|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 19 July 2006
doi: 10.1242/dev.02481
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




,

1 Department of Plant Developmental and Molecular Biology, Geb. 26.03.02,
University of Düsseldorf, D-40225 Düsseldorf, Germany.
2 Max Planck Institute for Plant Breeding, Carl-von-Linné Weg 10, D-50829
Cologne, Germany.

Author for correspondence (e-mail:
hoeckeru{at}uni-koln.de)
Accepted 7 June 2006
| SUMMARY |
|---|
|
|
|---|
Key words: SPA1, Photomorphogenesis, Flowering time, Photoperiodism, CONSTANS, Arabidopsis
| INTRODUCTION |
|---|
|
|
|---|
Members of the four-member SPA protein family contain a COP1-like WD-repeat
domain, a coiled-coil domain and a kinase-like domain
(Hoecker et al., 1999
;
Laubinger and Hoecker, 2003
).
They function redundantly in suppression of photomorphogenesis in darkness.
Thus, strong constitutive photomorphogenesis is observed only when all four
SPA genes are defective (Laubinger et al.,
2004
). spa1, spa3 and spa4 single mutant
seedlings, by contrast, show normal development in darkness, while
photomorphogenesis in the light is enhanced in a fashion that was fully
dependent on a functional phytochrome A (PHYA) gene
(Hoecker et al., 1998
;
Laubinger and Hoecker, 2003
;
Fittinghoff et al., 2006
). SPA
proteins are also important for normal adult growth because spa
quadruple mutants exhibit extreme dwarfism
(Laubinger et al., 2004
).
Further genetic analyses indicated that the individual SPA genes have
overlapping but distinct functions during plant development. Whereas
SPA3 and SPA4 predominate in the regulation of adult growth,
SPA1 and SPA2 are the primary players in suppression of
photomorphogenesis in dark-grown seedlings
(Laubinger et al., 2004
).
Differences in SPA gene expression patterns appear to contribute to the
divergence in SPA1-SPA4 function
(Fittinghoff et al., 2006
).
All SPA proteins interact with COP1 in vitro, and an in vivo interaction
was observed between SPA1 and COP1. Because spa and cop1
mutations also interact genetically it is hypothesized that SPA proteins
function in concert with COP1 to ubiquitinate activators of the light response
(Hoecker and Quail, 2001
;
Laubinger et al., 2004
;
Saijo et al., 2003
). In
agreement with this idea, HY5 and HFR1 protein levels are increased in
spa1 mutant seedlings (Saijo et
al., 2003
; Yang et al.,
2005a
). Moreover, recombinant SPA1 altered the in vitro ubiquitin
ligase activity of COP1 (Saijo et al.,
2003
; Seo et al.,
2003
).
Light also controls the transition from vegetative to reproductive
development. Many plant species use day length (photoperiod) to adjust
flowering time to the changing seasons
(Putterill et al., 2004
). As a
facultative long-day plant, Arabidopsis flowers much earlier in long
days (LD) than in short days (SD). A key component in LD-triggered flowering
is the putative transcription factor CONSTANS (CO), which contains a
B-Box-type Zn-finger and a conserved CCT domain
(Koornneef et al., 1991
;
Putterill et al., 1995
). CO
promotes flowering by upregulating the expression of the genes FLOWERING
LOCUS T (FT) and SUPPRESSOR OF CONSTANS 1
(SOC1), which then in turn induce floral transition
(Abe et al., 2005
;
Hayama and Coupland, 2004
;
Samach et al., 2000
;
Searle and Coupland, 2004
;
Searle et al., 2006
;
Wigge et al., 2005
;
Yoo et al., 2005
). FT
and SOC1 are also responsive to other cues, such as extended cold
treatment in vernalization-requiring accessions, as well as developmental age
(autonomous pathway), indicating that FT and SOC1 integrate
several flowering-time pathways (Putterill
et al., 2004
). It appears, however, that FT expression is
primarily regulated by photoperiod, whereas the expression of SOC1 is
more strongly regulated by the vernalization/autonomous pathway than by the
photoperiod pathway (Kardailsky et al.,
1999
; Kobayashi et al.,
1999
; Lee et al.,
2000
; Samach et al.,
2000
; Wigge et al.,
2005
).
The expression of CO is regulated by the circadian clock, with
CO transcript levels rising around 12 hours after dawn. Therefore,
high levels of CO transcript occur at the end of daytime in LD but
during night time in SD (Suarez-Lopez et
al., 2001
). The `coincidence model' thus proposes that LD can
trigger flowering because the expression of CO coincides with the
exposure of plants to light (Roden et al.,
2002
; Suarez-Lopez et al.,
2001
; Yanovsky and Kay,
2002
). Recent results provided molecular support for this
hypothesis by showing that CO is also regulated at the post-transcriptional
level: CO protein is stabilized by light, while in darkness it is rapidly
degraded in the proteasome (Valverde et
al., 2004
). The combination of circadian regulation of CO
transcript levels and light-induced stabilization of the CO protein ensures
that the CO protein accumulates exclusively under inductive LD conditions. CO
protein accumulation in the light is dependent on the light quality because CO
accumulates in FR and B, but not in R
(Valverde et al., 2004
). This
correlates well with the knowledge that the FR-perceiving photoreceptor phyA
and the B-responsive cryptochrome 2 (cry2) promote flowering in LD, while the
R-photoreceptor phytochrome B (phyB) inhibits flowering
(Hayama and Coupland, 2004
;
Searle and Coupland,
2004
).
