|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 August 2006
doi: 10.1242/dev.02547
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Cell and Molecular Biology Graduate Group, University of Pennsylvania School
of Medicine, 364 Clinical Research Building, 415 Curie Blvd, Philadelphia, PA
19104, USA.
2 Department of Medicine (Hematology-Oncology), University of Pennsylvania
School of Medicine, 364 Clinical Research Building, 415 Curie Blvd,
Philadelphia, PA 19104, USA.
* Author for correspondence (e-mail: pklein{at}mail.med.upenn.edu)
Accepted 18 July 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Kermit 2, GIPC, Insulin like growth factor (IGF), IGF1 receptor (IGF1R), Eye development, Xenopus
| INTRODUCTION |
|---|
|
|
|---|
i)
(De Vries et al., 1998b
subunits
(El Mourabit et al., 2002
Previously, we identified a Xenopus homolog of GIPC, kermit
(Tan et al., 2001
), that is
72% identical to mammalian GIPC (De Vries
et al., 1998b
). Knockdown of kermit using antisense morpholino
oligonucleotides blocked neural crest induction by Xenopus frizzled 3
in ectodermal (animal cap) explants (Tan
et al., 2001
), but did not inhibit neural crest formation in whole
embryos. We reasoned that this negative result may indicate the presence of a
compensating or redundant activity in whole embryos that is absent in animal
cap explants. We therefore identified a second kermit gene (67% amino
acid identity with kermit 1) in Xenopus early embryos to study the
redundancy between kermit and kermit2. Unexpectedly, we
discovered a novel function for kermit 2 in IGF signaling that does not
overlap with kermit 1.
Kermit 2 is identical to XGIPC, identified in a yeast two hybrid screen for
IGF1 receptor binding proteins in Xenopus oocytes
(Booth et al., 2002
).
XGIPC/kermit 2 binds to the cytoplasmic domain of the Xenopus IGF1R
and this interaction appears to require the PDZ domain of XGIPC.
Overexpression of C-terminal truncation mutants of XGIPC that retain the PDZ
domain blocks insulin-induced Xenopus MAP kinase activation and
oocyte maturation. Human GIPC was also identified as a binding partner for
human IGF1R (Ligensa et al.,
2001
).
IGF signaling has been recently implicated in neural induction in
Xenopus and zebrafish embryos
(Eivers et al., 2004
;
Pera et al., 2003
;
Pera et al., 2001
;
Richard-Parpaillon et al.,
2002
). Ectopic expression of IGF in dorsal cells leads to the
induction of ectopic eyes and eye expansion and, when expressed in ventral
cells, induces secondary head-like structures
(Pera et al., 2001
;
Richard-Parpaillon et al.,
2002
). Inhibition of IGF signaling by either dominant-negative
IGF1R or IGF1R depletion reduces head structures
(Pera et al., 2001
;
Richard-Parpaillon et al.,
2002
). As kermit 2/XGIPC physically interacts with XIGF1R, we
examined the involvement of kermit 2/XGIPC in IGF signaling in
Xenopus embryonic development.
We report here that kermit2/XGIPC is expressed throughout
Xenopus early embryonic development and is localized to the anterior
region during neurula stage in a pattern highly similar to XIGF1R
(Richard-Parpaillon et al.,
2002
). Knockdown of kermit 2 leads to embryos with reduced
anterior structures, specifically reduction in the presumptive eye region.
Furthermore, depletion of kermit 2 and expression of dominant-negative XIGF1R
synergistically inhibit eye development. Kermit 2 is required for IGF1 induced
eye formation in whole embryos and for the induction of eye molecular markers
in ectodermal explants. Finally, we present evidence that kermit 2 is required
to maintain IGF/PI3 kinase-dependent activation of AKT. These results indicate
that kermit 2/XGIPC is required for IGF signaling in Xenopus eye
development likely through its interaction with the IGF1 receptor.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RT-PCR
RNA isolation and RT-PCR methods are described elsewhere
(Yang et al., 2002
). Primers
for EF-1
(Yang et al.,
2002
), ODC (Yang et
al., 2002
), Otx2 (Cox
and Hemmati-Brivanlou, 1995
), En2
(Hemmati-Brivanlou et al.,
1994
), muscle actin
(Hemmati-Brivanlou and Melton,
1994
), XAG (Blitz and
Cho, 1995
) and Xrx
(Mathers et al., 1997
) have
been described previously. Primers were designed to detect kermit2
(upstream, ATGCCTCTGGGATTGCGCGTAAAG; downstream, TTTAACTTTGTCAATCGTGCTCTC),
HoxD1 (upstream, CACTTCTTGCGGGGATGTTT; downstream,
AGAGTCCTGTAGCTCAGCTG), Pax6 (by N. Hirsch and W. Harris; upstream,
AGTGTCCTCATTCACATCG; downstream, AGTACTGAGACATGTCAGG) and Vent1
(upstream, GCATCTCCTTGGCATATTTGG; downstream, TTCCCTTCAGCATGGTTCAAC).
