|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 August 2006
doi: 10.1242/dev.02521
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Biology, University of Pennsylvania, Philadelphia, PA 19104-6018, USA.
* Author for correspondence (e-mail: spoethig{at}sas.upenn.edu)
Accepted 6 July 2006
| SUMMARY |
|---|
|
|
|---|
Key words: miRNA, Heterochrony, Phase change
| INTRODUCTION |
|---|
|
|
|---|
To identify genes directly involved in vegetative phase change, we used
microarray analysis to search for genes whose mRNA is elevated in zip-1,
rdr6-11 and sgs3-11
(Peragine et al., 2004
). These
mutations have identical phenotypes, and we reasoned that the genes
responsible for this phenotype would be expressed in a similar way in all
three mutants. Three such genes were identified: ETTIN/ARF3, ARF4 and
SPL3. This paper concerns the regulation and function of
SPL3 and the closely related genes, SPL4 and SPL5.
These genes are members of the SQUAMOSA PROMOTER BINDING PROTEIN LIKE
(SPL) gene family, members of which share a DNA-binding domain (the
SPB domain) first identified in proteins that bind to sequence motif present
in the promoter of the SQUAMOSA gene in Antirrhinum majus
(Cardon et al., 1999
;
Cardon et al., 1997
;
Klein et al., 1996
). Members
of this plant-specific structurally diverse family are found in non-vascular
(Arazi et al., 2005
) and
vascular plants, and are required for such processes as ligule
(Moreno et al., 1997
) and
glume (Wang et al., 2005b
)
development in maize, and leaf (Stone et
al., 2005
) and flower (Klein
et al., 1996
; Unte et al.,
2003
) development in Arabidopsis and
Antirrhinum. Cardon and colleagues
(Cardon et al., 1997
)
originally proposed a role for SPL3 in floral induction based on the
observations that SPL3 mRNA increases during the transition to
flowering in plants grown in long or short days, and that overexpression of
SPL3 produces early flowering. Consistent with this hypothesis,
SPL3 mRNA rapidly increases in plants exposed to a photoinductive
stimulus (Schmid et al.,
2003
). SPL4 and SPL5 are closely related to
SPL3, and have a similar temporal expression pattern
(Cardon et al., 1999
). The
function of these genes is unknown, however, as plants overexpressing
SPL4 and SPL5 have no apparent phenotype
(Cardon et al., 1999
).
SPL genes were among the first miRNA-regulated genes to be identified
in Arabidopsis (Rhoades et al.,
2002
). Ten out of the 16 SPL genes in
Arabidopsis - including SPL3, SPL4 and SPL5 - have
target sites for miR156. All of these genes are specifically
downregulated in plants that constitutively overexpress miR156b
(Schwab et al., 2005
), but
only two of these transcripts have been shown to be cleaved by this miRNA
(Chen et al., 2004
;
Kasschau et al., 2003
).
Here, we show that SPL3, SPL4 and SPL5 have overlapping functions in the regulation of vegetative phase change and floral induction in Arabidopsis and demonstrate that miR156 is responsible for the temporal change in SPL3 expression during vegetative development. We also show that ZIP and RDR6 either directly or indirectly repress the expression of SPL3 during vegetative development, but do not contribute significantly to the temporal expression pattern of this gene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RNA blots
Total RNA was isolated using Trizol (Invitrogen) from shoot apices of
plants grown under short-day conditions (10 hours light:14 hours dark) at
22°C. Whole seedlings (including cotyledons) were used for 8- to
14-day-old seedlings, the cotyledons and leaves 1 and 2 were removed from
plants harvested between 18-21 days after planting (dap), and the cotyledons
and leaves 1-4 were removed from plants harvested between 23-28 dap. The
number of leaves present on the shoot apex was determined by comparison with a
growth curve generated by dissecting shoot apices grown under the same SD
conditions. To measure SPL3 mRNA, 20 µg of total RNA was run on
1.2% agarose gels, transferred to Hybond N+ nylon membranes
(Amersham Pharmacia), and crosslinked under UV light. Hybridizations were
performed at 68°C in PerfectHyb plus buffer (Sigma). The SPL3
probe was PCR amplified using the primers 5 ' ACGAGAGAAGGCGGAAAAGCACAA 3
' and 5 ' CGGGATCCCTAAGTCTCAATGCATTTAT 3 ' from a
SPL3 cDNA clone and was labeled with 32P-dCTP using
Prime-II Random Primer Labeling Kit (Stratagene). Blots were hybridized for 8
hours at 68°C, washed once in 2 'SSC and 0.1% SDS solution for 5
minutes at room temperature, twice in 0.5xSSC and 0.1% SDS for 20
minutes at 68°C, and once in 0.1xSSC and 0.1% SDS for 20 minutes at
68°C, and were scanned with a Storm 860 (Molecular Dynamics). To measure
miR156, 50 µg total RNA was separated on 8 M urea/15% denaturing
polyacrylamide gels and electrically transferred to Hybond N+ nylon
membranes. Blots were hybridized with a miR156-complementary
oligonucleotide labeled with 32P-ATP (New England Biolabs) at
40°C in ULTRAhyb-oligo hybridization buffer (Ambion, Austin, TX). Blots
were washed twice at 40°C in 2xSSC and 0.5% SDS for 30 minutes
before scanning.
5' and 3' RACE
Total RNA was isolated from leaf or floral tissue as described above. 5
'RACE and 3 'RACE were carried out using the FirstChoice RLM-RACE
Kit (Ambion, Austin, TX). For standard 5 ' RACE, 5 µg of total RNA
was ligated to the RNA adapter after treatment with calf intestinal
phosphatase and tobacco acid pyrophosphatase. For 5 'RLM-RACE, RNA was
ligated to the RNA oligo adapter without pre-treatment. cDNA was synthesized
using the 3 'RACE oligo d(T) adapter supplied by the manufacturer.