Besides the photoreceptors, light signaling intermediates also affect
photoperiodic flowering. cop1 mutants show no delay in flowering
under SD conditions, indicating that COP1 is required for the suppression of
flowering in non-inductive SD (McNellis et
al., 1994
). When grown in the presence of sucrose, cop1
mutants flowered even in complete darkness, while wild-type plants never
bolted under these conditions (Nakagawa
and Komeda, 2004
). The molecular nature of COP1 function in the
control of flowering time, however, is unknown. Because SPA proteins function
in concert with COP1, and, moreover, suppress seedling light responses in
darkness, we were interested in examining the roles of SPA genes in the light
regulation of flowering time using genetic and molecular approaches.
| MATERIALS AND METHODS |
|---|
|
|
|---|
To generate the spa1-7 co-SAIL double mutant, a segregating F2 population was grown in FR and short, i.e. spa1-7 mutant, seedlings were selected and transferred to LD conditions. Plants that flowered late were confirmed to be homozygous spa1-7 co mutant using PCR-based markers that can distinguish between the respective mutant and wild-type alleles.
Analysis of flowering time
To determine the flowering time, seeds were sown directly onto soil and
plants were grown in a randomized fashion in either SD (8 hours light/16 hours
darkness) or LD (16 hours light/8 hours darkness) at 21°C. The light
source were fluorescent tubes (80 µmol m-2 s-1).
Experiments that included the phyA-101 and the spa1-2
phyA-101 mutants were conducted in either SD (8 hours fluorescent
light/16 hours darkness) or SD+extension (8 hours fluorescent light/8 hours
incandescent light/8 hours darkness) at 21°C. Light was provided by
fluorescent white-light tubes (200 µmol m-2 s-1) and
incandescent 60W bulbs. Flowering time was scored by determining the number of
rosette leaves when the first inflorescence was seen by eye.
Analysis of transcript levels
Total RNA was isolated from the green parts of soil-grown plants using the
RNA Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's
instructions. One µg of RNA was treated with RNase-free DNase I (MBI
Fermentas, St Leon-Rot, Germany), according to the manufacturer's instruction
and subsequently reverse transcribed using an oligo-dT primer and RevertAid H
Minus M-MuLV Reverse Transcriptase (MBI Fermentas, St Leon-Rot, Germany).
cDNAs were diluted to 100 µl with water and 2 µl of diluted cDNA was
used for PCR-amplification of CO, FT, SOC1, FLC, SPA1, SPA2, SPA3,
SPA4 and UBQ10 fragments using gene-specific primers. The
UBQ10 fragment was used as a control to normalize for the amount of
cDNA used. CO, FT, UBQ10 and SOC1 and FLC primers
were described previously (Blazquez and
Weigel, 1999
; Mockler et al.,
2004
). A SPA1 fragment was amplified using
5'TGGTCATGAGAAAGCGGTGA3' and 5'CCTCCAACAGACGCTCGAC3';
SPA2 was amplified using 5'GCAGTTAGCTATGCGAAGTTC3' and
5'GCAAACGCTTGAAACGAACAGG3'; SPA3 was amplified using
5'GAGAAAGGAGTCTACAATAAGTTG3' and
5'CTCATTGATGGTCGACAAGTTGGCTCA3'; and SPA4 was amplified
using 5'TGAAGAAGATAATGGTTCTCTGTG3' and
5'CTCATCGATGGTCGACAGCTA3'. For all cDNAs, the exponential range of
amplification was determined experimentally. Then, 25 (for CO), 28
(FT), 20 (SOC1), 20 (FLC), 20 (SPA1), 20
(SPA2), 22 (SPA3), 24 (SPA4) and 17
(UBQ10) cycles were used in all experiments. PCR reactions with each
cDNA and primer pair were carried out three times simultaneously. The three
PCR products were pooled, separated on an agarose gel, transferred to a Nylon
membrane and hybridized with a radioactively labeled gene-specific probe.
Hybridization signals were quantified by phosphorimager analysis.
In vitro binding assays
Constructs expressing GAD-SPA1, GAD-SPA2, GAD-SPA3 or GAD-SPA4 have been
described previously (Hoecker and Quail,
2001
; Laubinger et al.,
2004
; Laubinger and Hoecker,
2003
). All constructs for expression of CO (without His-tag) were
generated by PCR-amplifying the full open-readingframe (ORF) of CO or
parts of the ORF of CO using primers with restriction sites and
subsequent ligation of the digested PCR products into the
NcoI-BamHI restriction sites of the vector pET15b (Novagen).
CO expresses the full-length CO protein (373 amino acids), CO
VP3 the
amino acids 1-364, CO-CCT the amino acids 272-373 and CO
B-Box the amino
acids 107-373. To express His6-CO protein, the ORF of CO
was inserted into the vector pDEST17 (Invitrogen) by Gateway recombination
cloning. His6-CO
CCT expresses amino acids 1-331 of CO,
COmVP1-3 expresses a full-length CO protein in which three VP motifs (amino
acids 214-215, 265-266 and 370-371) were changed to two alanine residues by
site-directed mutagenesis (Quickchange kit, Stratagene, La Jolla, USA).
All proteins were synthesized using the TnT reticulocyte coupled
transcription and translation system (Promega) in the presence of
35S-labelled methionine. Prey proteins were fully labeled with
35S-methionine, while bait proteins were synthesized in the
presence of a mixture of labeled and unlabelled methionine in order to
facilitate protein detection after SDS-PAGE. Protein synthesis and
co-immunoprecipitations were conducted as described previously
(Hoecker and Quail, 2001
).
Briefly, 10 µl each of bait and prey TnT reactions were added to 200 µl
of binding buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM dithiotreitol
(DTT), 0.1% Tween 20) and incubated on a rotary platform for 1-2 hours at
4°C. Co-immunoprecipitation were conducted by subsequently adding 0.4
µg of
-GAD antibody (Santa Cruz Biotechnology) and 8 µl of
protein A-coated magnetic beads (Dynal, Oslo, Norway). Precipitates were
washed four times with 1 ml of binding buffer (without DTT). Pellet and
supernatant fractions were resolved by SDS-PAGE and visualized using a
phosphorimager (Fuji).