Lineage tracing and in situ hybridization
Embryos were co-injected with RNA encoding ß-galactosidase with a
nuclear localization motif and control morpholino or kermit 2 morpholino
(5'-AGAGGCATCTTTCTTTCAGCGAAGG-3'). ß-Galactosidase activity
was visualized in embryos with Red-Gal (Research organics). Whole-mount in
situ hybridization was performed as described
(Deardorff et al., 1998
).
Antisense probes detected chordin
(Sasai et al., 1994
),
gooscoid (Blumberg et al.,
1991
), Bf1
(Papalopulu and Kintner,
1996
), Otx2 (Lamb et
al., 1993
), Pax6
(Hirsch and Harris, 1997
) and
Xrx (Mathers et al.,
1997
). For sense probes, kermit 2/pCS2 was linearized by
NotI and transcribed by Sp6 polymerase. For antisense probes, kermit
2/pCS2 was linearized by BamHI and transcribed by T7 polymerase.
Embryos, microinjection, immunoprecipitation and immunoblotting
Eggs were obtained from Xenopus females, in vitro fertilized and
microinjected as described (Deardorff et
al., 1998
). Each injected blastomere received 10 nl of RNA or
morpholino. For unilateral injections, morpholino and/or mRNA were injected
into one dorsal blastomere at the four-cell stage. Animal pole explants assays
were performed as described previously
(Deardorff et al., 2001
). For
immunoprecipitation, Xenopus embryos were injected in the animal pole
at the one-cell stage, cultured to stage 10 and lysed in embryo lysis buffer
[20 mM Tris (pH 7.5), 140 mM NaCl, 10% glycerol, 1 mM DTT, 2 mM sodium
vanadate, 25 mM NaF, 1% Nonidet P-40 and protease inhibitor cocktail for
mammalian cells (Sigma)]. Anti-GFP monoclonal antibody (1 µl) (Roche, 1 814
460) was incubated with 250 µl of cleared lysate overnight at 4°C,
collected on 30 µl protein G agarose beads (Invitrogen, 15920-010) for 1
hour, washed three times with PBS, and analyzed by western blot using IGF1R
antibody (Cell Signaling, 3022). AKT, P-AKT, MAPK, P-MAPK and ß-tubulin
antibodies are from Sigma (p2482), Cell Signaling (9271), Cell Signaling
(9102), Sigma (M9692) and BD Biosciences (556321), respectively.
TUNEL assay and phosphorylated histone H3 staining
Phosphorylated histone H3 staining was performed as described
(Bellmeyer et al., 2003
). TUNEL
staining protocol was from
www.xenbase.org
| RESULTS |
|---|
|
|
|---|
Kermit2/XGIPC is required for eye development
To study the endogenous function of kermit 2/XGIPC in Xenopus
embryos, we depleted kermit 2 using morpholino antisense oligonucleotides. The
kermit 2 morpholino blocked translation of kermit 2-GFP mRNA
containing the endogenous 5'UTR but had no effect on kermit
2-GFP mRNA lacking the 5'UTR
(Fig. 2A). Unilateral injection
(into one dorsal blastomere at the four-cell stage) of kermit 2 morpholino
strongly inhibited anterior development, especially eye development, in a
dose-dependent manner (Fig. 2B;
data not shown). Although there was a distribution of phenotypes, 60%
(n=38) of embryos receiving 40 ng of kermit 2 morpholino developed
without any detectable eyes on the injected side and 32% had small eyes
(Fig. 2B). Co-injection of
kermit2-GFP mRNA lacking the morpholino target sequence restored eye
formation in 72% (n=43) of kermit2-depleted embryos, and of
these, 28% appeared completely normal (Fig.