Nested PCR was carried out using the nested adapter primer, and primers
specific for SPL3, SPL4 and SPL5. RACE products were gel
purified and cloned into pGEM T easy vector (Promega) for sequencing.
Transgenic plants
SPL3 (ORF plus 3 'UTR) and a sequence lacking the 3 '
UTR (SPL3
) were PCR-amplified with pfu TURBO (Stratagene) using
cDNA as template. SPL3m was generated by introducing 7 mutations into
the predicted miR156 binding site using recombinant PCR.
GUS-Plus was amplified from the pCAMBIA1305.1 vector and
fused in frame to the 5 ' end of these genes to generate GUS-tagged
proteins. All of these constructs were cloned downstream of the CaMV 35S
promoter in pEZR-CL. Constructs overexpressing putative miR156
precursors were generated by cloning 0.3-0.8 kb of intergenic genomic sequence
containing the precursor in this vector. Plants were transformed using the
floral dip method (Bechtold et al.,
1993
).
GUS activity assays
Visual (i.e. non-quantitative) analyses of GUS expression were conducted by
staining plants according to the method of Senecoff et al.
(Senecoff et al., 1996
). The
effect of various mutations on the expression of 35S::GUS-SPL3
constructs was determined as follows. T1 seeds from plants treated with
Agrobacterium were grown on 1/2 MS medium supplemented with 50 mg/l
kanamycin to identify transgenic plants. Resistant plants were transferred to
soil in 96-well flats and grown under continuous light at 22°C. Leaves 3
and 4 were harvested when plants had about five fully expanded leaves, and
stored at -80°C for subsequent analysis. Upon flowering, adult rosette or
cauline leaves were visually assayed for GUS activity to identify plants
containing an active transgene. Quantitative GUS assays were carried out on
stored leaves from these plants. Leaves were ground to a fine powder in liquid
nitrogen in a microfuge tube, and suspended in a buffer containing 50 mM
sodium phosphate (pH 7.0), 10 mM ß-mercaptoethanol, 10 mM EDTA, 0.1%
sodium lauryl sarcosine and 0.1% Triton X-100. After centrifugation, 10 µl
of the supernatant was added to preheated GUS assay buffer (2 mM
4-Methylumbelliferyl ß-D-Glucuronide in GUS extraction buffer) at
37°C and incubated for 30 minutes. The reaction was stopped by addition of
900 µl of 0.2 M Na2CO3, and fluorescence was measured
with LS-50B luminescence spectrometer (PerkinElmer) with emission and
excitation filters set at 455 nm and 365 nm, respectively. Total protein was
determined using the Bradford Assay (BioRad).
|
| RESULTS |
|---|
|
|
|---|
950 nucleotide antisense transcripts
(AST), which completely encompass the ST and have an intron located in nearly
the same position as the intron in the ST
(Fig. 1A). Four transcription
start sites and 5 poly(A) sites were identified in these AS transcripts. SPL4 (At1g53160) and SPL5 (At3g15270) encode, respectively, 174 amino acid and 181 amino acid proteins that are 65% identical (76% similar) to the 131 amino acid protein encoded by SPL3. The structure of these genes is also very similar to SPL3 (Fig. 1A). These genes also possess a miR156 target site located within their 3 ' UTR and 5 'RLM-RACE demonstrated that SPL3/4/5 are all cleaved in the middle of this target site (Fig. 1B).
The regulation and function ofSPL3
In order to study the role of miR156 in the regulation of
SPL3, we produced transgenic plants expressing
miR156-sensitive and miR156-resistant forms of this gene
under the regulation of the constitutive CaMV 35S promoter. We chose to use
the 35S promoter rather than the endogenous SPL3 promoter in order to
eliminate effects on SPL3 expression due to transcriptional
cross-regulation. The constructs generated for this experiment express an
SPL3 transcript with a normal 3 ' UTR
(35S::SPL3), a transcript with seven mutations in the
miR156 target site (35S::SPL3m), and a transcript lacking
the 3 ' UTR (35S::SPL3
)
(Fig. 2A). Constructs in which
the GUS Plus sequence was fused in frame to the 5 ' end of
these sequences were also generated in order to evaluate the expression of the
SPL3 protein. Plants expressing GUS-tagged versions of SPL3 resembled plants
expressing untagged proteins, although their phenotype was slightly weaker.
Homozygous stocks containing a single insert were established from transgenic
lines, and these stocks were subjected to Northern analysis to ensure that the
transgene was overexpressed.
GUS expression was absent in the progeny of a cross between transgenic plants carrying 35S::GUS-SPL3 and plants carrying 35S::miR156a (Fig. 2B). Progeny from a cross between 35S::GUS-SPL3m and 35S::miR156a had high levels of GUS activity, and there was no significant difference between the amount of GUS activity in these plants (35,821±2815 pmol 4-MU/minute µg protein) and the progeny of a control cross between 35S::GUS-SPL3m and plants carrying an empty vector (33,599±2109 pmol 4-MU/minute µg protein). These results demonstrate that the SPL3 mRNA is a direct target of miR156 and show that the mutations we introduced in the miR156 target site completely block the activity of this miRNA.
|
), flowered early, had a significantly reduced number
of juvenile, adult and cauline leaves (Fig.
2C-E). The first two leaves of transgenic plants had a shorter
petiole and a more acute leaf base than wild-type leaves
(Fig. 2E); these features are
typical of adult leaves. These results indicate that SPL3 promotes
both vegetative and reproductive phase change and is normally repressed by
miR156.