Confocal microscopy, SPA1-CO colocalization and FRET analysis
To express CFP-SPA1 and YFP-CO in plants, the open-reading-frames of SPA1
or CO, respectively, were amplified by PCR and cloned into the GATEWAY vectors
pENSG-CFP or pENSG-YFP by recombination cloning. In these vectors, CFP-SPA1
and YFP-CO are expressed from the constitutive 35S-promoter.
Laser-scanning confocal microscopy was performed using a Leica TCS SP2 system (Leica Microsystems, Heidelberg, Germany). YFP was excited with the 514 nm line and CFP was excited with the 405 nm line of a diode laser of an argon laser 20%. Images were taken with an objective HC PL APO CS 20.0x0.70 UV. Fluorescence was detected in case of YFP between 525-590 nm and in case of CFP between 454-503 nm.
For SPA1-CO co-localization studies and FRET acceptor photobleaching, Arabidopsis leaf epidermal cells of 3-week-old, LD-grown plants were co-transfected ballistically with two plasmid constructs, respectively, encoding CFP-SPA1, YFP-CO, CFP or YFP, and analyzed 24 hours after bombardment. Cells exhibiting co-expression of both fluorescent proteins were bleached in the acceptor YFP channel by scanning an ROI (region of interest) with 100% laser intensity. FRET efficiency was calculated directly by the TCS software using the following formula: FRETEff=(Dpost-Dpre)/Dpost for all Dpost>Dpre.
CO protein detection
Nuclear extracts were prepared from 12-day-old, LD-grown (16 hour light/8
hour dark) plants at zeitgeber (ZT) 16 as described previously
(Valverde et al., 2004
).
Nuclear proteins were separated by SDS-PAGE using 10% bis-Tris NuPAGE
ready-cast gels (Invitrogen), transferred to a nitrocellulose membrane and
probed with an anti-CO antibody followed by an horseradish
peroxidase-conjugated secondary antibody. Immunoreactive proteins were
visualized by ECL (Pierce). The membrane was subsequently reprobed with an
antibody against histone H3a (Abcam) to control for unequal loading.
| RESULTS |
|---|
|
|
|---|
|
|
Early flowering in SD-grown spa1 mutants is independent of phyA
It has been shown previously that mutations in individual SPA genes
(spa1, spa3 or spa4) cause enhanced seedling responsiveness
to light only when a wild-type PHYA gene is present
(Fittinghoff et al., 2006
;
Hoecker et al., 1998
;
Laubinger and Hoecker, 2003
).
We therefore investigated whether early flowering of SD-grown spa1
mutants is also phyA dependent. Table
2 shows that spa1 phyA mutant plants flowered much
earlier than phyA mutant plants, indicating that a spa1
mutation causes early flowering in SD even in the absence of a functional
PHYA gene. This is consistent with the finding that phyA
mutations do not alter flowering time under SD conditions
(Reed et al., 1994
). To
further assess a possible function of phyA, we grew plants under daily cycles
of 8 hours fluorescent light + 8 hours incandescent light + 8 hours darkness.
The FR-rich incandescent light causes phyA-dependent photoperiodic flowering
(Johnson et al., 1994
). Also
under this light regime, spa1 phyA mutant plants flowered earlier
than the phyA mutant.
|
Taken together, these results show that SPA1 predominates in the control of flowering, SPA3 and SPA4 contribute somewhat, and SPA2 plays only a minor role - if any - in this response. Indeed, SPA1 was not only necessary but also sufficient for normal flowering in SD as the spa2 spa3 spa4 triple mutant retained normal photoperiodic control of flowering under the conditions used (Table 1, Fig. 1B).
spa mutations cause an increase in FT transcript levels without a change in CO mRNA levels
Photoperiodic flowering requires the coincidence between expression of the
flowering time gene CO and exposure of plants to light (`coincidence
model') (Roden et al., 2002
;
Suarez-Lopez et al., 2001
;
Yanovsky and Kay, 2002
). To
test whether spa mutants flower early in SD because of a change in
the CO expression pattern, we examined CO transcript levels
in wild-type and spa mutants over a 24 hour period. spa
mutations did not cause any dramatic changes in CO transcript levels
(Fig. 2A,B). Wild-type,
spa1 mutant, spa1 spa3 spa4 and spa2 spa3 spa4
mutants showed very similar diurnal regulation of CO mRNA levels in
SD-grown plants. This result is thus not consistent with the hypothesis that
spa mutants flower early in SD as a result of a change in the level
or pattern of CO expression.
We subsequently investigated whether signaling downstream of CO is
altered in spa mutants. CO induces the expression of the flowering
time genes FT and SOC1
(Samach et al., 2000
;
Searle et al., 2006
;
Yoo et al., 2005
). A
comparative analysis of FT transcript levels in SD-grown wild-type
and spa1-7 mutant plants shows that the spa1-7 mutation
caused an
70-fold increase in FT mRNA abundance relative to the
wild type (ZT 16 and ZT 20) (Fig.
2A,C). A similarly strong increase in FT transcript
levels was observed in spa1-3 mutant plants when compared with RLD
wild-type plants (data not shown). In the very early flowering spa1 spa3
spa4 triple mutant, FT mRNA levels were even more drastically
elevated (
1000-fold higher than in the wild type). The normal-flowering
spa2 spa3 spa4 triple mutant which has a functional SPA1
gene, by contrast, did not show increased FT transcript levels
(Fig. 2A,C). Thus, the
flowering time of SD-grown spa1 and spa1 spa3 spa4 mutants
correlated well with the amount of FT mRNA produced.