2B). kermit2-GFP mRNA alone did not cause apparent
developmental defects. In addition, bilateral injection of kermit 2 morpholino
caused absent or miniscule eyes in 83% (n=73) of embryos, and this
effect was reversed in 60% (n=85) of embryos co-injected with the
kermit2-GFP rescuing mRNA, although bilateral injections were also
associated with more severe trunk defects that were not completely rescued by
kermit2-GFP (data not shown). These results suggest that the reduced
eye formation phenotype is specifically due to loss of kermit 2.
To characterize further the kermit 2 loss-of-function phenotype, we analyzed molecular markers at various stages by in situ hybridization. Kermit 2 depletion disrupted anterior development, which could indicate direct inhibition of anterior neural development or could alternatively indicate mild ventralization. To examine whether kermit 2 plays a role in dorsal development, we examined the expression of the dorsal organizer genes chordin and goosecoid. Kermit 2 or control morpholinos were injected into two dorsal animal blastomeres of four-cell/eight-cell embryos, and chordin or goosecoid expression was assessed at the early gastrula stage (Fig. 3A-D). Expression of chordin and goosecoid was not affected by depletion of kermit 2, suggesting that loss of kermit 2 does not disrupt early dorsal specification. We then examined the expression of the anterior neural markers Bf1 (a forebrain marker), Otx2 (expressed in the forebrain, eyes and anterior midbrain) and Pax6 (a forebrain and eye marker) at the neurula stage (stage 20). To our surprise, unilateral injection of kermit 2 morpholino into dorsoanimal blastomeres did not obviously affect Bf1 expression (80% no change, n=45, Fig. 3F). Furthermore Pax6 and Otx2 expression were reduced only in the presumptive eye domain (Pax6, 93% eye reduction, n=75; Otx2, 81% eye reduction, n=32, Fig. 3H,J). Pax6 expression in the spinal cord was not affected. Consistent with an apparently eye-specific phenotype, the expression of the eye-specific markers Xrx (85% reduction, n=32, Fig. 3L) and Xath5 (data not shown) was also strongly reduced by kermit 2 depletion. This eye-specific phenotype is probably due to loss of kermit 2, as co-injection of kermit2 mRNA lacking the 5'UTR partially recovered Xrx expression in 73% (n=26, Fig. 3S, compared with 3R and 3L) of kermit 2-depleted embryos. We also analyzed the expression of Xrx and Pax6 at earlier stages of development (early neurula stage, stage 14) and found that depletion of kermit 2 did not have an obvious effect on Xrx (74% no change, n=49, Fig. 3N) or Pax6 (84% no change, n=50, Fig. 3P) expression at this stage, suggesting that kermit 2 is required for the maintenance, but not the initiation, of eye formation.
|
|
|
Kermit 2/XGIPC is required for IGF1 induced eye formation
In order to test the requirement of kermit 2/XGIPC for IGF signaling, we
examined whether depletion of kermit 2 inhibits IGF function in embryos.
Dorsal overexpression of IGF1 mRNA has been shown to induce ectopic
eyes and overgrowth of endogenous eyes
(Pera et al., 2001
;
Richard-Parpaillon et al.,
2002
). We found similarly that dorsal injection of XIGF1
mRNA caused expanded eyes in 64% (n=22) of the embryos. Depletion of
kermit 2 dramatically inhibited the XIGF1 induced eye phenotype and led to
embryos (73%, n=20) with small eyes or no eyes
(Fig. 5A). Kermit 2 depletion
alone reduced eye formation (similar to
Fig. 2). Dorsal injection of
IGF1 mRNA also expanded cement gland formation in embryos, but this
phenotype was not affected by kermit 2 depletion.
Kermit 2 is also required for IGF induced expression of eye markers in
animal cap explants. As reported (Pera et
al., 2001
; Richard-Parpaillon
et al., 2002
), expression of IGF1 alone in animal caps
induces anterior neural markers (Fig.