Plants constitutively expressing the a, b, c, d, e and f isoforms of
miR156 were generated by transforming wild-type plants with
constructs containing 0.3-0.8 kb of intergenic genomic sequence under the
regulation of the 35S promoter (Fig.
3A). All of these transgenic lines had a similar phenotype
(Fig. 3B), and resembled the
35S::156b transgenics described by Schwab et al.
(Schwab et al., 2005
). Thus,
all these loci are capable of producing miR156, although whether they
are all transcribed in vivo is unknown. A detailed phenotypic analysis was
performed on plants overexpressing miR156a. In continuous light,
transgenic plants had a significantly larger number of leaves without abaxial
trichomes (n=24; P<0.01 for all traits)
(Fig. 3C). Furthermore, most of
the leaves produced by these plants had a round lamina, long petiole and were
relatively small in size - all characteristics of juvenile leaves. Transgenic
plants also flowered significantly later than vector controls with many
additional leaves (Fig. 3C). To
determine if downregulation of SPL3 is responsible for this
phenotype, we examined the phenotype of F2 progeny from plants heterozygous
for 35S::miR156a and the miR156-insensitive transgene,
35S::SPL3m. Plants carrying both of these transgenes produced
significantly fewer leaves without abaxial trichomes than plants expressing
35S::miR156a (Fig.
3D). Plants with both transgenes resembled 35S::SPL3m in
producing leaves with short petioles, but the shape of the lamina in double
transgenics was more similar to that of 35S::miR156a than
35S::SPL3m (Fig. 3E).
We conclude that downregulation of SPL3 accounts for the effect of
35S::miR156a on abaxial trichome production, petiole length and
flowering time, but that the effect of this miRNA on lamina shape is mediated
by a different gene or genes. In this respect, SPL3 resembles
Gl15 in maize, which regulates phase-specific patterns of leaf
epidermal differentiation and flowering time, but does not affect leaf shape
(Evans et al., 1994
;
Lauter et al., 2005
;
Moose and Sisco, 1994
).
|
|
, 35S::SPL5 and
35S::SPL5
constructs analogous in structure to the similarly
named SPL3 constructs (Fig.
2A). 35S::SPL4 and 35S::SPL5 reduced the number
of adult leaves (n=50; P<0.01), but had no significant
effect on the number of leaves without abaxial trichomes or on flowering time
(Fig. 4B-D). By contrast,
35S::SPL4
and 35S::SPL5
significantly
accelerated abaxial trichome production and floral induction (n=48;
P<0.01). These results indicate that SPL4 and
SPL5 have the same function as SPL3, and that they are
normally repressed by miR156.
Temporal regulation of SPL3 by miR156
We studied the level of SPL3 and miR156 RNA in plants
grown in short days (SD; 10 hours light: 14 hours dark) in order to
distinguish changes in the expression of these genes associated with
vegetative phase change from those associated with floral induction
(Schmid et al., 2003
). Under
our SD conditions, the first leaf with abaxial trichomes (leaf 8 or 9) is
initiated 15-16 dap and flowering occurs approximately 60 dap, after the shoot
has produced about 45 leaves (Telfer et
al., 1997
; Bollman et al.,
2003
). Thus, changes in gene expression observed during the first
30 days of growth in SD are associated with vegetative phase change, not
floral induction.
The expression of SPL3 and miR156 was determined by
northern analysis of RNA from shoot apices harvested from juvenile (12 dap; 4
leaves), transition (19 dap; 10 leaves) and adult (26 dap; 16 leaves) plants
growing in SD. SPL3 mRNA was nearly undetectable at 12 dap, and was
present in increasing amounts in the 19 and 26 dap samples. A probe
complementary to miR156 detected both 20 and 21 nucleotide miRNAs;
the 20 nucleotide miRNA is derived from one or more of the miR156a-f
loci, whereas the 21 nucleotide miRNA is probably derived from
miR157a-d, which encode a miRNA that is very similar to
miR156 (Reinhart et al.,
2002
; Xie et al.,
2005
). The 21 nucleotide miRNA was expressed uniformly, whereas
the 20 nucleotide miRNA was expressed at a high level at 12 dap and at
uniformly low level thereafter (Fig.
5A). Thus, SPL3 and miR156 are expressed in a
complementary fashion early in vegetative development.
To determine if miR156 contributes to the temporal expression pattern of SPL3, we examined the expression of miR156-sensitive (35S::GUS-SPL3) and miR156-insensitive (35S::GUS-SPL3m) reporter genes under the regulation of the constitutive CaMV 35S promoter. All of the leaves of plants homozygous for 35S::SPL3m had high levels of GUS activity and there was relatively little variation in activity in plants harvested at different times (Fig. 5B,C). By contrast, plants transformed with 35S::GUS-SPL3 expressed GUS only in apical leaves. Lines with strong activity displayed GUS expression earlier in shoot development than did lines with lower activity, and often became completely silenced in subsequent generations. The line illustrated in Fig. 5 displays the pattern of GUS activity characteristic of the most stable lines we obtained. GUS expression in this line was observed starting with leaf 7 or 8 (Fig. 5B), and increased gradually during shoot development (Fig. 5C). Consistent with this expression pattern, miR156 was more abundant at 8 dap than at the later time points (Fig. 5D). These results demonstrate that temporal variation in the expression 35S::GUS-SPL3 is regulated post-transcriptionally by miR156.