FT transcript levels in spa mutants were strongly
elevated only during the night phase and not during day time
(Fig. 2A,C). Hence, it is
evident that FT expression in spa mutants followed the
expression of CO and thus might be dependent on CO. Moreover, the
pattern of FT mRNA abundance observed in SD-grown, early flowering
spa mutants was very similar to that described for LD-grown wild-type
plants (Suarez-Lopez et al.,
2001
).
CO also activates the expression of SOC1, a transcription factor
containing a MADS-box domain (Hepworth et
al., 2002
; Samach et al.,
2000
; Searle et al.,
2006
; Yoo et al.,
2005
). However, we found that SOC1 transcript levels were
not altered in spa1-7 mutants
(Fig. 2A,D) or in
spa1-3 mutants (data not shown) when compared with the respective
wild type. Thus, spa1 mutants did not flower early in SD as a result
of a change in SOC1 transcript abundance. In both triple mutants
examined, the early-flowering spa1 spa3 spa4 mutant and the
normal-flowering spa2 spa3 spa4 mutant, SOC1 levels were
somewhat higher than in the wild type (at the most five-fold). Because this
slight rise did not correlate with the flowering time of these mutants, it is
unlikely that the spa1 spa3 spa4 mutant flowered early due to
increased SOC1 expression.
Flowering time is also regulated by the repressor FLOWERING LOCUS C (FLC),
which suppresses the expression of FT and SOC1 in a pathway
unrelated to photoperiodic flowering
(Hepworth et al., 2002
;
Lee et al., 2000
). We
investigated whether the elevated FT transcript levels observed in
the spa1 and spa1 spa3 spa4 mutants might be caused by a
reduction in FLC levels. Fig.
2A,E shows that the spa1-7 mutation did not alter
FLC transcript abundance, although both examined triple mutants
exhibited even a slight increase in FLC mRNA levels. This increase,
like the slight elevation in SOC1 transcript levels, did not
correlate with the flowering time of SD-grown spa mutants, and,
moreover, according to the present knowledge on FLC function, should lead to
an inhibition of flowering. Hence, taken together, the transcript analyses
demonstrate that solely the dramatic increase in FT transcript levels
in spa mutants relative to the wild type correlated well with the
early flowering phenotype of spa mutants. This suggests that
spa mutations de-repress flowering in SD due to an inappropriate
induction of FT expression.
|
Early flowering of spa1 mutants in SD is dependent on CO
Our finding that spa1 mutations affect photoperiodic flowering by
inducing FT expression without altering the transcript levels of the
FT-regulator CO suggests that SPA1 may regulate CO
post-transcriptionally or, alternatively, may repress FT
independently of CO. To distinguish between these two possibilities,
we examined the epistatic relationship between spa1 and co
in SD-grown plants. The early-flowering phenotype of spa1 mutants was
completely suppressed by the co mutation
(Fig. 4A,B). In agreement with
this finding, FT transcript levels were not increased in spa1
co double mutants (Fig.
4C,D). This demonstrates that precocious flowering of SD-grown
spa1 mutants is fully dependent on CO. In addition, the
inappropriate induction of FT observed in spa1 mutants
requires CO. We therefore conclude that SPA1 function is CO
dependent.
|
|
B-Box)
reduced the SPA1-binding activity of CO, but did not abolish it. This shows
that the Zn fingers of CO are not essential for the interaction of CO with
SPA1. C-terminal truncation of CO including part of the CCT domain
(CO
CCT) abolished SPA1 binding (Fig.
6A-C), indicating that the CCT domain of CO is required for the
interaction with SPA1. To determine whether the CCT domain is also sufficient
for SPA1 binding, we tested a CO deletion-derivative containing only the CCT
domain and the last nine amino acids of CO (CO-CCT). However, this protein was
not capable of interacting with SPA1, suggesting that additional domains of CO
are necessary for SPA1 binding.
CO contains `VP motifs', which show some similarity to a COP1-binding motif
detected in the transcription factors STH, STO and HY5. In HY5, this motif was
also crucial for HY5 protein degradation
(Holm et al., 2001
). Because
SPA1 and COP1 are related proteins, we considered these VP motifs of CO
potential binding sites for SPA1. A deletion-derivative of CO that carries
missense mutations (VP to AA) in three VP-motifs of CO (COmVP1-3) bound SPA1
as efficiently as the wild-type CO protein
(Fig. 6A-C). In addition, a
truncated CO protein lacking the last nine amino acids, including one VP-motif
(CO
VP3), retained significant SPA1-binding activity. Thus, these VP
motifs of CO were not essential for in vitro binding of CO to SPA1. However,
we cannot exclude the possibility that our in vitro assay does not fully
reflect the in vivo interaction between SPA1 and CO. In addition, these VP
motifs may be of functional importance without affecting the SPA1-CO
interaction per se.
CO protein levels are increased in spa1 spa3 spa4 mutants
Our finding that SPA proteins interact with CO suggests that SPA proteins
control CO protein function. Because SPA proteins control seedling
photomorphogenesis by co-acting with the E3 ubiquitin ligase COP1, we
considered the possibility that SPA proteins control CO protein degradation.
We therefore examined CO protein levels in wild-type and spa mutant
plants. CO is a protein of very low abundance and usually undetectable in
nuclear extracts of wild-type plants
(Valverde et al., 2004
)
(Fig. 7). In LD-grown spa1
spa3 spa4 triple mutants, by contrast, CO protein accumulated to
detectable levels. CO transcript levels were similar in wild-type and
spa triple mutant plants, indicating that the observed increase in CO
protein levels in spa mutants was not caused by changes in
CO gene expression or CO transcript stability. Hence, the
elevated CO protein abundance in spa mutants is most probably caused
by a reduction in CO protein degradation. Consistent with this conclusion, the
CO protein was previously shown to be subject to degradation via the 26S
proteasome (Valverde et al.,
2004
).