5B, lane 4), including XAG (a cement gland marker),
Otx2 (a marker for the forebrain and anterior midbrain),
Pax6 (a marker for eyes and the forebrain) and Xrx (an eye
marker), but not the midbrain-hindbrain boundary marker En2 or the
mesodermal marker muscle actin. Kermit 2 depletion strongly reduced
the induction of Xrx, mildly reduced Pax6 induction, and did
not affect the induction of the anterior neural markers XAG and
Otx2 (lane 6). Co-injection of control morpholino did not affect any
of the IGF1-induced markers (lane 5). These results suggest that
kermit 2/XGIPC is required for IGF1-induced eye formation in
Xenopus.
|
This analysis was extended to ectodermal (animal cap) explants. Compared with oocytes, animal caps have high levels of endogenous AKT and MAP kinase phosphorylation/activation. We first tested the effect of kermit 2 morpholino on the endogenous phosphorylation of AKT and MAP kinase. Control morpholino or kermit 2 morpholino was injected into fertilized eggs. Animal caps were dissected at the late blastula stage (stage 9) and cultured for 2 hours (stage 10/10.5) or overnight (stage 20). Similar to the result in oocytes, kermit 2 depletion inhibited AKT phosphorylation/activation after overnight incubation, but not after 2 hours incubation; kermit 2 morpholino had no effect on MAP kinase phosphorylation (Fig. 6B). To test whether kermit 2 is required for AKT phosphorylation/activation by exogenous IGF1, embryos were injected with IGF1 mRNA with or without kermit 2 morpholino, animal caps were explanted at the blastula stage and cultured until late neurula stage (stage 20). We found that kermit 2 depletion blocked phosphorylation/activation of AKT by overexpressed IGF1 (Fig. 6C, compare lane 5 with lane 4). (Kermit 2 morpholino did not interfere with translation of injected mRNAs, as GFP mRNA co-injected with IGF1 mRNA was expressed at equal levels with or without kermit 2 morpholino co-injection.) Taken together, the results in oocytes and animal cap explants suggest that kermit 2/XGIPC is required for maintaining IGF induced AKT activation, but not for MAPK activation.
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
kermit 2/XGIPC and IGF signaling in Xenopus embryonic development
Inhibition of IGF signaling in Xenopus by either dominant-negative
IGF receptor or IGF receptor depletion disrupts anterior neural development
broadly (Pera et al., 2001
;
Richard-Parpaillon et al.,
2002
), yet loss of kermit 2/XGIPC specifically inhibits eye
formation without apparent effect on other aspects of anterior neural
development. At least two mechanisms could explain the morerestricted
requirement for kermit 2/XGPIC. First, depletion of kermit 2 blocks the
activation of AKT, but not of MAPK. It is likely that the IGF/PI3K/AKT branch
is specifically involved in eye formation, while the IGF/MAPK branch regulates
anterior neural development more broadly. Indeed, IGF inhibits SMAD1 activity
and induces neural differentiation via MAPK
(Pera et al., 2003
;
Kuroda et al., 2005
). Second,
eye development could have a distinct temporal requirement for IGF signaling.
For example, the specification of anterior neural tissue in general may only
require an early exposure to IGF, whereas proper eye formation may require
continual activation of IGF signaling. As kermit 2/XGIPC is required for the
maintenance, but not the initiation of IGF signaling, depletion of kermit
2/XGIPC may inhibit eye formation only at late neurula stages, without
disrupting general neural specification.
We also found that depletion of kermit 2 dramatically increases cell death in embryos, but does not reduce cell proliferation. This result is consistent with the data that kermit 2 depletion blocks IGF induced AKT activation, not MAPK activation. However, the increased cell death in kermit 2-depleted embryos is not restricted to the presumptive eye field. Thus, the extent to which increased cell death contributes to the eye phenotype remains to be established.
Regulation of the IGF1 receptor by kermit 2/XGIPC
As kermit 2/XGIPC functions downstream of the IGF ligand and upstream of
PI3 kinase and physically associates with the XIGF1R, kermit 2 probably
regulates IGF signaling through modulation of the receptor. In principle,
kermit 2 could regulate the stability, activity or subcellular localization of
the receptor. However, kermit 2 depletion did not obviously reduce the level
of XIGF1R under conditions that reduced AKT activation (data not shown),
arguing against kermit 2 regulation of IGF1R stability. Furthermore, kermit 2
depletion did not significantly affect the level of IGF-induced MAPK
phosphorylation, arguing against a role for kermit 2 in regulating overall
stability or activity of the IGF1R. Kermit 2 depletion also did not interfere
with the early (30 minute) phosphorylation of AKT in response to IGF,
suggesting that coupling to downstream signaling, at least initially, is
intact.
