on oocyte surface (A,C). LIN-3 staining is essentially absent when only secondary antibody was used (B) or in lin-3(RNAi) animals (C). DAPI staining is in blue. RNAi was performed in the lin-15 background in order to have a control for effectiveness of lin-3(RNAi). If lin-3 expression is reduced, the SynMuv phenotype of lin-15 mutants is suppressed. We were therefore able to examine specifically animals that were non-Muv for LIN-3 staining.

• Supplemental Figure 3 -

  Fig. S3. PIE-1:GFP mislocalization in T22F3.3(RNAi) embryos. Representative embryos showing PIE-1 localization (green), with number and percentage embryos demonstrating mis-localization listed. (A) Mock-treated embryo showing correct PIE-1 localization; (B) mex-5(RNAi) embryo, with probable cross-RNAi affecting mex-6 expression, showing ectopic PIE-1; (C) T22F3.3(RNAi) embryo.