DEV02499 Supplementary Material

Files in this Data Supplement:

• Supplemental Table - Adobe PDF

• Supplemental Figure 1 -

  Fig. S1. Generation of Flk1^+/CreSmad4^{floxed/floxed} mice. (A) The mating scheme used to generate Smad4 mutant and control littermates. One quarter of the resulting embryos will be Flk1^+/CreSmad4^{floxed/floxed}. (B) (upper) Genomic DNA was extracted from a piece of embryo tail. A 390 bp fragment from wild-type Smad4 allele and a 450 bp fragment from floxed Smad4 allele can be PCR amplified with gray primers (sense, 5′-GGGCAGCGTAGCATATAAGA-3′; antisense, 5′-GACCCAAACGTCACCTTCAG-3′). A 500 bp fragment should appear with black primers (sense 5′-AAGAGCCACAGGGTCAAGCAG-3′; antisense 5′- GACCCAAACGTCACCTTCAG -3′) if Cre-mediated recombination occurs. The presence of the knock-in Cre gene was confirmed by a 540 bp fragment using sense 5′-GAAACCGAGCTGCGTCCAGATTT-3′; antisense 5′-GGTGTACGGTCAGTAAATTGG-3′. (B) (lower) A representative tail genomic DNA PCR results. Lane 1, Smad4^{floxed/floxed}; lane 2, Flk-1^+/CreSmad4^{floxed/floxed}; lane 3, Smad4^+/floxed; lane 4, Flk-1^+/CreSmad4^+/floxed; lane 5, Smad4^+/floxed; lane 6, Smad4^+/floxed; lane 7, H₂O; lane 8, size marker DNA. (C) Genomic PCR on hematopoietic colonies grown from E9.5 Smad4 CKO yolk sac replating. Lane 1, Flk1^+/CreSmad4^+/floxed; lane 2, Flk1^+/CreSmad4^+/floxed; lane 3, Flk-1^+/CreSmad4^{floxed/floxed}; lane 4, Flk-1^+/CreSmad4^{floxed/floxed}; lane 5, Smad4^{floxed/floxed}; lane 6, Smad4^+/floxed; lane 7, Smad4^+/floxed (tail DNA); lane 8, Flk-1^+/CreSmad4^{floxed/floxed} (tail DNA); lane 9, H₂O.

• Supplemental Figure 2 -

  Fig. S2. E13.5 fetal liver of Fgfr1/2 CKO were dissociated and plated into methylcellulose cultures with hematopoietic cytokines. Four to seven days later, colonies were counted and plotted. Data obtained from one wild-type (wt) and one mutant (mt) fetal liver are shown on the left. Each bar represents the average number of colonies. Error bars indicate standard deviation from triplicate plating. Total hematopoietic colonies obtained from three wild-type and two mutant embryos are shown on the right. BFU-E, burst forming unit-erythrocytes; Mac, macrophage; G/M, granulocyte/macrophage.