ZIP and RDR6 regulate the amplitude of SPL3 expression, but not its temporal expression
SPL3 initially came to our attention because it is one of a
relatively small number of genes that is over-expressed in zip, rdr6
and sgs3 mutants. Two other genes that have this expression pattern,
ETTIN/ARF3 and ARF4, are targets of trans-acting
siRNAs (ta-siRNAs) (Allen et al.,
2005
; Williams et al.,
2005
). ta-siRNAs are produced by a pathway involving SGS3,
RDR6 and DCL4 from transcripts that are cleaved by a miRNA
(Dunoyer et al., 2005
;
Gasciolli et al., 2005
;
Yoshikawa et al., 2005
). The
observation that SPL3 mRNA is elevated in these three mutants
therefore suggests that SPL3 is either directly or indirectly
regulated by this silencing pathway.
|
|
The effect of sgs3-11 and rdr6-11 on the level of
SPL3 mRNA suggests that this gene may be a direct target of RNAi. To
test this hypothesis, we searched for siRNAs derived from SPL3 by
hybridizing blots of low molecular weight from wild-type and mutant plants
with a probe that spans the SPL3 ORF and 3 'UTR, as well as
with oligonucleotide probes to sequences 5 ' and 3 ' of the
miR156 target site. No siRNAs were detected with any of these probes.
Furthermore, a search of the MPSS database
(mpss.udel.edu/at/)
revealed that no small RNAs have been cloned from SPL3. To determine
if SGS3 and RDR6 play a general role in the expression of
genes targeted by miR156, we examined the level of SPL4,
SPL9 and SPL15 mRNA in sgs3-11 and rdr6-11
mutants; SPL9 and SPL15 have a miR156 target site
in their ORF and are downregulated in plants constitutively expressing
miR156b (Schwab et al.,
2005
). SPL4 mRNA was elevated in both mutants, but we
observed little or no change in SPL9 or SPL15
(Fig. 6D). Semi-quantitative
RT-PCR analysis of the expression of the SPL3 antisense transcript in
zip, rdr6-11 and sgs3-11 demonstrated that these mutations
also have no effect on this transcript
(Fig. 6E). These results
suggest that the increase in SPL3 mRNA in sgs3 and
rdr6 is an indirect effect, and does not reflect the involvement of
SGS3 and RDR6 in miR156-initiated transitive
silencing of this gene.
| DISCUSSION |
|---|
|
|
|---|
The function of SPL3, SPL4 and SPL5
SPL3 was originally identified because of its homology to SBP
genes in Antirrhinum and was reported to cause early flowering when
overexpressed (Cardon et al.,
1997
). We confirmed this observation, but found that
overexpression of SPL3 only has a major effect on flowering time if
the miR156 target site in the 3 ' UTR is mutated or deleted.
The results obtained by Cardon et al.
(Cardon et al., 1997
) are
probably attributable to the fact that the construct used in that study had a
truncated miR156 target site. Overexpression of SPL3 also
accelerated two traits characteristic of adult leaves - abaxial trichome
production and short petioles - but had relatively little effect on other leaf
traits. This result demonstrates that SPL3 regulates a subset of
traits associated with the adult phase, but is not entirely responsible for
vegetative phase change. Plants overexpressing miR156-sensitive and
miR156-insensitive versions of the SPL4 and SPL5
mRNAs have essentially the same phenotype as plants expressing the
corresponding SPL3 constructs, indicating that these genes have
similar, if not the same functions as SPL3. Whether SPL4 and
SPL5 have unique functions is still unknown because loss-of-function
mutations in these genes have not yet been identified. Other genes that affect
both vegetative phase change and floral induction include genes involved in
gibberellin biosynthesis/signaling, as well as genes involved in the
autonomous floral induction pathway (Scott
et al., 1999
; Silverstone et
al., 1997
; Telfer et al.,
1997
). It will be important to determine if SPL3/4/5
reside in one or the other of these pathways. The observation that
35S::SPL3m is incapable of rescuing the effect of
35S::miR156a on lamina shape suggests that other targets of this
miRNA also play a role in vegetative phase change.
Temporal regulation of SPL3 by miR156
The level of SPL3 mRNA increases early in vegetative development
(this study), and during the transition to flowering
(Cardon et al., 1999
;
Cardon et al., 1997
;
Schmid et al., 2003
). Because
of our interest in vegetative phase change, we focused on the regulation of
SPL3 early in vegetative development, when the expression of this
gene and miR156 change in a complementary fashion. We found that the
constitutively transcribed miR156-sensitive reporter gene
35S::GUS-SPL3 displayed GUS activity only in apical leaves, whereas
the miR156-insensitive 35S::GUS-SPL3m transgene displayed
constitutive GUS activity. This result is consistent with the capacity of
these transgenes to affect plant morphology, and demonstrates that
SPL3 is repressed post-transcriptionally by miR156 early in
shoot development. Additional support for this conclusion was provided by the
observation that the temporal expression pattern of the endogenous
SPL3 transcript is disrupted by hst-6, a mutation that
strongly reduces the accumulation of miR156. Interestingly, the
amount of miR156 present in young plants appears far in excess of the
amount actually necessary to block SPL3 activity. This conclusion is
supported by the observation that 35S::SPL3 was unable to overcome
the effect of endogenous miR156, and the observation that
hst-6 had relatively little effect on SPL3 mRNA levels early
in shoot development, when hst-6 still has a significant amount of
miR156.
It should be emphasized that our results do not eliminate the possibility
that transcriptional regulation also plays a role in the temporal expression
of SPL3. SPL3/4/5 are transcription factors and may crossregulate
each other's expression, as has been observed in the case of the AP2
family of miR172-regulated transcription factors
(Chen, 2004
;
Schmid et al., 2003
). Indeed,
the dramatic increase in the expression of SPL3/4/5 during the floral
transition is probably regulated at a transcriptional level rather than by
miR156 because miR156 does not decrease markedly during this
transition (G.W. and R.S.P., unpublished).