Alternatively, mammalian GIPC is involved in the regulation of endocytic
trafficking, and kermit 2/XGIPC may similarly regulate the subcellular
localization of the IGF receptor. A function for GIPC in endocytic trafficking
was first proposed based on its localization to endocytic vesicles
(Dance et al., 2004
;
De Vries et al., 1998a
;
De Vries et al., 1998b
;
Jeanneteau et al., 2004a
;
Lou et al., 2002
;
Lou et al., 2001
). For
example, GIPC is enriched at clathrin-rich invaginations and the endocytic
compartments found between microvilli in proximal tubule kidney cells
(Lou et al., 2002
). A role for
GIPC in endocytosis is also supported by functional studies in cultured cells
(Hirakawa et al., 2003
;
Jeanneteau et al., 2004a
).
Hirakawa et al. used RNAi to knockdown GIPC in 293 cells and found that GIPC
is partially responsible for maintaining a relatively constant level of the
human lutropin receptor (LHR) at the cell surface during ligand-induced
internalization and for recycling of the ligand (CG)
(Hirakawa et al., 2003
). In a
similar manner, kermit 2 could be required for the recycling of the IGF1R to
the plasma membrane after ligand-dependent internalization. A failure to
recycle internalized IGF1R could explain why depletion of kermit 2 reduces AKT
phosphorylation after prolonged exposure to IGF, but not after short-term
exposure. A defect in recycling of IGF1R would not be expected to disrupt MAP
kinase phosphorylation, as MAP kinase can be activated by receptors that have
been internalized in association with ß-arrestin and component kinases of
the MAPK cascade (DeFea et al.,
2000
; Lefkowitz and Shenoy,
2005
; Lin et al.,
1998
; Luttrell et al.,
2001
; Tohgo et al.,
2003
), while AKT and PI3 kinase have not been reported to be
activated by internalized receptors within endosomes. However, we have so far
been unable to demonstrate an effect of kermit 2 depletion on IGF1R
trafficking, and this will remain a focus of future studies.
In summary, we have shown that kermit 2/XGIPC is required for eye development in Xenopus embryos. Kermit 2/XGIPC physically and functionally interacts with the IGF1R and is required for IGF signaling in anterior neural development specifically in eye formation. Expression of molecular markers of eye development is induced but not maintained in kermit 2-depleted embryos, and phosphorylation of AKT is similarly induced but not maintained after prolonged exposure to IGF when kermit 2 is depleted. Eye development can be partially rescued in kermit 2-depleted embryos by an active PI3 kinase. Based on these observations, we propose that kermit 2/XGIPC, through the modulation of IGF1R, mediates endogenous IGF signaling in Xenopus eye formation.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice,
N., Cohen, P. and Hemmings, B. A. (1996). Mechanism of
activation of protein kinase B by insulin and IGF-1. EMBO
J. 15,6541
-6551.[Medline]
Bellmeyer, A., Krase, J., Lindgren, J. and LaBonne, C.
(2003). The protooncogene c-myc is an essential regulator of
neural crest formation in xenopus. Dev. Cell
4, 827-839.[CrossRef][Medline]
Blitz, I. and Cho, K. (1995). Anterior
neurectoderm is progressively induced during gastrulation: the role of the
Xenopus homeobox gene orthodenticle. Development
121,993
-1004.[Abstract]
Blobe, G. C., Liu, X., Fang, S. J., How, T. and Lodish, H.
F. (2001). A novel mechanism for regulating transforming
growth factor beta (TGF-beta) signaling. Functional modulation of type III
TGF-beta receptor expression through interaction with the PDZ domain protein,
GIPC. J. Biol. Chem.
276,39608
-39617.
Blumberg, B., Wright, C. V., De Robertis, E. M. and Cho, K.
W. (1991). Organizer-specific homeobox genes in Xenopus
laevis embryos. Science
253,194
-196.
Bohlson, S. S., Zhang, M., Ortiz, C. E. and Tenner, A. J.
(2005). CD93 interacts with the PDZ domain-containing adaptor
protein GIPC: implications in the modulation of phagocytosis. J.
Leukoc. Biol. 77,80
-89.
Booth, R. A., Cummings, C., Tiberi, M. and Liu, X. J.
(2002). GIPC participates in G protein signaling downstream of
insulin-like growth factor 1 receptor. J. Biol. Chem.