In agreement with the elevated CO protein levels in spa triple mutants, these mutants flowered earlier than wild-type plants under these LD conditions (Table 1). However, although CO protein levels in spa triple mutants were at least as high as in a 35S-CO overexpressing line, these spa triple mutants flowered later than 35S-CO plants (data not shown). This implies that SPA proteins might also, directly or indirectly, be involved in regulating the activity of the CO protein.
| DISCUSSION |
|---|
|
|
|---|
|
Although there is some functional redundancy among the four SPA genes, SPA1 is clearly the predominant player in the regulation of flowering time. Only spa1 mutants, but not spa2, spa3 and spa4 single mutants showed a defect in flowering time. Moreover, we found that SPA1 is sufficient for normal photoperiodic flowering as triple mutants with defects in all SPA genes but SPA1 flowered normally.
|
1000-fold
higher FT mRNA abundance when compared with the wild type. This is
consistent with previous findings showing that high-level FT
expression in transgenic 35S::FT or 35S::CO plants led to early flowering even
under non-inductive SD conditions (Samach
et al., 2000
The transcript levels of the flowering time gene SOC1, by
contrast, were not dramatically altered in early-flowering spa mutant
plants. This is in agreement with previous findings showing that SOC1
seems to be more strongly regulated by the autonomous/vernalization pathway
than by the photoperiod pathway. SOC1 mRNA levels are only slightly
reduced in the day length-insensitive co and gi mutant
plants, while they are strongly affected by mutations in the
vernalization/autonomous pathway (Lee et
al., 2000
; Samach et al.,
2000
). Conversely, FT transcript levels are very strongly
dependent on CO (Kardailsky et
al., 1999
; Kobayashi et al.,
1999
; Samach et al.,
2000
; Wigge et al.,
2005
). However, SOC1 transcript levels are increased by
overexpression of FT, suggesting that SOC1 expression is
activated by FT (Michaels et al.,
2005
; Moon et al.,
2005
; Yoo et al.,
2005
). In addition, SOC1 expression in the shoot apical
meristem is delayed in ft mutants
(Searle et al., 2006
). Spatial
and quantitative relationships between FT and SOC1
expression are not well understood. Hence, FT-induction in the
SD-grown spa mutants might be too low to activate SOC1.
Alternatively, SOC1-induction by FT might occur at developmental
stages or in specific tissues that are not reflected under our experimental
conditions.
SPA1 interacts with CO to prevent CO-mediated induction of FT in SD
Our epistasis analysis demonstrates that SPA1 acts upstream of a key
regulator of photoperiodic flowering, the putative transcription factor CO.
Early flowering as well as the increase in FT transcript abundance
was fully abolished in spa1 co double mutants. We can envision at
least two not mutually exclusive possibilities on how SPA1 might control CO
function: SPA1 might regulate the expression of CO. A change in the
expression pattern of CO is known to alter photoperiodic flowering,
as, for example, in the late-flowering mutants fkf1 and gi,
or the early-flowering mutant toc1
(Imaizumi et al., 2005
;
Imaizumi et al., 2003
;
Suarez-Lopez et al., 2001
;
Yanovsky and Kay, 2002
).
Alternatively, SPA1 might regulate the stability and/or activity of the CO
protein. Our results do not support the first model. The mutants spa1
and spa1 spa3 spa4 showed no difference in CO transcript
abundance throughout a 24-hour time period (SD), when compared with the wild
type, indicating that early flowering of these mutants was not caused by a
change in the level or pattern of CO expression. We, therefore, favor
the model that SPA1 regulates the CO protein. Indeed, we found that SPA1 and
CO physically interact in vitro and in vivo. Thus, the mechanism of
SPA1-mediated repression of FT in SD probably involves direct binding
of SPA1 to CO.
|
It is thus far unknown how SPA proteins regulate CO protein stability. CO
was recently reported to be degraded under SD conditions
(Valverde et al., 2004
). In
SD, CO transcripts accumulate primarily during the night phase, i.e.
in darkness, and, therefore, synthesized CO protein is thought to be rapidly
degraded by the proteasome (Valverde et
al., 2004
). Hence, we speculate that SPA proteins might be
directly involved in this dark-dependent degradation of CO. This is consistent
with previous evidence showing that SPA proteins function to suppress light
signaling in darkness (Laubinger et al.,
2004
). In addition, our observation that SPA transcript levels
rise during the night phase, i.e. when CO is degraded, supports this idea.
Thus far, we could not investigate regulation and dynamics of SPA1-mediated CO
degradation because CO is of too low abundance in SD-grown plants. However,
our finding that CO protein abundance is higher in light-grown spa
mutant plants when compared with the wild type indicates that CO is also
degraded in the light and, thus, that light does not fully inhibit degradation
of CO.
We also considered an alternative possibility that SPA proteins function in
the light to inhibit the phyA-dependent stabilization of CO
(Valverde et al., 2004
). This
mechanism is conceivable because mutations in SPA1, SPA3 or
SPA4 cause a hyper-responsiveness of seedlings to light in a fashion
that is fully dependent on a functional PHYA gene
(Hoecker et al., 1998
;
Laubinger and Hoecker, 2003
;
Fittinghoff et al., 2006
). This
indicates that SPA proteins are especially important for normal phyA signaling
in light-grown seedlings. However, our findings that early flowering of
spa1 mutants is independent of phyA and specific to SD are
inconsistent with this model.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Institut Jean-Pierre Bourgin, Laboratoire de Biologie des
Semences, INRA, 78026 Versailles Cedex, France ![]()
Present address: Department of Plant Biology, Carnegie Institution of
Washington, 260 Panama Street, Stanford, CA 94305, USA ![]()
Present address: Max Planck Institute for Plant Breeding,
Carl-von-Linné Weg 10, D-50829 Cologne, Germany ![]()
¶ Present address: Department of Biochemistry and Molecular Biology, Hermann
Herder Strasse 7, University of Freiburg, D-79104 Freiburg, Germany ![]()
** Present address: Institut für Biologie/Angewandte Genetik, Free
University of Berlin, Albrecht-Thaer-Weg 6, D-14195 Berlin, Germany ![]()

Present address: Institute of Botany, University of Cologne, D-50931
Cologne, Germany ![]()
| REFERENCES |
|---|
|
|
|---|
Abe, M., Kobayashi, Y., Yamamoto, S., Daimon, Y., Yamaguchi, A.,
Ikeda, Y., Ichinoki, H., Notaguchi, M., Goto, K. and Araki, T.