How is the expression of miR156 regulated early in vegetative
development? miR172 is expressed in a pattern complementary to that
of miR156, increasing with time during shoot development
(Aukerman and Sakai, 2003
).
Furthermore, the phenotype of plants overexpressing miR172 is nearly
the exact opposite of plants overexpressing miR156, and strongly
resembles the phenotype of plants over-expressing SPL3m
(Aukerman and Sakai, 2003
;
Chen, 2004
). The targets of
miR172 include the AP2-like transcription factors, TOE1,
TOE2, SMZ and SNZ in Arabidopsis
(Aukerman and Sakai, 2003
;
Chen, 2004
;
Schmid et al., 2003
), and
Gl15 in maize (Lauter et al.,
2005
). These genes act as floral repressors and, in the case of
Gl15, also promote the expression of juvenile vegetative traits. The
complementary relationship between the expression pattern and functions of
miR172 and miR156 is striking and raises the possibility
that these two miRNAs and their targets act in sequence in the same regulatory
pathway.
The function of RNAi in the regulation of SPL3
Transcripts that contain a miRNA target site are frequently silenced in an
RDR6-dependent fashion when they are expressed as transgenes, and it
has been reported that miRNA-directed cleavage sensitizes transcripts to
transitive silencing (Parizotto et al.,
2004
). Consistent with this report, we found that all of our
constructs with a functional miR156 target site were significantly
more susceptible to silencing than constructs that lacked this site. This made
it difficult to generate reporter lines and to maintain these lines over many
generations. It did not interfere with our ability to identify reliable
reporter lines, however, because transgenes undergoing post-transcriptional
silencing have a different expression pattern than SPL3. Whereas the
expression of SPL3 increases with time, transgenes undergoing
silencing are either permanently silenced very early in shoot development, or
display progressively lower levels of expression during shoot growth
(de Carvalho et al., 1992
;
Glazov et al., 2003
;
Palauqui et al., 1996
;
Vaucheret et al., 2004
).
Although it is clear that transgenes expressing transcripts with miRNA-target
sites are often subject to RNAi, whether this is also true for endogenous
transcripts is less certain. miRNA-directed transitive silencing is well
documented in the case of transcripts that produce trans-acting
siRNAs (Allen et al., 2005
;
Yoshikawa et al., 2005
).
However, most protein-coding transcripts that are cleaved by miRNAs -
including the miR156-regulated transcripts SPL9 and
SPL15 - are not affected by sgs3 or rdr6, and are
therefore unlikely to be targets of RNAi
(Allen et al., 2005
;
Peragine et al., 2004
). The
observation that SPL3 and SPL4 are elevated in these mutants
suggests that these genes either have features that make them unusually
susceptible to RNAi (e.g. the presence of the miR156 target site in
their 3 ' UTR), or that they are regulated indirectly by this mechanism
- for example, by a transcription factor that itself is a target of RNAi. We
have no conclusive evidence for either possibility. However, the observation
that zip-1, rdr6-11 and sgs3-11 have nearly identical
effects on SPL3 expression (Fig.
6A) (Peragine et al.,
2004
) suggests that these genes regulate SPL3 by the same
mechanism. Because ZIP is not generally required for RNAi
(Hunter et al., 2003
) or for
the miR156-dependent suppression of 35S::GUS-SPL3
(Fig. 6C), this observation may
indicate that these genes regulate SPL3 expression indirectly.
A large fraction of the genes in Arabidopsis have antisense
transcripts (Borsani et al.,
2005
; Jen et al.,
2005
; Wang et al.,
2005a
; Yamada et al.,
2003
). In most cases, these transcript pairs represent
neighboring, divergently transcribed protein-coding genes that overlap for a
region of their 3 ' ends. By contrast, the SPL3 antisense
transcript is nearly the same size as the sense transcript, it completely
encompasses the sense transcript and it does have significant coding
potential, suggesting that this transcript is dependent on sequences that are
important for the expression of the sense transcript. Whether this transcript
plays a role in the expression of the sense transcript remains to be
determined.
The results of this and other (Schmid
et al., 2003
; Schwab et al.,
2005
) studies indicate that SPL3 and the related genes,
SPL4 and SPL5, are under complex transcriptional and
post-transcriptional regulation. We are particularly intrigued by these three
genes because they establish a link between miRNAs and vegetative phase change
in Arabidopsis, and reveal that temporal variation in miRNA
expression plays a regulatory role in developmental timing in plants. Further
studies will be necessary to determine the precise mechanism by which
SPL3/4/5 expression is controlled during vegetative and reproductive
phase change, and the regulatory pathways in which these genes operate.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Achard, P., Herr, A., Baulcombe, D. C. and Harberd, N. P.
(2004). Modulation of floral development by a
gibberellin-regulated microRNA. Development
131,3357
-3365.
Allen, E., Xie, Z., Gustafson, A. M. and Carrington, J. C. (2005). microRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell 121,207 -221.[CrossRef][Medline]
Ambros, V. (2000). Control of developmental timing in Caenorhabditis elegans. Curr. Opin. Genet. Dev. 10,428 -433.[CrossRef][Medline]
Arazi, T., Talmor-Neiman, M., Stav, R., Riese, M., Huijser, P. and Baulcombe, D. C. (2005). Cloning and characterization of micro-RNAs from moss. Plant J. 43,837 -848.[CrossRef][Medline]
Aukerman, M. J. and Sakai, H. (2003).
Regulation of flowering time and floral organ identity by a microRNA and its
APETALA2-like target genes. Plant Cell
15,2730
-2741.