277,6719
-6725.
Cai, H. and Reed, R. R. (1999). Cloning and
characterization of neuropilin-1-interacting protein: a PSD-95/Dlg/ZO-1
domain-containing protein that interacts with the cytoplasmic domain of
neuropilin-1. J. Neurosci.
19,6519
-6527.
Carballada, R., Yasuo, H. and Lemaire, P.
(2001). Phosphatidylinositol-3 kinase acts in parallel to the ERK
MAP kinase in the FGF pathway during Xenopus mesoderm induction.
Development 128,35
-44.[Abstract]
Cox, W. G. and Hemmati-Brivanlou, A. (1995).
Caudalization of neural fate by tissue recombination and bFGF.
Development 121,4349
-4358.[Abstract]
Dance, A. L., Miller, M., Seragaki, S., Aryal, P., White, B.,
Aschenbrenner, L. and Hasson, T. (2004). Regulation of
myosin-VI targeting to endocytic compartments. Traffic
5, 798-813.[CrossRef][Medline]
De Vries, L., Elenko, E., McCaffery, J. M., Fischer, T., Hubler,
L., McQuistan, T., Watson, N. and Farquhar, M. G. (1998a).
RGS-GAIP, a GTPase-activating protein for Galphai heterotrimeric G proteins,
is located on clathrin-coated vesicles. Mol. Biol.
Cell 9,1123
-1134.
De Vries, L., Lou, X., Zhao, G., Zheng, B. and Farquhar, M.
G. (1998b). GIPC, a PDZ domain containing protein, interacts
specifically with the C terminus of RGS-GAIP. Proc. Natl. Acad.
Sci. USA 95,12340
-12345.
Deardorff, M. A., Tan, C., Conrad, L. J. and Klein, P. S.
(1998). Frizzled-8 is expressed in the Spemann organizer and
plays a role in early morphogenesis. Development
125,2687
-2700.[Abstract]
Deardorff, M. A., Tan, C., Saint-Jeannet, J. P. and Klein, P.
S. (2001). A role for frizzled 3 in neural crest development.
Development 128,3655
-3663.
DeFea, K. A., Zalevsky, J., Thoma, M. S., Dery, O., Mullins, R.
D. and Bunnett, N. W. (2000). beta-arrestin-dependent
endocytosis of proteinase-activated receptor 2 is required for intracellular
targeting of activated ERK1/2. J. Cell Biol.
148,1267
-1281.
Eivers, E., McCarthy, K., Glynn, C., Nolan, C. M. and Byrnes,
L. (2004). Insulin-like growth factor (IGF) signalling is
required for early dorso-anterior development of the zebrafish embryo.
Int. J. Dev. Biol. 48,1131
-1140.[CrossRef][Medline]
El Mourabit, H., Poinat, P., Koster, J., Sondermann, H., Wixler,
V., Wegener, E., Laplantine, E., Geerts, D., Georges-Labouesse, E.,
Sonnenberg, A. et al. (2002). The PDZ domain of TIP-2/GIPC
interacts with the C-terminus of the integrin alpha5 and alpha6 subunits.
Matrix Biol. 21,207
-214.[CrossRef][Medline]
Favre-Bonvin, A., Reynaud, C., Kretz-Remy, C. and Jalinot,
P. (2005). Human papillomavirus type 18 E6 protein binds the
cellular PDZ protein TIP-2/GIPC, which is involved in transforming growth
factor beta signaling and triggers its degradation by the proteasome.
J. Virol. 79,4229
-4237.
Hasson, T. (2003). Myosin VI: two distinct
roles in endocytosis. J. Cell Sci.
116,3453
-3461.
Hemmati-Brivanlou, A. and Melton, D. A. (1994).
Inhibition of activin signalling promotes neuralization in Xenopus laevis.Cell 77,273
-281.[CrossRef][Medline]
Hemmati-Brivanlou, A., Kelley, O. G. and Melton, D. A.
(1994). Follistatin, an antagonist of activin, is present in the
Spemann organizer and displays direct neuralizing activity.
Cell 77,283
-295.[CrossRef][Medline]
Hirakawa, T., Galet, C., Kishi, M. and Ascoli, M.
(2003). GIPC binds to the human lutropin receptor (hLHR) through
an unusual PDZ domain binding motif, and it regulates the sorting of the
internalized human choriogonadotropin and the density of cell surface hLHR.