(2005). FD, a bZIP protein mediating signals from the floral
pathway integrator FT at the shoot apex. Science
309,1052
-1056.
Blazquez, M. A. and Weigel, D. (1999).
Independent regulation of flowering by phytochrome B and gibberellins in
Arabidopsis. Plant Physiol.
120,1025
-1032.
Briggs, W. R. and Spudich, J. L. (ed.) (2005).Handbook of photosensory receptors . Weinheim: Wiley.
Chen, M., Chory, J. and Fankhauser, C. (2004). Light signal transduction in higher plants. Annu. Rev. Genet. 38,87 -117.[CrossRef][Medline]
Dehesh, K., Franci, C., Parks, B. M., Seeley, K. A., Short, T.
W., Tepperman, J. M. and Quail, P. H. (1993). Arabidopsis
HY8 locus encodes phytochrome A. Plant Cell
5,1081
-1088.
Duek, P. D., Elmer, M. V., van Oosten, V. R. and Fankhauser, C. (2004). The degradation of HFR1, a putative bHLH class transcription factor involved in light signaling, is regulated by phosphorylation and requires COP1. Curr. Biol. 14,2296 -2301.[CrossRef][Medline]
Fittinghoff, K., Laubinger, S., Nixdorf, M., Fackendahl, P., Baumgardt, R. L., Batschauer, A. and Hoecker, U. (2006). Functional and expression analysis of Arabidopsis SPA genes during seedling development and adult growth. Plant J. (in press).
Harmer, S. L., Hogenesch, J. B., Straume, M., Chang, H. S., Han,
B., Zhu, T., Wang, X., Kreps, J. A. and Kay, S. A. (2000).
Orchestrated transcription of key pathways in Arabidopsis by the circadian
clock. Science 290,2110
-2113.
Hayama, R. and Coupland, G. (2004). The
molecular basis of diversity in the photoperiodic flowering responses of
Arabidopsis and rice. Plant Physiol.
135,677
-684.
Hepworth, S. R., Valverde, F., Ravenscroft, D., Mouradov, A. and Coupland, G. (2002). Antagonistic regulation of flowering-time gene SOC1 by CONSTANS and FLC via separate promoter motifs. EMBO J. 21,4327 -4337.[CrossRef][Medline]
Hoecker, U. and Quail, P. H. (2001). The
phytochrome A-specific signaling intermediate SPA1 interacts directly with
COP1, a constitutive repressor of light signaling in Arabidopsis.
J. Biol. Chem. 276,38173
-38178.
Hoecker, U., Xu, Y. and Quail, P. H. (1998).
SPA1: a new genetic locus involved in phytochrome A-specific signal
transduction. Plant Cell
10, 19-33.
Hoecker, U., Tepperman, J. M. and Quail, P. H.
(1999). SPA1, a WD-repeat protein specific to phytochrome A
signal transduction. Science
284,496
-499.
Holm, M., Hardtke, C. S., Gaudet, R. and Deng, X. W. (2001). Identification of a structural motif that confers specific interaction with the WD40 repeat domain of Arabidopsis COP1. EMBO J. 20,118 -127.[CrossRef][Medline]
Imaizumi, T., Tran, H. G., Swartz, T. E., Briggs, W. R. and Kay, S. A. (2003). FKF1 is essential for photoperiodic-specific light signalling in Arabidopsis. Nature 426,302 -306.[CrossRef][Medline]
Imaizumi, T., Schultz, T. F., Harmon, F. G., Ho, L. A. and Kay,
S. A. (2005). FKF1 F-box protein mediates cyclic degradation
of a repressor of CONSTANS in Arabidopsis. Science
309,293
-297.
Jang, I. C., Yang, J. Y., Seo, H. S. and Chua, N. H.
(2005). HFR1 is targeted by COP1 E3 ligase for post-translational
proteolysis during phytochrome A signaling. Genes Dev.
19,593
-602.
Johnson, E., Bradley, M., Harberd, N. P. and Whitelam, G. C. (1994). Photoresponses of light-grown phyA mutants of Arabidopsis. Phytochrome A is required for the perception of daylength extensions. Plant Physiol. 105,141 -149.[Abstract]
Kardailsky, I., Shukla, V. K., Ahn, J. H., Dagenais, N.,
Christensen, S. K., Nguyen, J. T., Chory, J., Harrison, M. J. and Weigel,
D. (1999). Activation tagging of the floral inducer FT.
Science 286,1962
-1965.
Kobayashi, Y., Kaya, H., Goto, K., Iwabuchi, M. and Araki,
T. (1999). A pair of related genes with antagonistic roles in
mediating flowering signals. Science
286,1960
-1962.
Koornneef, M., Hanhart, C. J. and van der Veen, J. H. (1991). A genetic and physiological analysis of late flowering mutants in Arabidopsis thaliana. Mol. Gen. Genet. 229, 57-66.[Medline]
Laubinger, S. and Hoecker, U. (2003). The SPA1-like proteins SPA3 and SPA4 repress photomorphogenesis in the light. Plant J. 35,373 -385.[CrossRef][Medline]
Laubinger, S., Fittinghoff, K. and Hoecker, U.