Baumberger, N. and Baulcombe, D. C. (2005).
Arabidopsis ARGONAUTE1 is an RNA Slicer that selectively recruits
microRNAs and short interfering RNAs. Proc. Natl. Acad. Sci.
USA 102,11928
-11933.
Baurle, I. and Dean, C. (2006). The timing of developmental transitions in plants. Cell 125,655 -664.[CrossRef][Medline]
Bechtold, N., Ellis, J. and Pelletier, G. (1993). In planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis plants. C. R. Acad. Sci. III Sci. Vie 316,1194 -1199.
Bollman, K. M., Aukerman, M. J., Park, M. Y., Hunter, C.,
Berardini, T. Z. and Poethig, R. S. (2003). HASTY,
the Arabidopsis ortholog of Exportin 5/MSN5, regulates phase change
and morphogenesis. Development
130,1493
-1504.
Borsani, O., Zhu, J., Verslues, P. E., Sunkar, R. and Zhu, J. K. (2005). Endogenous siRNAs derived from a pair of natural cis-antisense transcripts regulate salt tolerance in Arabidopsis.Cell 123,1279 -1291.[CrossRef][Medline]
Cardon, G. H., Hohmann, S., Nettesheim, K., Saedler, H. and Huijser, P. (1997). Functional analysis of the Arabidopsis thaliana SBP-box gene SPL3: a novel gene involved in the floral transition. Plant J. 12,367 -377.[CrossRef][Medline]
Cardon, G., Hohmann, S., Klein, J., Nettesheim, K., Saedler, H. and Huijser, P. (1999). Molecular characterisation of the Arabidopsis SBP-box genes. Gene 237,91 -104.[CrossRef][Medline]
Carrington, J. C. and Ambros, V. (2003). Role
of microRNAs in plant and animal development. Science
301,336
-338.
Chen, J., Li, W. X., Xie, D., Peng, J. R. and Ding, S. W.
(2004). Viral virulence protein suppresses RNA silencing-mediated
defense but upregulates the role of microRNA in host gene expression.
Plant Cell 16,1302
-1313.
Chen, X. (2004). A microRNA as a translational
repressor of APETALA2 in Arabidopsis flower development.
Science 303,2022
-2025.
Clarke, J. H., Tack, D., Findlay, K., Van Montagu, M. and Van Lijsebettens, M. (1999). The SERRATE locus controls the formation of the early juvenile leaves and phase length in Arabidopsis. Plant J. 20,493 -501.[CrossRef][Medline]
de Carvalho, F., Gheysen, G., Kushnir, S., Van Montagu, M., Inze, D. and Castresana, C. (1992). Suppression of beta-1,3-glucanase transgene expression in homozygous plants. EMBO J. 11,2595 -2602.[Medline]
Dunoyer, P., Himber, C. and Voinnet, O. (2005). DICER-LIKE 4 is required for RNA interference and produces the 21-nucleotide small interfering RNA component of the plant cell-to-cell silencing signal. Nat. Genet. 37,1356 -1360.[CrossRef][Medline]
Evans, M. M., Passas, H. J. and Poethig, R. S. (1994). Heterochronic effects of glossy15 mutations on epidermal cell identity in maize. Development 120,1971 -1981.[Abstract]
Gasciolli, V., Mallory, A. C., Bartel, D. P. and Vaucheret, H. (2005). Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs. Curr. Biol. 15,1494 -1500.[CrossRef][Medline]
Glazov, E., Phillips, K., Budziszewski, G. J., Meins, F. and Levin, J. Z. (2003). A gene encoding an RNase D exonuclease-like protein is required for post-transcriptional silencing in Arabidopsis. Plant J. 35,342 -349.[CrossRef][Medline]
Grigg, S. P., Canales, C., Hay, A. and Tsiantis, M. (2005). SERRATE coordinates shoot meristem function and leaf axial patterning in Arabidopsis. Nature 437,1022 -1026.[CrossRef][Medline]
Hunter, C., Sun, H. and Poethig, R. S. (2003). The Arabidopsis heterochronic gene ZIPPY is an Argonaute family member. Curr. Biol. 13,1734 -1739.[CrossRef][Medline]
Jen, C. H., Michalopoulos, I., Westhead, D. R. and Meyer, P. (2005). Natural antisense transcripts with coding capacity in Arabidopsis may have a regulatory role that is not linked to double-stranded RNA degradation. Genome Biol. 6, R51.[CrossRef][Medline]
Kasschau, K. D., Xie, Z., Allen, E., Llave, C., Chapman, E. J., Krizan, K. A. and Carrington, J. C. (2003). P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA function. Dev. Cell 4, 205-217.[CrossRef][Medline]
Kidner, C. A. and Martienssen, R. A. (2005). The developmental role of microRNA in plants. Curr. Opin. Plant Biol. 8,38 -44.[CrossRef][Medline]
Klein, J., Saedler, H. and Huijser, P. (1996). A new family of DNA binding proteins includes putative transcriptional regulators of the Antirrhinum majus floral meristem identity gene SQUAMOSA. Mol. Gen. Genet. 250, 7-16.[Medline]
Lauter, N., Kampani, A., Carlson, S., Goebel, M. and Moose, S.
P. (2005). microRNA172 down-regulates
glossy15 to promote vegetative phase change in maize.
Proc. Natl. Acad. Sci. USA
102,9412
-9417.