J. Biol. Chem. 278,49348
-49357.
Hirsch, N. and Harris, W. A. (1997). Xenopus
Pax-6 and retinal development. J. Neurobiol.
32, 45-61.[CrossRef][Medline]
Hu, L. A., Chen, W., Martin, N. P., Whalen, E. J., Premont, R.
T. and Lefkowitz, R. J. (2003). GIPC interacts with the
beta1-adrenergic receptor and regulates beta1-adrenergic receptor-mediated ERK
activation. J. Biol. Chem.
278,26295
-26301.
Jeanneteau, F., Diaz, J., Sokoloff, P. and Griffon, N.
(2004a). Interactions of GIPC with dopamine D2, D3 but not D4
receptors define a novel mode of regulation of G protein-coupled receptors.
Mol. Biol. Cell 15,696
-705.
Jeanneteau, F., Guillin, O., Diaz, J., Griffon, N. and Sokoloff,
P. (2004b). GIPC recruits GAIP (RGS19) to attenuate dopamine
D2 receptor signaling. Mol. Biol. Cell
15,4926
-4937.
Katoh, M. (2002). GIPC gene family (Review).
Int. J. Mol. Med. 9,585
-589.[Medline]
Kuroda, H., Fuentealba, L., Ikeda, A., Reversade, B. and De
Robertis, E. M. (2005). Default neural induction:
neuralization of dissociated Xenopus cells is mediated by Ras/MAPK activation.
Genes Dev. 19,1022
-1027.
Lamb, T. M., Knecht, A. K., Smith, W. C., Stachel, S. E.,
Economides, A. N., Stahl, N., Yancopolous, G. D. and Harland, R. M.
(1993). Neural Induction by the Secreted Polypeptide Noggin.
Science 262,713
-718.
Lefkowitz, R. J. and Shenoy, S. K. (2005).
Transduction of receptor signals by beta-arrestins.
Science 308,512
-517.
Ligensa, T., Krauss, S., Demuth, D., Schumacher, R., Camonis,
J., Jaques, G. and Weidner, K. M. (2001). A PDZ domain
protein interacts with the C-terminal tail of the insulin-like growth factor-1
receptor but not with the insulin receptor. J. Biol.
Chem. 276,33419
-33427.
Lin, F. T., Daaka, Y. and Lefkowitz, R. J.
(1998). beta-arrestins regulate mitogenic signaling and
clathrin-mediated endocytosis of the insulin-like growth factor I receptor.
J. Biol. Chem. 273,31640
-31643.
Liu, T. F., Kandala, G. and Setaluri, V.
(2001). PDZ domain protein GIPC interacts with the cytoplasmic
tail of melanosomal membrane protein gp75 (tyrosinase-related protein-1).
J. Biol. Chem. 276,35768
-35777.
Lou, X., Yano, H., Lee, F., Chao, M. V. and Farquhar, M. G.
(2001). GIPC and GAIP form a complex with TrkA: a putative link
between G protein and receptor tyrosine kinase pathways. Mol. Biol.
Cell 12,615
-627.
Lou, X., McQuistan, T., Orlando, R. A. and Farquhar, M. G.
(2002). GAIP, GIPC and Galphai3 are concentrated in endocytic
compartments of proximal tubule cells: putative role in regulating megalin's
function. J. Am. Soc. Nephrol.
13,918
-927.
Luttrell, L. M., Roudabush, F. L., Choy, E. W., Miller, W. E.,
Field, M. E., Pierce, K. L. and Lefkowitz, R. J. (2001).
Activation and targeting of extracellular signal-regulated kinases by
beta-arrestin scaffolds. Proc. Natl. Acad. Sci. USA
98,2449
-2454.
Mathers, P. H., Grinberg, A., Mahon, K. A. and Jamrich, M.
(1997). The Rx homeobox gene is essential for vertebrate eye
development. Nature 387,603
-607.[CrossRef][Medline]
O'Connor, R. (2003). Regulation of IGF-I
receptor signaling in tumor cells. Horm. Metab. Res.
35,771
-777.[CrossRef][Medline]
Oldham, S. and Hafen, E. (2003). Insulin/IGF
and target of rapamycin signaling: a TOR de force in growth control.