(2004). The SPA quartet: a family of WD-repeat proteins with a
central role in suppression of photomorphogenesis in arabidopsis.
Plant Cell 16,2293
-2306.
Lee, H., Suh, S. S., Park, E., Cho, E., Ahn, J. H., Kim, S. G.,
Lee, J. S., Kwon, Y. M. and Lee, I. (2000). The AGAMOUS-LIKE
20 MADS domain protein integrates floral inductive pathways in Arabidopsis.
Genes Dev. 14,2366
-2376.
McNellis, T. W., Von Arnim, A. G., Araki, T., Komeda, Y., Miséra, S. and Deng, X.-W. (1994). Genetic and molecular analysis of an allelic series of cop1 mutants suggests functional roles for the multiple protein domains. Plant Cell 6,487 -500.[Abstract]
Michaels, S. D., Himelblau, E., Kim, S. Y., Schomburg, F. M. and
Amasino, R. M. (2005). Integration of flowering signals in
winter-annual Arabidopsis. Plant Physiol.
137,149
-156.
Mockler, T. C., Yu, X., Shalitin, D., Parikh, D., Michael, T.
P., Liou, J., Huang, J., Smith, Z., Alonso, J. M., Ecker, J. R. et al.
(2004). Regulation of flowering time in Arabidopsis by K homology
domain proteins. Proc. Natl. Acad. Sci. USA
101,12759
-12764.
Moon, J., Lee, H., Kim, M. and Lee, I. (2005).
Analysis of flowering pathway integrators in Arabidopsis. Plant
Cell Physiol. 46,292
-299.
Nakagawa, M. and Komeda, Y. (2004). Flowering
of Arabidopsis cop1 mutants in darkness. Plant Cell
Physiol. 45,398
-406.
Osterlund, M. T., Ang, L. H. and Deng, X. W. (1999). The role of COP1 in repression of Arabidopsis photomorphogenic development. Trends Cell Biol. 9, 113-118.[CrossRef][Medline]
Osterlund, M. T., Hardtke, C. S., Wei, N. and Deng, X. W. (2000). Targeted destabilization of HY5 during light-regulated development of Arabidopsis. Nature 405,462 -466.[CrossRef][Medline]
Putterill, J., Robson, F., Lee, K., Simon, R. and Coupland, G. (1995). The CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors. Cell 80,847 -857.[CrossRef][Medline]
Putterill, J., Laurie, R. and Macknight, R. (2004). It's time to flower: the genetic control of flowering time. BioEssays 26,363 -373.[CrossRef][Medline]
Reed, J. W., Nagatani, A., Elich, T. D., Fagan, M. and Chory, J. (1994). Phytochrome A and phytochrome B have overlapping but distinct functions in Arabidopsis development. Plant Physiol. 104,1139 -1149.[Abstract]
Roden, L. C., Song, H. R., Jackson, S., Morris, K. and Carre, I.
A. (2002). Floral responses to photoperiod are correlated
with the timing of rhythmic expression relative to dawn and dusk in
Arabidopsis. Proc. Natl. Acad. Sci. USA
99,13313
-13318.
Saijo, Y., Sullivan, J. A., Wang, H., Yang, J., Shen, Y., Rubio,
V., Ma, L., Hoecker, U. and Deng, X. W. (2003). The COP1-SPA1
interaction defines a critical step in phytochrome A-mediated regulation of
HY5 activity. Genes Dev.
17,2642
-2647.
Samach, A., Onouchi, H., Gold, S. E., Ditta, G. S.,
Schwarz-Sommer, Z., Yanofsky, M. F. and Coupland, G. (2000).
Distinct roles of CONSTANS target genes in reproductive development of
Arabidopsis. Science
288,1613
-1616.
Searle, I. and Coupland, G. (2004). Induction of flowering by seasonal changes in photoperiod. EMBO J. 23,1217 -1222.[CrossRef][Medline]
Searle, I., He, Y., Turck, F., Vincent, C., Fornara, F., Krober,
S., Amasino, R. A. and Coupland, G. (2006). The transcription
factor FLC confers a flowering response to vernalization by repressing
meristem competence and systemic signaling in Arabidopsis. Genes
Dev. 20,898
-912.
Seo, H. S., Yang, J. Y., Ishikawa, M., Bolle, C., Ballesteros, M. L. and Chua, N. H. (2003). LAF1 ubiquitination by COP1 controls photomorphogenesis and is stimulated by SPA1. Nature 424,995 -999.[Medline]
Sessions, A., Burke, E., Presting, G., Aux, G., McElver, J.,
Patton, D., Dietrich, B., Ho, P., Bacwaden, J., Ko, C. et al.
(2002). A high-throughput Arabidopsis reverse genetics system.
Plant Cell 14,2985
-2994.
Suarez-Lopez, P., Wheatley, K., Robson, F., Onouchi, H., Valverde, F. and Coupland, G. (2001). CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature 410,1116 -1120.[CrossRef][Medline]
Valverde, F., Mouradov, A., Soppe, W., Ravenscroft, D., Samach,
A. and Coupland, G. (2004). Photoreceptor regulation of
CONSTANS protein in photoperiodic flowering. Science
303,1003
-1006.
Wigge, P. A., Kim, M. C., Jaeger, K. E., Busch, W., Schmid, M.,
Lohmann, J. U. and Weigel, D. (2005). Integration of spatial
and temporal information during floral induction in Arabidopsis.
Science 309,1056
-1059.
Yang, J., Lin, R., Hoecker, U., Liu, B., Xu, L. and Wang, H. (2005a). Repression of light signaling by Arabidopsis SPA1 involves post-translational regulation of HFR1 protein accumulation. Plant J. 43,131 -141.[CrossRef][Medline]
Yang, J., Lin, R., Sullivan, J., Hoecker, U., Liu, B., Xu, L.,
Deng, X. W. and Wang, H. (2005b). Light regulates
COP1-mediated degradation of HFR1, a transcription factor essential for light
signaling in Arabidopsis. Plant Cell
17,804
-821.