Lee, R. C., Feinbaum, R. L. and Ambros, V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14.Cell 75,843 -854.[CrossRef][Medline]
Moose, S. P. and Sisco, P. H. (1994). Glossy15 controls the epidermal juvenile-to-adult phase transition in maize. Plant Cell 6,1343 -1355.[Abstract]
Morel, J. B., Godon, C., Mourrain, P., Beclin, C., Boutet, S.,
Feuerbach, F., Proux, F. and Vaucheret, H. (2002). Fertile
hypomorphic ARGONAUTE (ago1) mutants impaired in
post-transcriptional gene silencing and virus resistance. Plant
Cell 14,629
-639.
Moreno, M. A., Harper, L. C., Krueger, R. W., Dellaporta, S. L.
and Freeling, M. (1997). liguleless1 encodes a
nuclear-localized protein required for induction of ligules and auricles
during maize leaf organogenesis. Genes Dev.
11,616
-628.
Palauqui, J. C., Elmayan, T., De Borne, F. D., Crete, P., Charles, C. and Vaucheret, H. (1996). Frequencies, timing, and spatial patterns of co-suppression of nitrate reductase and nitrite reductase in transgenic tobacco plants. Plant Physiol. 112,1447 -1456.[Abstract]
Parizotto, E. A., Dunoyer, P., Rahm, N., Himber, C. and Voinnet,
O. (2004). In vivo investigation of the transcription,
processing, endonucleolytic activity, and functional relevance of the spatial
distribution of a plant miRNA. Genes Dev.
18,2237
-2242.
Park, M. Y., Wu, G., Gonzalez-Sulser, A., Vaucheret, H. and
Poethig, R. S. (2005). Nuclear processing and export of
microRNAs in Arabidopsis. Proc. Natl. Acad. Sci. USA
102,3691
-3696.
Pasquinelli, A. E. and Ruvkun, G. (2002). Control of developmental timing by microRNAs and their targets. Annu. Rev. Cell Dev. Biol. 18,495 -513.[CrossRef][Medline]
Peragine, A., Yoshikawa, M., Wu, G., Albrecht, H. L. and
Poethig, R. S. (2004). SGS3 and
SGS2/SDE1/RDR6 are required for juvenile development and the
production of trans-acting siRNAs in Arabidopsis. Genes
Dev. 18,2368
-2379.
Poethig, R. S. (1990). Phase change and the
regulation of shoot morphogenesis in plants. Science
250,923
-930.
Qi, Y., Denli, A. M. and Hannon, G. J. (2005). Biochemical specialization within Arabidopsis RNA silencing pathways. Mol. Cell 19,421 -428.[CrossRef][Medline]
Ray, A., Lang, J. D., Golden, T. and Ray, S. (1996). SHORT INTEGUMENT (SIN1), a gene required for ovule development in Arabidopsis, also controls flowering time. Development 122,2631 -2638.[Abstract]
Reinhart, B. J., Slack, F. J., Basson, M., Pasquinelli, A. E., Bettinger, J. C., Rougvie, A. E., Horvitz, H. R. and Ruvkun, G. (2000). The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403,901 -906.[CrossRef][Medline]
Reinhart, B. J., Weinstein, E. G., Rhoades, M. W., Bartel, B.
and Bartel, D. P. (2002). MicroRNAs in plants.
Genes Dev. 16,1616
-1626.
Rhoades, M. W., Reinhart, B. J., Lim, L. P., Burge, C. B., Bartel, B. and Bartel, D. P. (2002). Prediction of plant microRNA targets. Cell 110,513 -520.[CrossRef][Medline]
Schmid, M., Uhlenhaut, N. H., Godard, F., Demar, M., Bressan,
R., Weigel, D. and Lohmann, J. U. (2003). Dissection of
floral induction pathways using global expression analysis.
Development 130,6001
-6012.
Schwab, R., Palatnik, J. F., Riester, M., Schommer, C., Schmid, M. and Weigel, D. (2005). Specific effects of microRNAs on the plant transcriptome. Dev. Cell 8, 517-527.[CrossRef][Medline]
Scott, D. B., Jin, W., Ledford, H. K., Jung, H. S. and Honma, M.
A. (1999). EAF1 regulates vegetative-phase change and
flowering time in Arabidopsis. Plant Physiol.
120,675
-684.
Senecoff, J. F., McKinney, E. C. and Meagher, R. B. (1996). De novo purine synthesis in Arabidopsis thaliana. II. The PUR7 gene encoding 5 '-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase is expressed in rapidly dividing tissues. Plant Physiol. 112,905 -917.[Abstract]
Silverstone, A. L., Mak, P. Y., Martinez, E. C. and Sun, T. P. (1997). The new RGA locus encodes a negative regulator of gibberellin response in Arabidopsis thaliana.Genetics 146,1087 -1099.[Abstract]
Stone, J. M., Liang, X., Nekl, E. R. and Stiers, J. J. (2005). Arabidopsis AtSPL14, a plant-specific SBP-domain transcription factor, participates in plant development and sensitivity to fumonisin B1. Plant J. 41,744 -754.[CrossRef][Medline]
Telfer, A. and Poethig, R. S. (1998). HASTY: a gene that regulates the timing of shoot maturation in Arabidopsis thaliana. Development 125,1889 -1898.[Abstract]
Telfer, A., Bollman, K. M. and Poethig, R. S. (1997). Phase change and the regulation of trichome distribution in Arabidopsis thaliana. Development 124,645 -654.[Abstract]
Unte, U. S., Sorensen, A. M., Pesaresi, P., Gandikota, M.,
Leister, D., Saedler, H. and Huijser, P. (2003).
SPL8, an SBP-box gene that affects pollen sac development in
Arabidopsis. Plant Cell
15,1009
-1019.
Vaucheret, H., Vazquez, F., Crete, P. and Bartel, D. P.
(2004). The action of ARGONAUTE1 in the miRNA pathway
and its regulation by the miRNA pathway are crucial for plant development.