Trends Cell Biol. 13,79
-85.[CrossRef][Medline]
Papalopulu, N. and Kintner, C. (1996). A
posteriorising factor, retinoic acid, reveals that anteroposterior patterning
controls the timing of neuronal differentiation in Xenopus neuroectoderm.
Development 122,3409
-3418.[Abstract]
Payne, D. M., Rossomando, A. J., Martino, P., Erickson, A. K.,
Her, J. H., Shabanowitz, J., Hunt, D. F., Weber, M. J. and Sturgill, T. W.
(1991). Identification of the regulatory phosphorylation sites in
pp42/mitogen-activated protein kinase (MAP kinase). EMBO
J. 10,885
-892.[Medline]
Pera, E. M., Wessely, O., Li, S. Y. and De Robertis, E. M.
(2001). Neural and head induction by insulin-like growth factor
signals. Dev. Cell 1,655
-665.[CrossRef][Medline]
Pera, E. M., Ikeda, A., Eivers, E. and De Robertis, E. M.
(2003). Integration of IGF, FGF, and anti-BMP signals via Smad1
phosphorylation in neural induction. Genes Dev.
17,3023
-3028.
Richard-Parpaillon, L., Heligon, C., Chesnel, F., Boujard, D.
and Philpott, A. (2002). The IGF pathway regulates head
formation by inhibiting Wnt signaling in Xenopus. Dev.
Biol. 244,407
-417.[CrossRef][Medline]
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K.
and De Robertis, E. M. (1994). Xenopus chordin: a novel
dorsalizing factor activated by organizer-specific homeobox genes.
Cell 79,779
-790.[CrossRef][Medline]
Stephens, L., Anderson, K., Stokoe, D., Erdjument-Bromage, H.,
Painter, G. F., Holmes, A. B., Gaffney, P. R., Reese, C. B., McCormick, F.,
Tempst, P. et al. (1998). Protein kinase B kinases that
mediate phosphatidylinositol 3,4,5-trisphosphate-dependent activation of
protein kinase B.[see comment]. Science
279,710
-714.
Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R.,
Reese, C. B., Painter, G. F., Holmes, A. B., McCormick, F. and Hawkins, P.
T. (1997). Dual role of
phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase
B.[see comment]. Science
277,567
-570.
Tan, C., Deardorff, M. A., Saint-Jeannet, J. P., Yang, J.,
Arzoumanian, A. and Klein, P. S. (2001). Kermit, a frizzled
interacting protein, regulates frizzled 3 signaling in neural crest
development. Development
128,3665
-3674.
Tani, T. T. and Mercurio, A. M. (2001). PDZ
interaction sites in integrin alpha subunits. T14853, TIP/GIPC binds to a type
I recognition sequence in alpha 6A/alpha 5 and a novel sequence in alpha 6B.
J. Biol. Chem. 276,36535
-36542.
Tohgo, A., Choy, E. W., Gesty-Palmer, D., Pierce, K. L.,
Laporte, S., Oakley, R. H., Caron, M. G., Lefkowitz, R. J. and Luttrell, L.
M. (2003). The stability of the G protein-coupled
receptor-beta-arrestin interaction determines the mechanism and functional
consequence of ERK activation. J. Biol. Chem.
278,6258
-6267.
Wang, L. H., Kalb, R. G. and Strittmatter, S. M.
(1999). A PDZ protein regulates the distribution of the
transmembrane semaphorin, M-SemF. J. Biol. Chem.
274,14137
-14146.
Yang, J., Tan, C., Darken, R. S., Wilson, P. A. and Klein, P.
S. (2002). Betacatenin/Tcf-regulated transcription prior to
the midblastula transition. Development
129,5743
-5752.[CrossRef][Medline]
Yung, Y., Dolginov, Y., Yao, Z., Rubinfeld, H., Michael, D.,
Hanoch, T., Roubini, E., Lando, Z., Zharhary, D. and Seger, R.
(1997). Detection of ERK activation by a novel monoclonal
antibody. FEBS Lett.
408,292
-296.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. H. Muders, P. K. Vohra, S. K. Dutta, E. Wang, Y. Ikeda, L. Wang, D. G. Udugamasooriya, A. Memic, C. N. Rupashinghe, G. B. Baretton, et al. Targeting GIPC/Synectin in Pancreatic Cancer Inhibits Tumor Growth Clin. Cancer Res., June 15, 2009; 15(12): 4095 - 4103. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||