Yanovsky, M. J. and Kay, S. A. (2002). Molecular basis of seasonal time measurement in Arabidopsis. Nature 419,308 -312.[CrossRef][Medline]
Yoo, S. K., Chung, K. S., Kim, J., Lee, J. H., Hong, S. M., Yoo,
S. J., Yoo, S. Y., Lee, J. S. and Ahn, J. H. (2005). CONSTANS
activates SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 through FLOWERING LOCUS T
to promote flowering in Arabidopsis. Plant Physiol.
139,770
-778.
Related articles in Development:
This article has been cited by other articles:
![]() |
U. Lagercrantz At the end of the day: a common molecular mechanism for photoperiod responses in plants? J. Exp. Bot., July 1, 2009; 60(9): 2501 - 2515. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-R. Song, J.-D. Song, J.-N. Cho, R. M. Amasino, B. Noh, and Y.-S. Noh The RNA Binding Protein ELF9 Directly Reduces SUPPRESSOR OF OVEREXPRESSION OF CO1 Transcript Levels in Arabidopsis, Possibly via Nonsense-Mediated mRNA Decay PLANT CELL, April 1, 2009; 21(4): 1195 - 1211. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pouteau, I. Carre, V. Gaudin, V. Ferret, D. Lefebvre, and M. Wilson Diversification of Photoperiodic Response Patterns in a Collection of Early-Flowering Mutants of Arabidopsis Plant Physiology, November 1, 2008; 148(3): 1465 - 1473. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. King, T. Hisamatsu, E. E. Goldschmidt, and C. Blundell The nature of floral signals in Arabidopsis. I. Photosynthesis and a far-red photoresponse independently regulate flowering by increasing expression of FLOWERING LOCUS T (FT) J. Exp. Bot., October 3, 2008; (2008) ern231v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Wu, Y. Wang, and S.-H. Wu Two New Clock Proteins, LWD1 and LWD2, Regulate Arabidopsis Photoperiodic Flowering Plant Physiology, October 1, 2008; 148(2): 948 - 959. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zhu, A. Maier, J.-H. Lee, S. Laubinger, Y. Saijo, H. Wang, L.-J. Qu, U. Hoecker, and X. W. Deng Biochemical Characterization of Arabidopsis Complexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development PLANT CELL, September 1, 2008; 20(9): 2307 - 2323. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Vega-Sanchez, L. Zeng, S. Chen, H. Leung, and G.-L. Wang SPIN1, a K Homology Domain Protein Negatively Regulated and Ubiquitinated by the E3 Ubiquitin Ligase SPL11, Is Involved in Flowering Time Control in Rice PLANT CELL, June 1, 2008; 20(6): 1456 - 1469. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ito, Y. Niwa, N. Nakamichi, H. Kawamura, T. Yamashino, and T. Mizuno Insight into Missing Genetic Links Between Two Evening-Expressed Pseudo-Response Regulator Genes TOC1 and PRR5 in the Circadian Clock-Controlled Circuitry in Arabidopsis thaliana Plant Cell Physiol., February 1, 2008; 49(2): 201 - 213. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-J. Liu, Y.-C. Zhang, Q.-H. Li, Y. Sang, J. Mao, H.-L. Lian, L. Wang, and H.-Q. Yang COP1-Mediated Ubiquitination of CONSTANS Is Implicated in Cryptochrome Regulation of Flowering in Arabidopsis PLANT CELL, February 1, 2008; 20(2): 292 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, C. T. Hotta, A. N. Dodd, J. Love, R. Sharrock, Y. W. Lee, Q. Xie, C. H. Johnson, and A. A.R. Webb Distinct Light and Clock Modulation of Cytosolic Free Ca2+ Oscillations and Rhythmic CHLOROPHYLL A/B BINDING PROTEIN2 Promoter Activity in Arabidopsis PLANT CELL, November 1, 2007; 19(11): 3474 - 3490. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kobayashi and D. Weigel Move on up, it's time for change mobile signals controlling photoperiod-dependent flowering Genes & Dev., October 1, 2007; 21(19): 2371 - 2384. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hayama, B. Agashe, E. Luley, R. King, and G. Coupland A Circadian Rhythm Set by Dusk Determines the Expression of FT Homologs and the Short-Day Photoperiodic Flowering Response in Pharbitis PLANT CELL, October 1, 2007; 19(10): 2988 - 3000. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Datta, C. Hettiarachchi, H. Johansson, and M. Holm SALT TOLERANCE HOMOLOG2, a B-Box Protein in Arabidopsis That Activates Transcription and Positively Regulates Light-Mediated Development PLANT CELL, October 1, 2007; 19(10): 3242 - 3255. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Izawa Adaptation of flowering-time by natural and artificial selection in Arabidopsis and rice J. Exp. Bot., September 1, 2007; 58(12): 3091 - 3097. [Abstract] [Full Text] [PDF] |
||||
![]() |
Flowering Newsletter bibliography for 2006 J. Exp. Bot., April 20, 2007; (2007) erm028v2. [Full Text] [PDF] |
||||
![]() |
S. Richardt, D. Lang, R. Reski, W. Frank, and S. A. Rensing PlanTAPDB, a Phylogeny-Based Resource of Plant Transcription-Associated Proteins Plant Physiology, April 1, 2007; 143(4): 1452 - 1466. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Endo, N. Mochizuki, T. Suzuki, and A. Nagatani CRYPTOCHROME2 in Vascular Bundles Regulates Flowering in Arabidopsis PLANT CELL, January 1, 2007; 19(1): 84 - 93. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||