Genes Dev. 18,1187
-1197.
Wang, X. J., Gaasterland, T. and Chua, N. H. (2005a). Genome-wide prediction and identification of cis-natural antisense transcripts in Arabidopsis thaliana. Genome Biol. 6,R30 .[CrossRef][Medline]
Wang, H., Nussbaum-Wagler, T., Li, B., Zhao, Q., Vigoroux, Y., Faller, M., Bomblies-Yant, K., Lukens, L. and Doebley, J. (2005b). The origin of the naked grains of maize. Nature 436,714 -719.[CrossRef][Medline]
Williams, L., Carles, C. C., Osmont, K. S. and Fletcher, J.
C. (2005). A database analysis method identifies an
endogenous trans-acting short-interfering RNA that targets the Arabidopsis
ARF2, ARF3, and ARF4 genes. Proc. Natl. Acad. Sci.
USA 102,9703
-9708.
Xie, Z., Allen, E., Fahlgren, N., Calamar, A., Givan, S. A. and
Carrington, J. C. (2005). Expression of Arabidopsis
miRNA genes. Plant Physiol.
138,2145
-2154.
Yamada, K., Lim, J., Dale, J. M., Chen, H., Shinn, P., Palm, C.
J., Southwick, A. M., Wu, H. C., Kim, C., Nguyen, M. et al.
(2003). Empirical analysis of transcriptional activity in the
Arabidopsis genome. Science
302,842
-846.
Yoshikawa, M., Peragine, A., Park, M. Y. and Poethig, R. S.
(2005). A pathway for the biogenesis of trans-acting
siRNAs in Arabidopsis. Genes Dev.
19,2164
-2175.
Related articles in Development:
This article has been cited by other articles:
![]() |
B. D. Pant, M. Musialak-Lange, P. Nuc, P. May, A. Buhtz, J. Kehr, D. Walther, and W.-R. Scheible Identification of Nutrient-Responsive Arabidopsis and Rapeseed MicroRNAs by Comprehensive Real-Time Polymerase Chain Reaction Profiling and Small RNA Sequencing Plant Physiology, July 1, 2009; 150(3): 1541 - 1555. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Baga, D. B. Fowler, and R. N. Chibbar Identification of genomic regions determining the phenological development leading to floral transition in wheat (Triticum aestivum L.) J. Exp. Bot., June 24, 2009; (2009) erp199v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Smith, M. R. Willmann, G. Wu, T. Z. Berardini, B. Moller, D. Weijers, and R. S. Poethig Cyclophilin 40 is required for microRNA activity in Arabidopsis PNAS, March 31, 2009; 106(13): 5424 - 5429. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Usami, G. Horiguchi, S. Yano, and H. Tsukaya The more and smaller cells mutants of Arabidopsis thaliana identify novel roles for SQUAMOSA PROMOTER BINDING PROTEIN-LIKE genes in the control of heteroblasty Development, March 15, 2009; 136(6): 955 - 964. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Kim, H. R. Woo, J. Kim, P. O. Lim, I. C. Lee, S. H. Choi, D. Hwang, and H. G. Nam Trifurcate Feed-Forward Regulation of Age-Dependent Cell Death Involving miR164 in Arabidopsis Science, February 20, 2009; 323(5917): 1053 - 1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-G. Joung and Z. Fei Identification of microRNA regulatory modules in Arabidopsis via a probabilistic graphical model Bioinformatics, February 1, 2009; 25(3): 387 - 393. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Coupland Mechanisms and variation in plant development: sorting the wood from the trees in Vermont Development, December 1, 2008; 135(23): 3813 - 3816. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lauter, M. J. Moscou, J. Habiger, and S. P. Moose Quantitative Genetic Dissection of Shoot Architecture Traits in Maize: Towards a Functional Genomics Approach The Plant Genome, November 1, 2008; 1(2): 99 - 110. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-I. Itoh, Y. Sato, and Y. Nagato The SHOOT ORGANIZATION2 Gene Coordinates Leaf Domain Development Along the Central-Marginal Axis in Rice Plant Cell Physiol., August 1, 2008; 49(8): 1226 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Wang, R. Schwab, B. Czech, E. Mica, and D. Weigel Dual Effects of miR156-Targeted SPL Genes and CYP78A5/KLUH on Plastochron Length and Organ Size in Arabidopsis thaliana PLANT CELL, May 1, 2008; 20(5): 1231 - 1243. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M. Ehrenreich and M. D. Purugganan Sequence Variation of MicroRNAs and Their Binding Sites in Arabidopsis Plant Physiology, April 1, 2008; 146(4): 1974 - 1982. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. George, S. M. Romanowsky, J. F. Harper, and R. A. Sharrock The ACA10 Ca2+-ATPase Regulates Adult Vegetative Development and Inflorescence Architecture in Arabidopsis Plant Physiology, February 1, 2008; 146(2): 716 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
Flowering Newsletter bibliography for 2006 J. Exp. Bot., April 20, 2007; (2007) erm028v2. [Full Text] [PDF] |
||||
![]() |
R.S. POETHIG, A. PERAGINE, M. YOSHIKAWA, C. HUNTER, M. WILLMANN, and G. WU The Function of RNAi in Plant Development Cold Spring Harb Symp Quant Biol, January 1, 2006; 71(0): 165 - 170. [Abstract] [PDF] |
||||
![]() |
G.J. HANNON, F.V. RIVAS, E.P. MURCHISON, and J.A. STEITZ The Expanding Universe of Noncoding RNAs Cold Spring Harb Symp Quant Biol, January 1, 2006; 71(0): 551 - 564. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||